Forest canker pathogen specific SSR (simple sequence repeat) markers, development method and application

Abstract

The invention discloses specific SSR (simple sequence repeat) markers for forest canker pathogens, a development method and application. The forest canker pathogen is lasiodiplodia pseudotheobroma, and the forest canker pathogen is lasiodiplodia pseudotheobroma. The SSR markers comprise an LPS01 marker, an LPS03 marker, an LPS04 marker, an LPS08 marker, an LPS10 marker, an LPS13 marker, an LPS15 marker, an LPS21 marker, an LPS22 marker, an LPS23 marker, an LPS31 marker, an LPS34 marker, an LPS35 marker and an LPS39 marker; the invention further discloses a development method and application of the specific SSR marker for the forest canker pathogen. The SSR marker disclosed by the invention not only provides a powerful tool for population genetics research of the pseudoacathea pseudoacathea, but also provides technical support for formulating a prevention and control strategy of the artificial forest canker.

Description

Technical Field

[0001] The present invention relates to the field of plant protection, and more specifically relates to a group of specific SSR markers for forest canker pathogens, a development method, and applications. Background Art

[0002] Forest canker, caused by Botryosphaeriaceae fungi, is a major disease of plantations in southern my country and poses a serious threat to the plantation industry. Typical symptoms of the disease include cankers and rot on the host stems. During the course of the disease, the lesions gradually expand and deepen in color. In the later stages of the disease, the diseased tissue ulcerates and becomes water-soaked, eventually losing water and collapsing. In severe cases, the branches and stems may turn black and die, or even the entire plant may die. Because the disease has a wide host range and is common in plantations of eucalyptus, pine, and fir trees in southern my country, it poses a major challenge to the sustainable development of my country's plantations.

[0003] Research has shown that Lasiodiplodia pseudotheobromae is one of the main pathogens causing cankers in plantations in southern my country. This pathogen belongs to the genus Lasiodiplodia, belonging to the class Dothideomycetes, order Botryosphaeriales, family Botryosphaeriaceae, and the phylum Ascomycota. Currently, Lasiodiplodia pseudotheobromae has been widely found in plantations in Fujian, Guangdong, Guangxi Zhuang Autonomous Region, Hainan, and Yunnan. It exhibits strong pathogenicity and causes serious damage to various tree species. However, limited research has been conducted on the genetic diversity of this pathogen across different host plants and regions, hindering our understanding of its transmission characteristics and evolutionary mechanisms and hindering the development of effective disease prevention and control strategies. Summary of the Invention

[0004] To this end, the technical problem to be solved by the present invention is to provide a set of SSR markers specific for the forest canker pathogen, as well as development methods and applications. These SSR (Simple Sequence Repeat) markers are highly polymorphic and reproducible, and can be widely applied to study the genetic diversity of populations of Diplodia pseudococoa in different regions and hosts. They provide key technical means for further analysis of the pathogen's transmission characteristics and evolutionary mechanisms, and provide a scientific basis for comprehensive prevention and control strategies for plantation canker.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] A group of SSR markers specific for a tree canker pathogen, wherein the tree canker pathogen is Lasiodiplodia pseudotheobromae; the SSR markers include LPS01, LPS03, LPS04, LPS08, LPS10, LPS13, LPS15, LPS21, LPS22, LPS23, LPS31, LPS34, LPS35 and LPS39; wherein:

[0007] The nucleotide sequence of LPS01 is shown in SEQ ID NO.1;

[0008] The nucleotide sequence of LPS03 is shown in SEQ ID NO.2;

[0009] The nucleotide sequence of LPS04 is shown in SEQ ID NO.3;

[0010] The nucleotide sequence of LPS08 is shown in SEQ ID NO.4;

[0011] The nucleotide sequence of LPS10 is shown in SEQ ID NO.5;

[0012] The nucleotide sequence of LPS13 is shown in SEQ ID NO.6;

[0013] The nucleotide sequence of LPS15 is shown in SEQ ID NO.7;

[0014] The nucleotide sequence of LPS21 is shown in SEQ ID NO.8;

[0015] The nucleotide sequence of LPS22 is shown in SEQ ID NO.9;

[0016] The nucleotide sequence of LPS23 is shown in SEQ ID NO.10;

[0017] The nucleotide sequence of LPS31 is shown in SEQ ID NO.11;

[0018] The nucleotide sequence of LPS34 is shown in SEQ ID NO.12;

[0019] The nucleotide sequence of LPS35 is shown in SEQ ID NO.13;

[0020] The nucleotide sequence of LPS39 is shown in SEQ ID NO.14.

[0021] The above 14 SSR markers were verified by the Pseudococcidioides pseudococoa population and showed high polymorphism in the population, with an average number of alleles of 5.214. When the SSR primer pairs designed based on these SSR markers were used for PCR amplification of the corresponding SSR sites in the genomic DNA of Pseudococcidioides pseudococoa, specific PCR amplification products were obtained. By sequencing the PCR amplification products, the genetic differences between different strains can be effectively distinguished, providing a stable molecular target for the genetic research of Pseudococcidioides pseudococoa populations.

[0022] A method for developing a specific SSR marker for a tree canker pathogen, wherein the tree canker pathogen is Lasiodiplodia pseudotheobromae, and the method comprises the following steps:

[0023] a) extracting genomic DNA from Diplodia pseudococcus and obtaining whole genome sequencing data;

[0024] b) SSR loci were screened from whole genome sequencing data using the search parameters of 3-6 nucleotide repeat units, 4-10 repeats, and 250 bp flanking sequences upstream and downstream of the repeat units;

[0025] c) comparing the SSR loci obtained in step b) with annotated genes in the whole genome of Diplodia pseudococoa to screen out SSR loci located in non-coding regions;

[0026] d) designing an SSR primer pair based on the SSR locus screened in step c); the design parameters include: annealing temperature of 55° C., 3′ end base of G or C, and amplification product length of 100 to 450 bp;

[0027] e) using the SSR primer pairs designed in step d), PCR amplifying genomic DNA of Diplodia pseudococoa strains from different hosts and different regions, and detecting polymorphisms in the SSR regions of the amplified products by sequencing; retaining SSR primer pairs that can perform specific amplification and have polymorphisms in the SSR regions of the amplified products;

[0028] f) obtaining the corresponding SSR marker specific to the wood canker pathogen according to the SSR primer pair retained in step e), namely, the aforementioned wood canker pathogen specific SSR marker.

[0029] Application of a specific SSR marker for the forest canker pathogen, wherein the application is to use the above-mentioned specific SSR marker for any of the following:

[0030] (1) Identification of Diplodia pseudococci;

[0031] (2) Analysis of the genetic structure of the Diplodia pseudococoa population;

[0032] (3) Analysis of genetic diversity of the pseudococoa hairy spore population.

[0033] The above application, when using the above-mentioned forest canker pathogen-specific SSR markers for genetic diversity analysis of the pseudococoa serovar Diplodia population, is carried out according to the following steps:

[0034] S1. Isolate and purify the strains, and extract the genomic DNA of each strain of Diplodia pseudococoa;

[0035] S2. Obtain the genotype of the SSR loci corresponding to the above-mentioned SSR markers in the genomic DNA of each strain of Diplodia pseudococoa to obtain the SSR genotype results;

[0036] S3. Calculate the genetic diversity parameters of the population composed of Diplodia pseudococoa based on the SSR genotype results.

[0037] In the above application, in step S2, a primer set for specifically amplifying SSR markers specific to the wood canker pathogen is used to perform PCR amplification on the genomic DNA of Pseudomonas aeruginosa, and the length polymorphism of the PCR amplification products is detected to obtain the genotype of the genomic DNA of each strain of Pseudomonas aeruginosa at the SSR site.

[0038] In the above application, the primer set for specific amplification of SSR markers specific to forest canker pathogen contains 14 SSR primer pairs; wherein:

[0039] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS01 are shown as SEQ ID NO. 15 and SEQ ID NO. 16, respectively;

[0040] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS03 are shown as SEQ ID NO. 17 and SEQ ID NO. 18, respectively;

[0041] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS04 are shown as SEQ ID NO. 19 and SEQ ID NO. 20, respectively;

[0042] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS08 are shown as SEQ ID NO. 21 and SEQ ID NO. 22, respectively;

[0043] The sequences of the two primers in the SSR primer pair for specific amplification of LPS10 are shown as SEQ ID NO. 23 and SEQ ID NO. 24, respectively;

[0044] The sequences of the two primers in the SSR primer pair for specific amplification of LPS13 are shown as SEQ ID NO. 25 and SEQ ID NO. 26, respectively;

[0045] The sequences of the two primers in the SSR primer pair for specific amplification of LPS15 are shown as SEQ ID NO. 27 and SEQ ID NO. 28, respectively;

[0046] The sequences of the two primers in the SSR primer pair for specific amplification of LPS21 are shown as SEQ ID NO. 29 and SEQ ID NO. 30, respectively;

[0047] The sequences of the two primers in the SSR primer pair for specific amplification of LPS22 are shown as SEQ ID NO. 31 and SEQ ID NO. 32, respectively;

[0048] The sequences of the two primers in the SSR primer pair for specific amplification of LPS23 are shown in SEQ ID NO. 33 and SEQ ID NO. 34, respectively;

[0049] The sequences of the two primers in the SSR primer pair for specific amplification of LPS31 are shown as SEQ ID NO. 35 and SEQ ID NO. 36, respectively;

[0050] The sequences of the two primers in the SSR primer pair for specific amplification of LPS34 are shown in SEQ ID NO. 37 and SEQ ID NO. 38, respectively;

[0051] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS35 are shown as SEQ ID NO. 39 and SEQ ID NO. 40, respectively;

[0052] The sequences of the two primers in the SSR primer pair for specific amplification of LPS39 are shown as SEQ ID NO. 41 and SEQ ID NO. 42, respectively;

[0053] In each SSR primer pair, the odd-numbered primers are forward primers and the even-numbered primers are reverse primers.

[0054] The 14 SSR primer pairs have been scientifically designed and can specifically bind to the corresponding SSR sites in the genomic DNA of Diplodia pseudococoa with different genetic backgrounds collected from different hosts and regions. They can also stably obtain the PCR amplification products of each strain at the corresponding sites, and clearly distinguish different SSR genotypes through length polymorphism detection, thereby improving the accuracy of population genetic research.

[0055] In the above application, when detecting the length polymorphism of the PCR amplification product, the chain termination sequencing method is used to obtain the base sequence of the PCR amplification product, and the length polymorphism of the PCR amplification product is obtained based on the base sequence of the PCR amplification product.

[0056] Occasional mutations may occur in the genomic DNA of a strain. When an insertion or deletion occurs in a genomic region linked to an SSR and the mutation is located within the PCR amplification interval, the PCR amplification product will contain an abnormal number of bases, leading to errors in genotyping based on product length. However, chain-termination sequencing, which obtains the base sequence of the PCR amplification product and calculates the length polymorphism of the PCR amplification product based on the base sequence, can provide more accurate results.

[0057] In the above application, in step S2, for each strain of Diplodia pseudococoa, for each of the SSR sites in its genomic DNA, a PCR reaction system is prepared using the SSR primer pair corresponding to the SSR site in the primer set for specifically amplifying the SSR marker specific to the wood canker pathogen to perform PCR amplification.

[0058] Constructing separate PCR reaction systems for multiple SSR sites for each strain can help reduce amplification interference and nonspecific reactions, and improve primer amplification efficiency and the reproducibility of results.

[0059] In the above application, each PCR reaction system contained: 100 ng of genomic DNA of Diplodia pseudococoa as a DNA template, 1 μL of a 0.01 mol / L forward primer, 1 μL of a 0.01 mol / L reverse primer, 18 μL of a 2× high-fidelity PCR premix, and RNase-free double-distilled water; the volume of each PCR reaction system was 35 μL.

[0060] In the above application, in step S2, the reaction procedure for PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute, for a total of 35 cycles; and final extension at 72°C for 10 minutes.

[0061] The technical solution of the present invention achieves the following beneficial technical effects:

[0062] 1. After PCR amplification of the 14 SSR sites in the genomic DNA of Pseudo-cocoa-color Diplodia, the 14 SSR primer pairs provided by the present invention were respectively used to amplify the 14 SSR sites. The resulting PCR amplification products have high polymorphism and good specificity, which helps to accurately distinguish subtle genetic differences between different strains and helps to improve the resolution of population genetic diversity and group structure. The SSR markers provided by the present invention have been fully screened and verified and can be stably and repeatedly used in population genetics studies of 204 strains of Pseudo-cocoa-color Diplodia, providing a powerful molecular tool for in-depth analysis of the spread, evolution and group structure of Pseudo-cocoa-color Diplodia in different hosts and different geographical regions.

[0063] 2. The SSR primers and SSR markers developed in the present invention are currently the only molecular marker system designed specifically for the study of Pseudococcus spp. populations, filling the gap in this field. They can be used for the comprehensive analysis of the genetic diversity, genetic structure and genetic differentiation of Pseudococcus spp. populations, revealing their transmission pathways and evolutionary trends, providing theoretical basis and technical support for early warning, monitoring and scientific prevention and control of artificial forest canker disease, reducing the risk of disease outbreaks, and have the potential value of being promoted and applied in the actual prevention and control of forest canker disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Agarose gel electrophoresis results of PCR amplification of genomic DNA of different strains of Diplodia pseudococoa by some of the SSR primers in Example 1 of the present invention;

[0065] Figure 2 Cumulative distribution curve of genotypes of 204 strains of Diplodia pseudococoa in Example 2 of the present invention;

[0066] Figure 3 Figure 2 shows the results of the genetic structure analysis of the Pseudococcus spp. population based on the STRUCTURE software in Example 2 of the present invention;

[0067] Figure 4 DeltaK curves of the five geographical populations in Example 2 of the present invention. DETAILED DESCRIPTION

[0068] Example 1 Development of SSR loci (SSR markers) for forest canker pathogens

[0069] The forest canker pathogen used in this example is Lasiodiplodia pseudotheobromae.

[0070] In this example, a sequencing strategy combining the second-generation sequencing platform Illumina HiSeq 2500 with the third-generation sequencing platform Oxford Nanopore Technologies was employed. First, second-generation sequencing libraries and third-generation sequencing libraries were constructed separately. Sequencing yielded second-generation sequencing data and third-generation whole-genome data. These two sets of data were then combined to assemble the complete genome sequences (i.e., whole-genome sequencing data) of five strains of Diplodia pseudococoa. This enabled whole-genome sequencing of these five representative strains. These five representative strains were all collected from susceptible plants in the wild. Specific information is shown in Table 1. The greater the number of "+"s in the table, the greater the pathogenicity of the strain.

[0071] Table 1 Information of strains used for genome sequencing

[0072]

[0073] After sequencing, the whole genome sequencing data of 5 strains of Diplodia pseudococoa were successfully obtained. The average size of the 5 whole genome sequencing data (after assembly) was 43.47Mb, the highest N50 was 5817267bp, the average GC content was 54.76%, and the overlapping group contigs obtained from the whole genome sequencing data (after assembly) reached at least 8, indicating that the assembly quality and assembly completeness of the whole genome sequencing data obtained in this project were high, and they can be used as reference genome data for SSR site development and SSR primer design of Diplodia pseudococoa.

[0074] SSR primers were designed using the sequencing data of five whole-genome sequences. The reference genome was searched for microsatellite repeat regions (SSR regions) using the software Krait v.1.3.3, and a total of 3945 simple repeat sequence sites (SSR sites) were found. The search parameters were set as an SSR repeat unit length of 3 to 6 nucleotides (i.e., tri-, tetra-, penta-, and hexa-) and a repeat unit repeat number range of 4 to 10. The length of the upstream and downstream flanking sequences of the repeat unit was 250 bases (bp). Of the 3945 SSR sites, 1971 met the above-mentioned criteria, accounting for 50% of the total.

[0075] The above search operation screened 1,971 SSR loci from the whole-genome sequencing results. Subsequently, the retrieved SSR loci were aligned with the annotated gene (RIFT3945; see https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_033955225.1 / ) in the whole-genome of R. pseudococoa, and 941 SSR loci were further screened in non-coding regions.

[0076] Primer 3 software was used to design SSR primer pairs for each of the 941 SSR loci, ensuring that at least one SSR primer pair was designed for each SSR locus (each SSR primer pair contained two SSR primers). Key design parameters included an annealing temperature of 55°C, the first two 3' bases set to G or C, and a target product length of 100 to 450 bp.

[0077] SSR primer pairs are screened from these designed primers. During screening, the fragments amplified by the SSR primer pair are required to be polymorphic among the five strains (that is, the same SSR primer pair amplifies the genomic DNA of five different strains, and each strain can obtain a specific DNA fragment; and there are more than two fragment differences between the specific DNA fragments amplified by the five strains), and the primers themselves are highly specific; in addition, the primers should not easily form a hairpin structure and should not easily form primer dimers with each other. For the SSR primer pairs finally screened, the DNA fragments amplified (that is, SSR sites) should be distributed as much as possible on different overlapping group contigs of Pseudomonas pseudococoa, to avoid combining multiple primers on the same overlapping group contig and mutual interference between primers.

[0078] The above steps screened a total of 39 SSR primer pairs, corresponding to 39 SSR loci, numbered LPS01 to LPS39. PCR was performed using these selected SSR primer pairs on genomic DNA from 10 representative strains of Diplodia pseudococoa collected from different regions and hosts, with significant differences in pathogenicity and mating type. This was done to verify that the SSR primer pairs could amplify specific bands and that the specific bands could be successfully sequenced.

[0079] The information of the 10 strains of Diplodia pseudococoa used in primer validation is shown in Table 2 .

[0080] Table 2 Ten representative strains used for SSR primer validation

[0081]

[0082] The agarose gel electrophoresis results of the amplified products obtained by PCR amplification of the genomic DNA of the above 10 strains of Diplodia pseudococoa using some SSR primers are as follows: Figure 1 As shown in the figure, B represents the blank control and M represents the Maker. As can be seen from the figure, not all designed SSR primer pairs can amplify specific bands. Even if a certain SSR primer pair amplifies specific bands, the sequences of these specific bands (DNA fragments) are not necessarily polymorphic among the 10 strains, and the polymorphism is not necessarily caused by the copy number of the repeat unit at the SSR locus (it can also be a polymorphism of SNPs or a polymorphism of irregular additions or deletions, etc.).

[0083] The sequencing results were further analyzed. For an SSR primer pair, after amplifying the genomic DNA of 10 strains of Diplodia pseudococoa, 10 specific DNA bands (DNA fragments) are expected to be obtained. The sequence polymorphism between DNA fragments should mainly originate from the polymorphism of the SSR region (i.e., the difference in the number of repetitions of repeat units within the SSR region). Based on this, when analyzing the sequencing results, the 10 DNA fragments amplified by each SSR primer pair should be sequenced to determine whether the DNA sequence differences are mainly caused by variations in the SSR region; if the DNA sequence differences are not derived from the SSR region, the SSR primer pair should be eliminated. In addition, for cases where there is no obvious polymorphism between the amplified DNA fragments, or their differences are limited to the two sides of the DNA fragments (i.e., the head and the end), the corresponding SSR primer pair should also be discarded.

[0084] After the above screening process, 14 SSR primer pairs were finally obtained as shown in Table 3. Each SSR primer pair contains a forward primer and a reverse primer.

[0085] Table 3 14 SSR primer pairs

[0086]

[0087]

[0088] The reference sequence of the SSR site corresponding to the SSR marker in the genomic DNA of Diplodia pseudococoa (i.e., the complete genome sequence of Diplodia pseudococoa disclosed in https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_033955225.1 / ) is as follows:

[0089] LPS 01_GGC_RIFT3495(SEQ ID NO.1):

[0090] ACCTCTCTGCAATACGAGCGGCGCGCCAGATTTTATTTTTGGGACCGCGCCAGGCCTTGCCGCTTGTTGCTCCGGAGAATTAAAGTAGGGGCGCGGGCGGCGGCGGCGGCGGCGGCGGGGGCGGGAAACCAAAGAATGCCCTAACCCACTGTTACTCTTCTTCCCCCCAAAAAAAGAAAGGGACCGATCTTTGTGCTGACTCGAAAATCTTTTCTTCTTTCTCGTGTAACAGTACCACAATGAGGGCGTCCTGAAGAAGTATGCGCCTAAGCTCAAGGTTGGCGAAGTCAAGGAGGAGGCTAAGCTATGATTGGGGGCTTGGACGGGACAAGAGAA

[0091] LPS 03_GTT_RIFT3495(SEQ ID NO.2):

[0092] GGGAAACAGCAAATCGCAGGACAGAGAGACATTCCCGTTCTCGTGTAGTCGTGTTTGTTTTTTTGGTAGGTGATGGACAGGTAGGTTGTTGTTGTTGTTGTTATAATCACTGGCACTTCCAGAATCTCCCAATCCTGGTCGTCGGCGCGGACTTGGGTCTCCGCTTCTCCTCGCACGCGTCATGGTCGTCCTCTTCGGGCACCTCGATGCGGTAGCGCCTCACGCTGCACGCGTCGTCGTCGTCGTTCTCGCCGTCGTAGAAA

[0093] LPS 04_GACC_RIFT3495(SEQ ID NO.3):

[0094] GATGTCACGATGCATGGTGCTGGCATTTACTGGCACCGCCCCGTTCCAGAGTAGTGAAGTCTGGTACGAGACCGACTAGGGTGTTTGCTGGCTTTGCATAACACACCTAGTGTAAGATGTACTGTGTAGCCTATAGTCTGACGACTGATCTTGAACTGACCGACTGACCGACTGACCGACCGACCGACCGCCGGCAGATCCGTCATGACCCCGGGAATTTATCCCCGGTCATCAACGATCCTCCTCAGCACGCCCCCGCGCACAGGAAGCAGATCAATCCTTCAGCTAACTTGTCGATTTCTTCGCAGATATGCCGAATTTTTTCTGCAGGATTCCTGAACTACCACCGCCCCCCTGCCCCGCCCGTCTCCACCGCCCGTCTCCACCGCCGTCGGATGGACCCGGGGCTGGGAAGGATGCATTGATCGAATAACAAGAGCCGAGGCTGGGCGATTGCTCGTGATGATG

[0095] LPS 08_GTG_RIFT3495(SEQ ID NO.4):

[0096] CGACGGAGGTGGAGATAACGACAGTGCCATTCGGGGACGATTCTGCAGCACGACATGATCATCGATGAGCAGTGGTGGTGGTGGTGAGAGACCGGAGCAAAAAAGTCCGTGTGGGGGCGGCCGGACCCACGCGGGTCAGCGAGAGGCAATTGCTGATCGCCGTTGACGCCTGCTAGCGAGGATGAAGTTGGTTAACGTTAGGGCACCGCTATTTCGAGACCCCTGGCCCGCCGCCCTCGCGTGGCTGGGGGGACGTGCTGACAGTCGTTA

[0097] LPS10_AAC_RIFT3495(SEQ ID NO.5):

[0098] TCAACATCCACCATCCACCGCCCACCACCACACGCGTCGACAAAGTTCTACGCACACTATGCACAGGTTTTGAACAAACTCCAGATGCGAAATTGACATTTCACTGACTAAATGAAAGCAGAATCTATTTGCGACCGAGGGCTGGTGCTTTCAGCAAATGCGAGGCTCGTGTGTTGTTGTCGCATGGACCGCGCGGGTTGTGAGCGATGCGAAGAGATGGAACAACAACAACAACAACGTTGGTTGAATGAACGATGAAGAAAAACGCCTCGCGAAAAGAAACACCAAGGCATCGCATCACGAACACCAAAATTTAGAGGAATTTCGCGAGCGAAAGTCCAGTTGTGAAGATACCGCTTGCTGCCAGAAGCTTAATTAAGGCCGGCGACCGAAAGCGAAGTACCACTCTCTAGCACTTTGCAGCTCCAAATCTTGCGCCGTTTCT

[0099] LPS13_GAG_RIFT3495(SEQ ID NO.6):

[0100] GGGGGAGAGGTTTGAGTTGGTGGAGCCGTGGGGTGGGCTGCACCCGCTGGAAGTGGTGGCGAGGGTGACGGAGGAGGATTTGGCGGTTTTGGTGCCGGGGAAGGGCGGGGATGGGGATGAGGAGGAGGAGGAGGAGTATGTGCTCAAGGCGGCGGTGAGCGCGTTTCCGGCGGGGTTTGATATACAAGAGAAGATGGATCAGCCGCTCACGGCAATCCACGAGCCGGTGCCGACGTACAAAGAGA

[0101] LPS 15_AAC_RIFT3495(SEQ ID NO.7):

[0102] TCCACCCCCTCTATAAGCCCCACGGGAGGCAAACTACGTAGTAGTATATAGACGAGGTAAAATCAAACAACAACAACAACCCACTCAGTCCTCATGCCACTCATTCAGTGCAAGACAATCACATCTCTTTTCATCGCCCAGTGCAACAGGTCGCCACTGAAGTAGAAGTTCCTGCG ACCTCTTAGTTCCATGACCTCTGGATGCGCCTCACCAACACGCTCCAGCTGGAGATTCAGCCGATCAAGACCACCCTGAACGAAAACATTGAGCAGCTTGCTAGCGTCTGCCGCGCTTAGGATCACATCCGCCAGAACCAGAAGCAGAACGTTGAGCGCCGCAAAAACACGACGTCTT

[0103] LPS 21_GCG_RIFT3495(SEQ ID NO.8):

[0104] CAAGTCTCATAGGGCAGGCCGCCGCTCCCGCTTTGTGGGAGGCCGTCATTCGCAGCCGCGTCTCGGATAATAATGGCCGTGTCCCGTGGCACCCCTCCCCTTCGCCCTTGCTTTTTGCTTCCCGCG GAGAACGTGGTTGCCCCTGTTTCTCCTGAAGAAACCATCACCTCACATGCGGCACGGCAACGTGGAGCGGCGGCGGCGGCGGCGGTGGTGGCTTTGGCTCATAACAGCAGAGTCACGCCATAGGAA

[0105] LPS 22_GTT_RIFT3495(SEQ ID NO.9):

[0106] GTTGTTGAACGACACGACCGACTCGCTCGACCACACGCGGCCGGCTTGGAGCGGGGGGTTGTTGTTGTTGTTGTTGTTGTTGCTGTCGCTGCTGCTTACCGCCGAGAATGGCTGTGAGGAAGACGGGACTGAGGTGTTGTTGTCATTGCTGCTGCTGCTGTAAGCAGGCGGTTCATCGGCGGGAAGCAGCGCCTTCGCGGCCGCCATCTGAGCTTCGAAGTCCTCGATGTGTTGCGCCACTAGCTGGTCGTGGCCGAGGCTGGGAAACGTCGGCGGGAAGGGTCCGGATGTCATG

[0107] LPS 23_AAAG_RIFT3495(SEQ ID NO.10):

[0108] TCATAATCGCAGCCACGAGCAAACAAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAAAGGTGCCCATGCCACACTTCCTACGCCACACCGCAAAAACAGACTATTCTAGATCTTGCGCTACATATGAAAATGTAGCAGTCAACATCTGGACGGGCAGGAAATCTCACTGA

[0109] LPS 31_AAG_RIFT3495(SEQ ID NO.11):

[0110] CAACAAAAGGAAGCGTCCCGACGTGAAGTCAGGCGCAAAAGAAGAAAAAGAAGAAGAAGAAGAAGCATAAGAATAAAGTTTTGAAGGCTGCGTGACGGCCATTAGGGCGTAAGAAGGTTGTTGGTTGTTGTATGTAGATAGAGGTAAGGTAGTAGAGTAGGTAGGTAGGTAGTAGATAGGTAGACGTCAGATGAAGACTGATCTTTCGAAAAGAACAGAGCCATGAGAAAAACATGGCAGGATATCAAGAAAACAAATAACGAAACAGAAAAAGATTTCCCCAGGAAAAAAGATTCGATGCAGCCAACCAAGAAACTTTTCTTGAAAAAATGCCTCTTTTTACCTCGTATAAACCACTGCGAGCG

[0111] LPS 34_AAG_RIFT3495(SEQ ID NO.12):

[0112] GTAGACAGGTGCTCGTCTCGCGCATGCGCGACGGCACAGAGGTCAAGATGGACGCGCGGCGCTTGGAGCCGCTGATCGAAGCGTGCGTGAGGCGCGTTGCTGCTGCCGCGACGAGAAGAAAAGGCGCTGAGGGGGGAAAGGAGGAAAAGGAGGAGGAGGAGGAGGAGGAAGAAGAAGAAGAAGAAGAGGCTGTCGACGCGATCTTGCTGCTCTGCACGGGTGATGTGCCGGCGTTCGGGGCGGACCTGGGCGTGCCCGTTGTCGTGCCTCAGGACGCGGTGAGGCGGTTTATGGAGGAGAAGGGGGAAGGGAGAAAAAGGGCTTGGAAGTTAGTTCTTGTCAGCCCTGAGGAGCGGCAGGTTCAGGCGGCGCGGGGGCGGTGGGAGGGTGTGGGCGGGTGTGAAGTGCTTGGGGCGGCTGCGGCGACGCCGTATGGGGATGCGAGTAC

[0113] LPS 35_CGC_RIFT3495(SEQ ID NO.13):

[0114] TCGAGAATTCTGGATCGTGCGCGGCGCAAGCCCAGCTGAGAGCGCAAGGGACGAGACGAGACGAAAGTGGAGGCGAGAGTGGCCCACCGCGATGTGGTTCCGTTGGCGCGCACGGCCTGCTCGGCCGGGGTGGGGATGGGCCGGTCACCGCTCAACGGCGAATGTCGTCGCTGTCTGCCTGTCTGTCTGTCTGTCGTCGTCGTCGTCGCCGCCGCCGCCGCCGCCT TCGATCCGATCGCGCGTGGCGTGCCTCTCGAACGCCCTCTGCTGCGCTGCAAGCCAGCGCCCGAACTTGATGCGAGCGATAAGGGCGGCGTGGGCGCATCACGGCGAACCATTCCGGGAGATCCCCTTGGGCTGCTGGCTTCAGCTCTGTGCGTCAGCACTGGCCGTGGTGTCGCGCATCTGGGTCGCGGAAGGATCTGATGAGGTGGGCTTAGGGTGTTGGTGAA

[0115] LPS 39_GGA_RIFT3495(SEQ ID NO.14):

[0116] CCGCCAACTCGAAATACACCACCGCGGCGGAAGAGGAGGCAGTCGCTCGAGGCGGGCAAGGGCGATGGCGTCGGTCGGCGAAGAGCGCTGCCGTGCTGTCGACGTGGTGGGAGGAGGAGGAGGAGGAGGAGGAGCGGCG GCGGTCGGCTGCAGGAGGGGAAGGTGACACGCGGCGACGTTGCAGTTATCGAGGCGAAGAGAAAGTAGGTGAGAATGACCGACAAGCGCTGGGAGAGATGGAGGCGGAGCAGGTGGGCTTGCAGGGGAACGGTTGTGATA

[0117] Example 2 Population genetics analysis of forest canker pathogens based on SSR markers

[0118] In this example, population genetics analysis was performed on 204 strains of Diplodia pseudococoa from five regions in southern China. The 204 strains were from Fujian (13 strains), Guangdong (90 strains), Guangxi Zhuang Autonomous Region (74 strains), Hainan (25 strains), and Yunnan (2 strains).

[0119] 14 SSR primer pairs screened in Example 1 were used, and 204 PCR reaction systems were prepared for each SSR primer pair to perform PCR amplification on the corresponding SSR sites in the genomic DNA of 204 strains of Pseudococcidiospora cocoi. After PCR amplification, the length of the PCR product of each SSR site was checked. For a certain SSR site, the length of its PCR product was determined (mainly depending on how many times the repeating unit was repeated), which indicated how many alleles were present at the SSR site. For a certain strain, the composition of its alleles at each SSR site was the SSR genotype result of the strain. Based on the composition of the alleles at the SSR site (SSR genotype result), genetic diversity analysis was performed on Pseudococcidiospora cocoi in 5 geographical populations.

[0120] Genomic DNA from Diplodia pseudococoa was extracted using the CTAB method. Each 35 μL PCR reaction system consisted of 1 μL of genomic DNA (containing 100 ng of DNA), 1 μL of 0.01 mol / L forward primer, 1 μL of 0.01 mol / L reverse primer, 18 μL of 2× High Fidelity PCR Master Mix (Sangon Reagent No. B639292), and 14 μL of RNase-free double-distilled water.

[0121] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute, for a total of 35 cycles; and final extension at 72°C for 10 minutes.

[0122] After PCR, the PCR amplification products were commissioned by Sangon Biotech (Shanghai) Co., Ltd. for bidirectional Sanger sequencing (chain termination sequencing). The sequencing results were edited and analyzed using MEGA 7. Based on the sequencing results (i.e., the base sequence of the PCR amplification products), the length of the PCR amplification products at each SSR locus was determined, and the genotypes of each SSR locus in the 204 strains were counted.

[0123] The R language package v.3.6.33 and the poppr package were used to calculate the number of alleles (Na), Simpson's index (λ), Nei's genetic diversity index (h), and the distribution index of different genotypes (Evenness) at each SSR locus. These four parameters can be collectively referred to as genetic diversity indices.

[0124] Table 4 Polymorphism of 14 SSR loci

[0125]

[0126]

[0127] As shown in Table 4, PCR amplification of 14 SSR loci in the genomic DNA of L. pseudococoa using 14 SSR primer pairs revealed good polymorphism, with each SSR locus containing 2 (LPS 35) to 10 (LPS 03) alleles, with an average of 5.214 alleles. The Simpson index (λ) ranged from 0.067 to 0.772, with an average of 0.514. Nei's genetic diversity index (h) ranged from 0.067 to 0.776, with an average of 0.517. Both the Simpson index and Nei's genetic diversity index (h) were relatively close for each SSR locus, with the lowest index for LPS01 and the highest for LPS03. The distribution index (Evenness) of different genotypes ranged from 0.401 to 0.976, with an average of 0.720. The lowest value corresponded to the SSR locus LPS 01, and the highest value corresponded to the SSR locus LPS 35.

[0128] Overall, the number of alleles at the LPS01 locus is relatively small, at 3, and the corresponding Simpson index (λ), Nei's genetic diversity index (h), and the distribution index of different genotypes (E) are the lowest (0.067, 0.067, 0.401). The number of alleles at the LPS03 and LPS39 loci is relatively large, at 10 and 9, respectively. The values ​​of the other three genetic diversity indices are also relatively high, with Simpson index (λ) of 0.772 and 0.75, Nei's genetic diversity index (h) of 0.776 and 0.753, and the distribution index of different genotypes (E) of 0.784 and 0.789, respectively. The above results show that the SSR loci developed in Example 1 have high polymorphism and are suitable for population genetic diversity research of Pseudomonas aeruginosa. In addition, the SSR primer pairs developed in Example 1 can effectively achieve specific amplification of the corresponding SSR loci in the genomic DNA of Pseudomonas aeruginosa.

[0129] Furthermore, the R language package v.3.6.33 and the poppr package were used to construct the genotype cumulative distribution curves of 204 strains of Diplodia pseudococoa. Figure 2As shown. In the figure, NumLoci represents the number of SSR sites (SSR primer pairs), MLG represents the number of genotypes, and the red dotted line indicates that the MLG differentiation rate is 100%. The 204 strains used in this example have a total of 156 genotypes at 14 SSR sites, among which the numbers of genotypes in the five geographical populations (Fujian FJ, Guangdong GD, Guangxi Zhuang Autonomous Region GX, Hainan HN and Yunnan YN) are 12, 67, 53, 22 and 2 respectively. With the increase of the number of SSR sites, the number of genotypes in the population shows an increasing trend, and reaches the highest state (100%) when the number of SSR sites is 13, indicating that the above-mentioned SSR sites have a high genotypic diversity, and the corresponding number of SSR primer pairs (14) is sufficient for the study of genetic diversity of the population composed of 204 strains.

[0130] The genetic structure analysis (Structure analysis) of the population was performed using the Structure v2.3.4 software. The admixture model was selected, the burnin parameter was set to 250,000, the MCMC (Markov Chain Monte Carlo) parameter was set to 1,000,000, and K (number of clusters) was set to 1-10. Each K value was repeated 20 times. The optimal K value was calculated according to the methods provided in the paper "Inference of population structure using multilocus genotype data" published by Pritchard JK et al. in 2000 and the paper "Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies" published by Falush D et al. in 2003. The optimal K value was finally determined to be 2 (such as Figure 4 shown). Figure 3 is the result of Structure analysis, Figure 3 It can be seen that the 204 strains of Diplodia pseudococoa can be clearly divided into two major subpopulations. In the figure, blue represents genetic subpopulation 1, orange represents genetic subpopulation 2, and the data are clone-corrected data. 1 is the Fujian population, 2 is the Guangdong population, 3 is the Guangxi Zhuang Autonomous Region population, 4 is the Hainan population, and 5 is the Yunnan population. This result further confirms that the SSR loci (SSR primer pairs) developed in Example 1 are applied to the genetic analysis of Diplodia pseudococoa with high accuracy.

[0131] The above results indicate that the 14 SSR loci (14 SSR primer pairs) in Example 1 can be applied to cluster analysis and genetic diversity analysis of Diplodia pseudococci.

[0132] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the claims of this patent application.

Claims

1. A group of SSR markers specific to forest canker pathogens, characterized by: The forest canker pathogen is Lasiodiplodia pseudotheobromae; the SSR markers include LPS01, LPS03, LPS04, LPS08, LPS10, LPS13, LPS15, LPS21, LPS22, LPS23, LPS31, LPS34, LPS35 and LPS39; wherein: The nucleotide sequence of LPS01 is shown in SEQ ID NO.1; The nucleotide sequence of LPS03 is shown in SEQ ID NO.2; The nucleotide sequence of LPS04 is shown in SEQ ID NO.3; The nucleotide sequence of LPS08 is shown in SEQ ID NO.4; The nucleotide sequence of LPS10 is shown in SEQ ID NO.5; The nucleotide sequence of LPS13 is shown in SEQ ID NO.6; The nucleotide sequence of LPS15 is shown in SEQ ID NO.7; The nucleotide sequence of LPS21 is shown in SEQ ID NO.8; The nucleotide sequence of LPS22 is shown in SEQ ID NO.9; The nucleotide sequence of LPS23 is shown in SEQ ID NO.10; The nucleotide sequence of LPS31 is shown in SEQ ID NO.11; The nucleotide sequence of LPS34 is shown in SEQ ID NO.12; The nucleotide sequence of LPS35 is shown in SEQ ID NO.13; The nucleotide sequence of LPS39 is shown in SEQ ID NO.

14.

2. A method for developing a specific SSR marker for a forest canker pathogen, characterized in that: The forest canker pathogen is Lasiodiplodia pseudotheobromae, and the development method comprises the following steps: a) extracting genomic DNA from Diplodia pseudococcus and obtaining whole genome sequencing data; b) SSR loci were screened from whole genome sequencing data using the search parameters of 3-6 nucleotide repeat units, 4-10 repeats, and 250 bp flanking sequences upstream and downstream of the repeat units; c) comparing the SSR loci obtained in step b) with annotated genes in the whole genome of Diplodia pseudococoa to screen out SSR loci located in non-coding regions; d) designing an SSR primer pair based on the SSR locus screened in step c); the design parameters include: annealing temperature of 55° C., 3′ end base of G or C, and amplification product length of 100 to 450 bp; e) using the SSR primer pairs designed in step d), PCR amplifying genomic DNA of Diplodia pseudococoa strains from different hosts and different regions, and detecting polymorphisms in the SSR regions of the amplified products by sequencing; retaining SSR primer pairs that can perform specific amplification and have polymorphisms in the SSR regions of the amplified products; f) obtaining the corresponding SSR marker specific to the wood canker pathogen according to the SSR primer pair retained in step e), namely, the wood canker pathogen specific SSR marker as claimed in claim 1.

3. Application of specific SSR markers for forest canker pathogens, characterized in that: The application is to use the forest canker pathogen-specific SSR marker according to claim 1 for any of the following: (1) Identification of Diplodia pseudococci; (2) Analysis of the genetic structure of the Diplodia pseudococoa population; (3) Analysis of genetic diversity of the pseudococoa hairy spore population.

4. The use according to claim 3, characterized in that When the forest canker pathogen-specific SSR markers as claimed in claim 1 are used for genetic diversity analysis of a population of Pseudomonas pseudococoa, the following steps are followed: S1. Isolate and purify the strains, and extract the genomic DNA of each strain of Diplodia pseudococoa; S2. Obtain the genotype of the SSR locus corresponding to the specific SSR marker of the wood canker pathogen of claim 1 in the genomic DNA of each strain of Diplodia pseudococoa, and obtain the SSR genotype result; S3. Calculate the genetic diversity parameters of the population composed of Diplodia pseudococoa based on the SSR genotype results.

5. The use according to claim 4, characterized in that In step S2, a primer set for specifically amplifying SSR markers specific to the wood canker pathogen is used to perform PCR amplification on the genomic DNA of Diplodia pseudococoa, and the length polymorphism of the PCR amplification product is detected to obtain the genotype of the genomic DNA of each strain of Diplodia pseudococoa at the SSR site.

6. The use according to claim 5, characterized in that The primer set for specific amplification of SSR markers specific to wood canker pathogens contains 14 SSR primer pairs, among which: The sequences of the two primers in the SSR primer pair used for specific amplification of LPS01 are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS03 are shown in SEQ ID NO. 17 and SEQ ID NO. 18, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS04 are shown in SEQ ID NO. 19 and SEQ ID NO. 20, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS08 are shown as SEQ ID NO. 21 and SEQ ID NO. 22, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS10 are shown in SEQ ID NO. 23 and SEQ ID NO. 24, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS13 are shown in SEQ ID NO. 25 and SEQ ID NO. 26, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS15 are shown in SEQ ID NO. 27 and SEQ ID NO. 28, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS21 are shown in SEQ ID NO. 29 and SEQ ID NO. 30, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS22 are shown in SEQ ID NO. 31 and SEQ ID NO. 32, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS23 are shown in SEQ ID NO. 33 and SEQ ID NO. 34, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS31 are shown as SEQ ID NO. 35 and SEQ ID NO. 36, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS34 are shown in SEQ ID NO. 37 and SEQ ID NO. 38, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS35 are shown in SEQ ID NO. 39 and SEQ ID NO. 40, respectively; The sequences of the two primers in the SSR primer pair for specific amplification of LPS39 are shown as SEQ ID NO. 41 and SEQ ID NO. 42, respectively; In each SSR primer pair, the odd-numbered primers are forward primers and the even-numbered primers are reverse primers.

7. The use according to claim 6, characterized in that When detecting the length polymorphism of the PCR amplification product, a chain termination sequencing method is used to obtain the base sequence of the PCR amplification product, and the length polymorphism of the PCR amplification product is obtained based on the base sequence of the PCR amplification product.

8. The use according to claim 7, characterized in that In step S2, for each strain of Diplodia pseudococoa, for each of the SSR sites in its genomic DNA, a PCR reaction system is prepared using the SSR primer pair corresponding to the SSR site in the primer set for specifically amplifying the SSR marker specific to the wood canker pathogen to perform PCR amplification.

9. The use according to claim 8, characterized in that Each PCR reaction system contained: 100 ng of genomic DNA of Diplodia pseudococoa as a DNA template, 1 μL of a 0.01 mol / L forward primer, 1 μL of a 0.01 mol / L reverse primer, 18 μL of a 2× high-fidelity PCR premix, and RNase-free double-distilled water; the volume of each PCR reaction system was 35 μL.

10. The use according to claim 9, characterized in that In step S2, the reaction program for PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute, for a total of 35 cycles; and final extension at 72°C for 10 minutes.

Images