Multiplex fluorescent quantitative PCR (polymerase chain reaction) reagent for synchronously detecting human T-cytophilic virus subtypes

Abstract

The invention discloses a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) reagent for synchronously detecting human T-cytophilic virus subtypes. The detection reagent comprises specific primers and probes aiming at human T-cytophilic virus type 1, human T-cytophilic virus type 2, human T-cytophilic virus type 3 and human T-cytophilic virus type 4; according to the present invention, the multiple fluorescence quantitative detection method is adopted, such that the four human T-cytophilic virus subtypes can be simultaneously detected in the single reaction tube, the virus load can be quantified while the virus infection condition is detected, and the significant advantage is provided for the research of the influence of the different gene subtype virus infection states on the clinical diseases. The reagent has the advantages of being high in specificity, high in sensitivity, good in repeatability and reproducibility, easy to operate and the like, the clinical screening speed of the four subtypes of the human T-cytophilic virus can be increased, the detection cost can be saved, and the reagent has high application value for clinical rapid screening diagnosis and clinical disease research.

Description

Technical Field

[0001] The present invention belongs to the technical field of RNA virus detection, and in particular relates to a multiplex fluorescence quantitative PCR reagent for synchronously detecting human T-cell tropic virus subtypes. Technical Background

[0002] Human T-cell leukemia virus (HTLV) is an oncogenic retrovirus classified into four subtypes based on their genomic diversity: HTLV-1, HTLV-2, HTLV-3, and HTLV-4. HTLV primarily infects T lymphocytes and is associated with a variety of human diseases, with HTLV-1 and HTLV-2 being the most closely associated with human disease. Studies have found that although HTLV-1 and HTLV-2 share high similarities in genomic structure, replication patterns, and protein function, their clinical pathogenicity differs significantly. HTLV-1 can cause adult T-cell leukemia / lymphoma (ATLL) and HTLV-associated myelopathy (HAM) / tropical spastic paraparesis (TSP), while HTLV-2 only occasionally causes spinal cord lesions and is primarily associated with lymphocytosis / thrombocytosis and cancer mortality. In addition, the clinical pathogenicity of HTLV-3 and HTLV-4 remains to be studied.

[0003] Currently, the diagnosis of HTLV infection utilizes a two-stage serological testing strategy: an initial screening phase using an enzyme-linked immunosorbent assay (ELISA) or particle agglutination test (PAT), with suspected positive samples further confirmed by Western blot (WB) or line immunoassay (LIA). It should be noted that serological methods alone cannot confirm the current infection status, have a high false-positive rate, and are unable to perform viral typing. In the field of molecular diagnostics, while loop-mediated isothermal amplification (LAMP) technology can directly detect viral nucleic acid, its requirements for precise temperature control and equipment limit its clinical application value. In comparison, real-time fluorescent quantitative polymerase chain reaction (qPCR) has become the gold standard for laboratory testing due to its high sensitivity and specificity. However, traditional single-plex qPCR suffers from issues such as low throughput (only supporting single-target detection per assay), long assay times, and high individual test costs, which limit its effectiveness in large-scale clinical screening. Importantly, there is a lack of multiplex fluorescent quantitative PCR assays capable of simultaneously detecting HTLV-1, HTLV-2, HTLV-3, and HTLV-4. Therefore, developing a multiplex fluorescent quantitative PCR assay for the simultaneous detection of all four subtypes of human T-lymphotropic virus (HTLV) is of great value and significance for efficient and accurate screening and diagnosis of clinical HTLV infection. Summary of the Invention

[0004] To address the shortcomings of existing detection technologies, the present invention has developed a method for the simultaneous detection of human T-lymphotropic virus (HTLV) subtypes based on multiplex fluorescence quantitative PCR. Through the design of specific primers and probes, this method can simultaneously detect all four HTLV-1 subtypes with high sensitivity and specificity. This technology not only accurately distinguishes different HTLV subtypes but also quantifies the viral load of each subtype, providing important technical support for clinical diagnosis and treatment strategy development.

[0005] To achieve the above objectives, the present invention designs specific primers and probes for the highly conserved sequences of HTLV-1, HTLV-2, HTLV-3, and HTLV-4 respectively; The specific primers for human T-lymphotropic virus type 1 were TAYTAGATACAGGAGCRGACATGACA and TATCRACTARGCAAGATGTTAAAACAATA, and the probe was AGCTCACCTCCCTTCCTGTGCTAATACGC; The specific primers for human T-lymphotropic virus type 2 were GAACCCCTCCTGTTGGATCTCYC and GAGGTGTTTGYCCCATAACGGA, and the probe was ATCCCGATCAAGACATCTCRATACTCCCACTC; The primers specific for human T-lymphotropic virus type 3 were CCAAAAAGAACACCRRGGCTCTGA and AGGTYGCTCTCCCCTTTTATAG, and the probe was TCTCTCCCTRCCYTGKCTCCCGGAAAAAAC; The specific primers for human T-lymphotropic virus type 4 are AAAGGTCAACTGTCTCACACAAATAA and CTGAACCATCCTCATGCTTATATAG, and the probe is CTCAAAACCAGGAAATCCATAGAAATGC.

[0006] The detection reagents of the present invention also include other conventional reagents used for multiplex fluorescence quantitative PCR detection.

[0007] The method for using the above-mentioned multiplex fluorescence quantitative PCR detection reagent is as follows: 1. Collect blood samples from patients visiting the hospital. During the sampling process, the patient's relevant clinical information is systematically collected and registered. The samples are stored at low temperatures during transportation and then stored in a -80°C ultra-low temperature freezer. 2. Use Tiangen Virus Genomic DNA / RNA Extraction Kit to extract human T-lymphotropic virus genomic RNA from the blood; 3. Using the RNA extracted in step 2 as a template, specific primers and probes targeting the genomes of the four subtypes of human T-lymphotropic virus were used to perform multiplex fluorescence quantitative PCR detection according to the reaction procedure and reaction system optimized by the Acryl One-Step Kit (Ag11713). The results were determined based on the Ct value. The reaction procedure was reverse transcription at 42°C for 5 min, pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing and extension at 59°C for 30 s, and 40 cycles. The fluorescence signal was collected during the extension phase of each cycle.

[0008] The interpretation of test results includes the following: 1. Determination of the validity of the amplification curve Amplification curve shape: The curve should be a standard "S" shape, smooth without jagged fluctuations, and the plateau phase should be normal; Threshold line setting requirements: The threshold line is located in the middle of the exponential growth period and should not be too high or too low; Quality control requirements: The Ct value of the negative control and the template-free control should be UNDEF, and the difference in Ct value between duplicate wells should be <0.5 (otherwise, retesting or re-extraction of nucleic acid is required); 8 , 10 5 and 10 2 The plasmid standard with 10 copies / μL was used as the positive control, and the positive control amplified normally. 8 , 10 5 and 10 2 The plasmid standard with 100 copies / μL was used as a positive control. The amplification curves of each concentration gradient met the above-mentioned requirements for the validity judgment of the amplification curve, indicating that the positive control amplification results were valid.

[0009] Result interpretation criteria Table 1 Interpretation criteria for human T-lymphotropic virus (HTLV) nucleic acid test results ; Compared with the prior art, the present invention has the following advantages and technical effects: The present invention designs specific primers based on the highly conserved regions of the conserved genes of the four subtypes of human T-lymphotropic virus, and uses specific probes for different viruses with different fluorescent labels to achieve the simultaneous detection of the four subtypes of human T-lymphotropic virus in a single reaction system. It can detect the viral infection status and quantify the viral load at the same time. Specificity validation of the method revealed that the four subtypes of human T-lymphotropic virus had no cross-reaction with other pathogens and had good specificity; sensitivity validation of the method revealed that the minimum detection limit of the four subtypes of human T-lymphotropic virus could reach 100 copies / μL, indicating that the method had high sensitivity; repeatability validation of the method revealed that the coefficient of variation for both intra-batch and inter-batch repeatability was less than 5%, indicating that the method had good repeatability and reproducibility.

[0010] The method of the present invention boasts high sensitivity, strong specificity, good reproducibility, and simple operation. It can simultaneously and rapidly and accurately detect four viral subtypes: HTLV-1, HTLV-2, HTLV-3, and HTLV-4, providing an effective technical means for laboratory testing to distinguish between these four subtypes. The development of a single-tube multiplex fluorescence quantitative PCR assay and method for simultaneous detection of the four subtypes of human T-lymphotropic virus (HTLV) has significant scientific research value and clinical application implications for in-depth research into the molecular characteristics, epidemiological distribution patterns, and pathogenic mechanisms of different HTLV subtypes. This technology will provide reliable technical support for the precise typing and diagnosis of HTLV infection, transmission and tracing studies, and the development of clinical prevention and control strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The amplification curves of human T-lymphotropic virus type 1 at different probe concentrations are shown; Figure 2 The amplification curves of human T-lymphotropic virus type 2 at different probe concentrations are shown; Figure 3 The amplification curves of human T-lymphotropic virus type 3 at different probe concentrations are shown; Figure 4 The amplification curves of human T-lymphotropic virus type 4 at different probe concentrations are shown; Figure 5 The amplification curves of human T-lymphotropic virus type 1 at different annealing temperatures are shown; Figure 6 This is the amplification curve of human T-lymphotropic virus type 2 at different annealing temperatures; Figure 7 This is the amplification curve of human T-lymphotropic virus type 3 at different annealing temperatures; Figure 8 The amplification curves of human T-lymphotropic virus type 4 at different annealing temperatures are shown; Figure 9 The results of the multiplex fluorescence quantitative PCR specificity experiment; Figure 10 To verify the amplification curve results of the linear range of human T-lymphotropic virus type 1 by multiplex fluorescence quantitative PCR; Figure 11 To verify the amplification curve results of the linear range of human T-lymphotropic virus type 2 by multiplex fluorescence quantitative PCR; Figure 12 To verify the amplification curve results of the linear range of human T-lymphotropic virus type 3 by multiplex fluorescence quantitative PCR; Figure 13 To verify the amplification curve results of the linear range of human T-lymphotropic virus type 4 by multiplex fluorescence quantitative PCR; Figure 14 This is the standard curve result of human T-lymphotropic virus type 1 multiplex fluorescence quantitative PCR; Figure 15 This is the standard curve result of human T-lymphotropic virus type 2 multiplex fluorescence quantitative PCR; Figure 16 This is the standard curve result of human T-lymphotropic virus type 3 multiplex fluorescence quantitative PCR; Figure 17 This is the standard curve result of human T-lymphotropic virus type 4 multiplex fluorescence quantitative PCR. DETAILED DESCRIPTION

[0012] To further illustrate the technical means and effects of the present invention, the technical solutions of the present invention are further described below through specific embodiments, but the present invention is not limited to the scope of the embodiments. It should be noted that the materials used in the following examples are not limited to the above-mentioned materials and can be replaced by other similar materials; if the specific conditions of the instruments are not specified, conventional conditions or conditions recommended by the manufacturer shall be followed; those skilled in the art should have relevant knowledge of using conventional materials and instruments; unless otherwise specified, the methods in the examples are all conventional methods.

[0013] Example 1: Design of specific primers and probes 1. Download the full-length genomic nucleic acid sequences of human T-lymphotropic virus-1, human T-lymphotropic virus-2, human T-lymphotropic virus-3, and human T-lymphotropic virus-4 from NCBI (https: / / www.ncbi.nlm.nih.gov / ); 2. Use Mega11 software to perform nucleic acid sequence alignment to identify conserved gene regions in the genomes of the four subtypes of human T-lymphotropic virus (HTLV-1); use Primer Select software to design specific primers and probes for the pol gene of HTLV-1, the gag gene of HTLV-2, the tax gene of HTLV-3, and the tax gene of HTLV-4, respectively; 3. BLAST comparison analysis of primers and probes: The nucleotide sequences of the primers and probes designed initially were compared again using the BLAST search function of the NCBI website to select primers and probe sequences with high specificity; The detailed sequence information of the specific primers and probes targeting the four subtypes of human T-lymphotropic viruses (HTLV-1, HTLV-2, HTLV-3, and HTLV-4) is shown in Table 2 .

[0014] Table 2 Multiplex fluorescence quantitative PCR primers and probes .

[0015] Example 2: Establishment of a Multiplex Fluorescence Quantitative PCR Method for Four Subtypes of Human T-lymphotropic Virus 1. Plasmid construction and verification The specific gene sequences of human T-lymphotropic virus type 1 (SEQ ID NO: 1) and human T-lymphotropic virus type 4 (SEQ ID NO: 4) were ligated with the pUC57 vector to synthesize human T-lymphotropic virus-positive plasmid A. The specific gene sequences of human T-lymphotropic virus type 2 (SEQ ID NO: 2) and human T-lymphotropic virus type 3 (SEQ ID NO: 3) were ligated with the pUC57 vector to synthesize human T-lymphotropic virus-positive plasmid B. Plasmid construction was completed by Sangon Biotech Co., Ltd. Concentration was measured using an ultraviolet spectrophotometer, and the copy number of the plasmid was calculated based on the length and concentration of each plasmid using the following formula:

[0016] The copy number determination results are shown in Table 3.

[0017] Table 3 Plasmid standard concentration and copy number determination results ; 2. Optimization of multiple fluorescence quantitative reaction system The above plasmid standards were diluted tenfold (10 10 -10 1 According to the initial reaction system and reaction conditions recommended in the instructions of the Acridine One-Step RT-qPCR Kit (Cat. No. Ag11713), 10 9 ~10 2 Real-time fluorescence quantitative PCR was performed with a plasmid standard of 1000 copies / μL. Based on the experimental results, a positive standard with a Ct value between 15 and 30 cycles, high fluorescence intensity, and a good amplification curve was selected as a template for reaction system optimization. Finally, a concentration of 10 6 The positive standard with 100 copies / μL was used as a template for system optimization.

[0018] The final concentrations of upstream or downstream primers of each gene in the reaction system were set to 40nM, 60nM, 80nM, and 100nM, respectively. The “matrix method” was used to optimize the primer concentrations. The Ct values ​​and Std values ​​are shown in Table 4. The final concentrations of the probes in the reaction system were set to 40nM, 60nM, and 80nM, respectively. The probe concentrations were optimized. The Ct values ​​and Std values ​​are shown in Table 5. The amplification curve results are shown in Figure 1-4 As shown; the annealing temperatures were 50℃, 53℃, 56℃, 59℃, and 61℃ respectively for annealing temperature optimization, and the amplification curve results are shown as follows Figure 5-8Each gradient was repeated three times, and the average Ct and Std values ​​were calculated. Based on the principles of relatively small Ct values, a good amplification curve with an "S" shape, high and concentrated fluorescence intensity, and minimal primer dimers, the optimal concentrations of upstream and downstream primers in the reaction system were determined to be 60 nM; the optimal probe concentration was 80 nM; and the optimal annealing temperature was 59°C. Table 4 Ct value results of primer concentration optimization for multiplex fluorescence quantitative PCR

[0019] (Note: All data are: row first concentration = upstream primer concentration, column first concentration = downstream primer concentration; NT: primer probe concentration is too high, not detected) Table 5 Ct value results of multiplex fluorescence quantitative PCR probe concentration optimization

[0020] The final multiplex fluorescence quantitative PCR reaction system was determined as follows: 2×One Step RT-qPCR Buffer II (probe) 12.5 μL, pro Taq HS DNA Polymerase (5 U / μL) 0.5 μL, Evo M-MLV RTase Enzyme Mix II 0.5 μL, HTLV-1-F / R 0.6 μL each, HTLV-2-F / R 0.6 μL each, HTLV-3-F / R 0.6 μL each, HTLV-4-F / R 0.6 μL each, HTLV-1-P 0.8 μL, HTLV-2-P 0.8 μL, HTLV-3-P 0.8 μL, HTLV-4-P 0.8 μL, template 2 μL, and water was added to make up to 25 μL. The multiplex fluorescence quantitative PCR reaction program was finally determined as follows: reverse transcription at 42°C for 5 min, pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 59°C for 30 s, 40 cycles; fluorescence was collected during the extension stage of each cycle.

[0021] Example 3: Verification of the specificity, linear range, sensitivity, and repeatability of the primer probe fluorescent quantitative PCR of the present invention 1. Specificity verification of fluorescent quantitative PCR The viral genome extracts of four clinically verified nucleic acid-positive DNA viruses (herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (HCMV), hepatitis B virus (HBV)) and four RNA viruses (human immunodeficiency virus (HIV), hepatitis C virus (HCV), hepatitis E virus (HEV), hepatitis G virus (HGV)) and the 10 6 The specificity of multiplex fluorescence quantitative PCR was verified according to the reaction system and procedure optimized in Example 2, using 1000 copies / μL plasmid standards as templates and sterile water as a negative control.

[0022] The results are as follows Figure 9 As shown, except for HTLV-1, HTLV-2, HTLV-3, and HTLV-4, the other viruses were not amplified. There was no cross-reaction between the primers for detecting the four subtypes of human T-lymphotropic virus and other viral nucleic acid templates, indicating that the method has good specificity.

[0023] 2. Verification of the linear interval of fluorescent quantitative PCR The positive plasmid standard was diluted to 10 by 10-fold serial dilution method. 8 -10 2 copies / μL, sterile water was used as a negative control, and specific primers and probes for four subtypes of human T-lymphotropic virus were used respectively, and the linear interval of the present invention was verified according to the optimized reaction system and procedure; The results are as follows Figure 10-13 As shown, the amplification curves are 10 from left to right. 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL; a standard curve was established with the logarithm of template concentration as the horizontal axis and the Ct value as the vertical axis, as shown in Figure 14-17 The standard curve parameters for each subtype are as follows: HTLV-1 (E = 93.64%, R2 =0.999), HTLV-2 (E=95.64%, R 2 =0.999), HTLV-3 (E=99.25%, R 2 =0.998), HTLV-4 (E=99.08%, R 2 =0.999). All R 2 The values ​​were all >0.99, and the amplification efficiency was 90-105%, which met the linear verification standard.

[0024] 3. Sensitivity verification of fluorescence quantitative PCR After linear interval verification, it was preliminarily determined that the minimum detection limit (LOD) of the four subtypes of human T-lymphotropic virus was 100 copies / μL. 3 copies / μL, 10 2 copies / μL, 10 1 Three gradients of 100 copies / μL were used as templates, and sterile water was used as a negative control. According to the optimized reaction system and reaction procedure, 20 repeated experiments were performed using the multiplex fluorescence quantitative PCR detection method. If the detection rate could stably reach more than 95%, it was finally determined as the minimum detection limit.

[0025] The results are shown in Table 6. The minimum detection limit of the detection system of the present invention for the four human T-lymphotropic viruses is 100 copies / μL.

[0026] Table 6 Sensitivity verification results of multiplex fluorescence quantitative PCR ; 4. Fluorescence quantitative PCR repeatability verification In order to verify the repeatability of the multiplex fluorescence quantitative PCR detection method, a concentration gradient of 10 6 -10 2 The plasmid standard with 100 copies / μL was used as the positive template and detected using a Biori FQD-96a real-time fluorescence quantitative PCR instrument. The reaction system and amplification procedure were the same as in Example 2. The fluorescence signal was collected during the extension phase of each cycle, and the reproducibility was verified within and between batches. Repeat within a batch: Repeat once for 6 gradients, with three replicates per gradient; repeat between batches: Repeat three times for 6 gradients, with three replicates per gradient. Record the Ct value for each run and calculate the coefficient of variation (CV) according to the following formula to evaluate repeatability. A coefficient of variation (CV) within and between batches calculated from the Ct values ​​of the experimental results of <5% indicates good repeatability and reproducibility.

[0027]

[0028] The repeatability verification results are shown in Table 7. The results show that the coefficient of variation CV is less than 5%, indicating that the repeatability and reproducibility of the present invention are good; Table 7 Multiplex fluorescence quantitative PCR repeatability verification results .

Claims

1. A multiplex fluorescence quantitative PCR reagent for simultaneous detection of human T-lymphotropic virus subtypes, characterized by: Including specific primers and probes for human T-lymphotropic virus type 1, human T-lymphotropic virus type 2, human T-lymphotropic virus type 3, and human T-lymphotropic virus type 4; The specific primers for human T-lymphotropic virus type 1 were TAYTAGATACAGGAGCRGACATGACA and TATCRACTARGCAAGATGTTAAAACAATA, and the probe was AGCTCACCTCCCTTCCTGTGCTAATACGC; The specific primers for human T-lymphotropic virus type 2 were GAACCCCTCCTGTTGGATCTCYC and GAGGTGTTTGYCCCATAACGGA, and the probe was ATCCCGATCAAGACATCTCRATACTCCCACTC; The primers specific for human T-lymphotropic virus type 3 were CCAAAAAGAACACCRRGGCTCTGA and AGGTYGCTCTCCCCTTTTATAG, and the probe was TCTCTCCCTRCCYTGKCTCCCGGAAAAAAC; The specific primers for human T-lymphotropic virus type 4 are AAAGGTCAACTGTCTCACACAAATAA and CTGAACCATCCTCATGCTTATATAG, and the probe is CTCAAAACCAGGAAATCCATAGAAATGC.

Images