Development and utilization of SNP (Single Nucleotide Polymorphism) marker of corn kernel weight-related character
By developing SNP molecular markers related to corn kernel weight, combined with genome-wide association analysis and PCR amplification technology, the problem of difficulty in early selection of corn kernel weight traits in the existing technology is solved, efficient and low-cost breeding selection is achieved, and breeding efficiency is improved.
Patent Information
- Application Number
- CN202510841021.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-23
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2045-06-23
AI Technical Summary
The prior art is difficult to select corn grain weight traits efficiently, early and uninfluenced by the environment in corn breeding, resulting in slow breeding process and high cost.
Developed and utilized SNP molecular markers related to corn kernel weight, and designed primer pairs for PCR amplification by detecting specific sites in the corn genome (C and T polymorphisms at 94bp of SEQ ID No.1), combined with genome-wide association analysis, SNP site S1_52872374, which is significantly associated with grain-heavy traits, was designed for PCR amplification, and early selection of corn grain-heavy traits.
The clear selection goals during the breeding process were achieved, and the heavy traits of corn grains were selected early to improve breeding efficiency and reduce costs. They were suitable for molecular marker assisted breeding and molecular polymerization breeding.
Smart Images

Figure CN120536627A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular breeding, and in particular relates to the development and utilization of a SNP marker for weight-related traits in corn kernels. Background Art
[0002] As my country's largest cultivated crop with the highest yield, corn is crucial to the country's food security. Kernel weight is a key selective trait in high-yield corn breeding. Currently, corn breeding in my country is in the transition phase from traditional phenotypic selection to biological breeding. The development of molecular markers to assist in breeding selection will help accelerate the progress of molecular breeding. Molecular marker-assisted breeding, with its high efficiency, short cycle time, and low cost, has become a routine breeding technique used in corn breeding by international seed companies.
[0003] Currently, molecular marker technology has been widely applied in maize breeding and selection. The development of molecular markers has gone through three stages: the first stage, represented by SSR markers (restriction fragment length polymorphism) and amplified fragment length polymorphism markers; the second stage, represented by SSR markers; and the third stage, represented by InDel and SNP markers. SNP markers, due to their high abundance, wide distribution, and ease of automated detection, are widely used in molecular marker-assisted breeding, germplasm quality control, and variety protection.
[0004] Quantitative trait locus (QTL) mapping is widely used in plants and animals and has become the most common method for locating loci controlling target traits. Genome-wide association studies (GWAS) are an effective method for revealing the complex genetic basis of crop trait variation and have been widely applied to different crops. Maize has a high level of genetic diversity and contains rare alleles in its genome, making it well-suited for GWAS studies to investigate the genetic architecture of grain-related traits. Therefore, combining QTL and GWAS to elucidate the genetic basis of maize grain weight is of great significance for crop improvement. Summary of the Invention
[0005] The present invention provides the development and utilization of a SNP marker for corn kernel weight-related traits, which can realize breeding selection of corn 100-kernel weight traits based on single-point genotype detection.
[0006] The present invention provides a sequence containing a SNP molecular marker with traits heavily correlated with corn kernels. The sequence includes the nucleotide sequence shown in SEQ ID No. 1, and C and T polymorphisms exist at 94 bp of the nucleotide sequence.
[0007] The present invention also provides a primer pair for amplifying the above sequence.
[0008] In a preferred embodiment of the present invention, the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4.
[0009] The present invention also provides an application of a substance for detecting the above sequence in detecting or assisting in detecting corn yield-related traits.
[0010] In a preferred embodiment of the present invention, the corn yield-related traits include corn 100-kernel weight.
[0011] In a preferred embodiment of the present invention, the substance includes the above-mentioned primer pair.
[0012] The present invention also provides a method for detecting corn kernel weight-related traits, comprising using the corn genomic DNA to be tested as a template, performing PCR amplification using the above primer pair, and detecting the base type at 94bp of the amplified product, wherein the corn kernel weight-related traits of the CC genotype are superior to those of the TT type.
[0013] In a preferred embodiment of the present invention, the PCR amplification procedure includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 60 s, 35 cycles; and final extension at 72°C for 5 min.
[0014] The present invention also provides an application of a substance for detecting the above sequence in molecular marker-assisted breeding.
[0015] The present invention also provides a corn breeding method, comprising detecting the genotypes of the parents according to the above method, selecting varieties with CC genotypes as parents for breeding; or selecting varieties or lines with CC genotypes when screening offspring.
[0016] Beneficial effects: The present invention provides a sequence comprising a SNP molecular marker associated with corn kernel weight traits, the sequence comprising the nucleotide sequence of SEQ ID No. 1, and C and T polymorphisms exist at 94 bp of the nucleotide sequence. The present invention identified a major effect QTL on chromosome 1 of the corn genome, located between 19345489 bp and 61943737 bp, through positional cloning. Combined with genome-wide association analysis, a SNP site S1_52872374 significantly associated with the 100-grain weight trait was identified within the QTL, and genotype effect analysis showed that when the site was CC, the 100-grain weight of the corn inbred line material was significantly higher than when the site was TT. The present invention has developed a SNP molecular marker that is tightly linked to the 100-grain weight trait of corn, which can be used to select for the 100-grain weight of corn in breeding. The functional breeding marker developed by this invention for the 100-kernel weight trait of maize kernels allows for assisted selection for this trait in molecular marker-assisted breeding. Simply by testing the genotype of a single locus, selection for this trait can be performed. This method offers the advantages of clear selection targets, early selection, and immunity to environmental influences. Using single-locus genotype testing for selection in maize kernel weight breeding can also be used in molecular polymerized breeding of maize. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 is the genetic map of the RIL population;
[0018] Figure 2 This is the result map of QTL mapping results;
[0019] Figure 3 The distribution map of SNP markers on ten chromosomes;
[0020] Figure 4 This is the density map of 100-grain weight distribution in the associated population;
[0021] Figure 5 Manhattan plots for GWAS analysis;
[0022] Figure 6 This is the T-test result of different equal 100-grain weight values. DETAILED DESCRIPTION
[0023] The present invention provides a sequence containing a SNP molecular marker with traits heavily correlated with corn kernels. The sequence includes the nucleotide sequence shown in SEQ ID No. 1, and C and T polymorphisms exist at 94 bp of the nucleotide sequence.
[0024] The present invention combines QTL mapping and GWAS to identify a SNP site significantly associated with corn 100-grain weight, and develops a breeding marker suitable for assisting in the breeding selection of corn 100-grain weight. The SNP site is located in the sequence shown in SEQ ID No.1, and the 94th position of the sequence shown in SEQ ID No.1 is a polymorphic site.
[0025] SEQ ID No. 1:
[0026] GGACGGATGGAAACGGAAGTATACGCATGACGGTCTTAATGCCTTTTACGAAGCAGCACTTTCAGAGGACGGGACGTAGCAGTACGCGTACCACCACAAGCGCCGGCGATCTCGTATCTGCAGAGCCGATCGCCATTTCCTCCATCGTACGTTTATACAAGGAGGAAGCGGCCGACACGTCACTTTGCCTTTCTTCATTTAATACAAACTCTTGCACGGGACA.
[0027] The present invention also provides a primer pair for amplifying the above sequence.
[0028] In a preferred embodiment of the present invention, the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 3: GGACGGATGGAAACGGAAGT, the Tm value of which is 60.04°C and the GC content is 55%; and also includes a downstream primer as shown in SEQ ID No. 4: TGTCCCGTGCAAGAGTTTGT, the Tm value of which is 60.11°C and the GC content is 50%.
[0029] The present invention also provides an application of a substance for detecting the above sequence in detecting or assisting in detecting corn yield-related traits.
[0030] In a preferred embodiment of the present invention, the substance for detecting the sequence described in SEQ ID No. 1 includes the above-mentioned primer pair, and the corn yield-related trait includes corn 100-kernel weight. Using the primer pair described in the present invention, 364 corn inbred lines were divided into two groups according to the TT allele and the CC allele. Among them, 330 corn inbred lines had a CC genotype and 34 corn inbred lines had a TT genotype. A T-test was performed on the 100-kernel weight values of the two groups, and the p-value was less than 2.22e-16, indicating that there was a difference in 100-kernel weight between the two groups. When the 94bp position of the sequence described in SEQ ID No. 1 was detected as CC using the method of the present invention, the corn material had a higher 100-kernel weight.
[0031] The present invention also provides a method for detecting corn kernel weight-related traits, comprising using the corn genomic DNA to be tested as a template, performing PCR amplification using the above primer pair, and detecting the base type at 94bp of the amplified product, wherein the corn kernel weight-related traits of the CC genotype are superior to those of the TT type.
[0032] In a preferred embodiment of the present invention, the PCR amplification procedure includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 60 s, for 35 cycles; and final extension at 72°C for 5 min.
[0033] The present invention also provides an application of a substance for detecting the above sequence in molecular marker-assisted breeding.
[0034] The primer pairs of the present invention can be used to carry out breeding through molecular marker-assisted breeding, thereby cultivating or screening corn varieties with better 100-grain weight traits.
[0035] The present invention also provides a corn breeding method, comprising detecting the genotypes of the parents according to the above method, selecting varieties with CC genotypes as parents for breeding; or selecting varieties or lines with CC genotypes when screening offspring.
[0036] To further illustrate the present invention, the development and utilization of a SNP marker for weight-related traits in corn kernels provided by the present invention are described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.
[0037] Example 1
[0038] 1. QTL mapping for 100-kernel weight in maize
[0039] The present invention is based on the maize inbred lines SPL01 and SPL02 independently bred by the Shanghai Academy of Agricultural Sciences (both disclosed in the article, Yu, D., Wang, H., Gu, W. et al. Genetic diversity and population structure of popcorn germplasm resources using genome-wide SNPs through genotyping-by-sequencing. Genet Resour Crop Evol 68, 2379-2389 (2021). https: / / doi.org / 10.1007 / s10722-021-01137-0) as parents. After hybridization, they were selfed for 6 generations to construct a recombinant inbred line population (RIL) with a population size of 363.
[0040] A population of RILs was planted at the Zhuangxing base of the Shanghai Academy of Agricultural Sciences for three consecutive springs in 2019, 2020, and 2021. A randomized experimental design was used, with each maize inbred line planted in two rows. Normal irrigation, fertilization, and field management were maintained, and self-pollination was performed. After kernel maturity, three uniformly growing plants were selected, and 100-kernel weight was measured using an automated seed meter. BLUP values for 100-kernel weight were calculated using Meta-R software based on three replicates across three environments.
[0041] The results showed that the minimum 100-grain weight in the RIL population was 4.79g, the maximum was 8.59g, and the average was 6.90g. This result was used for subsequent QTL positioning analysis.
[0042] Genotyping of inbred lines in the RIL population was performed using the GenoBaitsMaize 10K Panel, a maize genotyping chip developed by Shijiazhuang Boredy Biotechnology Co., Ltd., yielding a total of 11,535 SNPs. Filtering was performed using the following criteria: missing rate <5%, heterozygosity <20%, and minor allele frequency >0.05. A total of 988 SNPs were retained. Genetic maps were constructed using ASTMAP software ( Figure 1 The total size of the genetic map was 2,966 cM, and the average genetic distance between SNP markers was 3.17 cM (Table 1).
[0043] Table 1 Genetic map information statistics
[0044] chromosome Genetic distance (cM) Number of SNPs Chr1 484.56 191 Chr2 364.28 95 Chr3 325.53 89 Chr4 316.89 129 Chr5 328.14 132 Chr6 208.90 48 Chr7 259.28 87 Chr8 252.42 68 Chr9 262.90 76 Chr10 163.14 73 total 2966.02 988
[0045] The QTL was located using RQTL software. The marker S1_55391236 on chromosome 1 had the highest lod value of 5.17. The left and right markers were S1_19345489 (lod = 3.43) and 1_61943737 (lod = 3.4), respectively. That is, the QTL interval was between 19345489 bp and 61943737 bp on chromosome 1 ( Figure 2 ).
[0046] 2. Association analysis of corn 100-grain weight traits
[0047] The present invention is based on 370 independently collected maize inbred line materials (Table 2) to conduct genome-wide association analysis of maize grain 100-grain weight traits. First, the CTAB method was used to extract fresh leaf DNA; then, the DNA was sequenced using simplified genome sequencing methods; finally, the sequence obtained by sequencing was aligned to the B73v4 version genome using BWA software, the repeated sequences were removed using picard software, and the HaplotypeCaller module of GATK software was used to identify SNP sites. After obtaining the genotype, bcftools software was used for quality filtering, and the filtering indicators included: 1) retaining biallelic SNP sites; 2) retaining SNP sites with a minor allele genotype frequency greater than or equal to 0.05; 3) removing SNP sites with a sample missing rate greater than 0.05. After quality filtering, a total of 356,290 sites were retained ( Figure 3 ) for subsequent GWAS analysis.
[0048] Table 2370 maize inbred line materials
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055] The association analysis population was planted in the Zhuangxing base of Shanghai Academy of Agricultural Sciences for three consecutive springs in 2019, 2020 and 2021. A randomized experimental design was adopted, and each corn inbred line was planted in 2 rows, with normal water and fertilizer and field management, and self-pollination. After the grains matured, 3 plants with uniform growth were selected, and the 100-grain weight trait of their grains was measured using an automatic seed tester. Meta-R software was used to calculate the BLUP value of 100-grain weight based on three environments and three repetitions. The results showed that the minimum 100-grain weight in the population was 9.42g, the maximum was 32.43g, and the average was 21.17g ( Figure 4 ).
[0056] The threshold of GWAS results was determined using GEC software, with an effective number of SNPs of 125,678 and a p-value of 7.96e-6. Genome-wide association analysis was performed using GEMMA software ( Figure 5 ), a total of 10 SNPs were identified to be significantly associated with 100-grain weight (Table 3).
[0057] Table 3 Information on SNPs significantly associated with 100-grain weight
[0058] chromosome Location Equivalent 1 Equivalency 2 p-value 1 52872374 T C 2.24E-06 2 227550516 T G 2.06E-06 2 227550540 A G 2.06E-06 2 227615906 A G 1.99E-06 2 228061899 A C 5.17E-06 2 229624549 G C 6.03E-06 3 39972604 T G 6.04E-06 4 18421118 G A 3.55E-06 7 168233075 A T 3.05E-06 9 111761280 G A 4.56E-06
[0059] The SNP marker located at 52872374bp on chromosome 1 is within the region of the QTL. The present invention designed primers targeting the S1_52872374 locus and applied them to molecular marker-assisted breeding for the 100-kernel weight trait in maize. The first 200bp before and after this locus were extracted, and the sequence is shown in SEQ ID No. 2:
[0060] CCGGATTCAGCCGTAAGAGACAGTCAAATGGCACCGGGCCATAGATTGGTTAAAAAAAAAACCCTGCTAGTGATGTCTCATTTAGTACATCGGAGTCACTGACGACGGACGGATGGAAACGGAAGTATACGCATGACGGTCTTAATGCCTTTTACGAAGCAGCACTTTCAGAGGACGGGACGTAGCAGTACGCGTACCAC CACAAGCGCCGGCGATCTCGTATCTGCAGAGCCGATCGCCATTTCCTCCATCGTACGTTTACAAGGAGGAAGCGGCCGACACGTCACTTTGCCTTTCTTCTCATTTAATACAAACTCTTGCACGGGACATACTTGAACTGATGAATAACCCCCAATTGAGACATCCGTTTGCACTGCCCGTCCGGTTCGTTGCTAGT.
[0061] Primers were designed using NCBI's Primer-BLAST. The designed primer sequences were shown in SEQ ID No. 3 and SEQ ID No. 4. The amplified product was shown in SEQ ID No. 1. The 94th position of the amplified product sequence was the site to be detected.
[0062] 3. Detecting the effect of the S1_52872374 site
[0063] Using the designed primer pair SEQ ID No.3 and SEQ ID No.4, 364 maize inbred lines (6 of the 370 maize inbred lines were missing) were divided into two groups according to the TT allele and the CC allele. Among them, 330 maize inbred lines had the CC genotype and 34 maize inbred lines had the TT genotype. A T-test was performed on the 100-grain weight values of the two groups, and the p-value was less than 2.22e-16, indicating that the difference in 100-grain weight between the two groups was real ( Figure 6When the S1_52872374 site is detected as CC using the method of the present invention, the kernels of the corn material have a higher 100-kernel weight.
[0064] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A sequence comprising SNP molecular markers associated with maize kernel weight-related traits, characterized in that: The sequence includes the nucleotide sequence shown in SEQ ID No. 1, and C and T polymorphisms exist at 94 bp of the nucleotide sequence.
2. A primer pair for amplifying the sequence of claim 1.
3. The primer pair according to claim 2, characterized in that The primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No.
4.
4. Use of a substance for detecting the sequence of claim 1 in detecting or assisting in detecting corn yield-related traits.
5. The application according to claim 4, characterized in that: The corn yield-related traits include corn 100-kernel weight.
6. The application according to claim 4, characterized in that: The substance includes the primer pair according to claim 2 or 3.
7. A method for detecting corn kernel weight-related traits, characterized in that: The method comprises using the genomic DNA of corn to be tested as a template, performing PCR amplification using the primer pair of claim 2 or 3, and detecting the base type at 94 bp of the amplified product, wherein the weight-related traits of corn kernels of CC genotype are better than those of TT type.
8. The method according to claim 7, characterized in that: The PCR amplification procedure includes: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 60° C. for 15 s, and extension at 72° C. for 60 s, for 35 cycles; and final extension at 72° C. for 5 min.
9. Use of a substance for detecting the sequence of claim 1 in molecular marker-assisted breeding.
10. A corn breeding method, characterized in that: The method comprises detecting the genotype of the parents according to the method of claim 7 or 8, selecting a variety with a CC genotype as a parent for breeding; or selecting a variety or line with a CC genotype when screening offspring.
Citation Information
Patent Citations
Application of Zm00001eb378820 gene in molecular marker-assisted breeding for regulating and controlling hundred-grain weight of corn grains
CN119662708A
SNP (Single Nucleotide Polymorphism) molecular marker closely linked with sweet corn kernel weight major QTL (Quantitative Trait Loci) and application of SNP molecular marker
CN120060546A
Pan-genome genotyping array and uses thereof
WO2023058064A1