SNP (Single Nucleotide Polymorphism) molecular marker related to corn plant height regulation and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to corn plant height regulation and application thereof. The sequence of the molecular marker is shown as SEQ ID NO.1, the 201bp site basic group of the sequence from the 5th end shows C / T polymorphism, a temperate zone corn inbred line Ye107 with low plant height is used as a common male parent and is respectively hybridized with one temperate zone and four tropical / subtropical corn inbred lines as female parents, and a corn polyparent group with obvious plant height difference is constructed. GWAS analysis and linkage analysis are used for co-localization to Chr1: SNP-25, 296 and 496 which are located in a chromosome 1 and remarkably related to the plant height, 3.59% of plant height phenotypic variation can be explained through the loci, a functional gene for regulating and controlling the corn plant height is excavated from the loci, and a qRT-PCR result shows that the gene is highly expressed in corn V14 period internodes, so that it is proved that the gene participates in regulation and control height correlation of the corn plant height, and the functional gene is a functional gene for regulating and controlling the corn plant height. Results of the invention provide technical support for efficient and accurate breeding of high-stalk or dwarf high-yield corn varieties by molecular markers.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, and in particular to a SNP molecular marker related to corn plant height regulation and application thereof. Background Art

[0002] Plant height is a key agronomic trait affecting maize yield and environmental adaptability. Appropriate plant height can improve lodging resistance, planting density, and harvest index, thereby promoting stable and increased maize yields. Maize is not only an important food crop worldwide, but also a vital source of feed and industrial raw materials. Its high yield and wide adaptability make it a key crop in global agricultural production. However, compared to other food crops, maize plant height exhibits a certain degree of genetic variability. Therefore, breeders analyze the relationship between different maize genotypes and plant height to further develop tall or short maize varieties.

[0003] Although there have been studies on maize plant height genes, such as the Chinese patent CN201110333262.6, which discloses a single-nucleotide polymorphism (SNP) associated with maize plant height, the discovery of this locus provides important evidence for molecular marker-assisted selection for plant height. However, as maize plant height is a complex quantitative trait, its formation involves the coordinated regulation of multiple genes and environmental interactions. Existing research still has the following limitations: the limited applicability of known molecular markers and insufficient identification of key regulatory genes.

[0004] In summary, improving maize plant height is an important goal of maize breeding and biotechnology improvement. Discovering functional genes associated with maize plant height can provide technical support for molecular marker-assisted selection to breed high-yield maize. Summary of the Invention

[0005] To address the above problems, the present invention provides a site Chr1: SNP-25,296,496 located on chromosome 1 of maize that is significantly associated with regulating plant height. This site was discovered by the present invention through genome-wide association study (GWAS), and the functional gene Zm00001eb008340 that regulates maize plant height was further excavated. qRT-PCR results also showed that the expression level of this gene was significantly increased in the V14 internodes of the four parents, further verifying the relationship between this molecular marker and plant height.

[0006] This study, published in the journal Nature Communications, identifies a SNP (Chr1: SNP-25,296,496) and its associated gene, Zm00001eb008340, as a novel target for regulating maize plant height. Significant associations between this SNP and plant height were detected in all three environments. This provides a precise tool for marker-assisted breeding (e.g., MAS and MABC) and enables efficient selection of tall and short cultivars.

[0007] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a SNP molecular marker related to maize plant height regulation. The SNP site is located at Chr1:SNP-25,296,496 of maize chromosome 1. The molecular marker sequence is shown in SEQ ID NO: 1, wherein the 201st base presents a C / T polymorphism.

[0008] As a further supplement to the above scheme: when the genotype of the 201st site in the molecular marker is CC, the corn exhibits a dwarf stalk trait; when the base mutation is TT, the corn exhibits a tall stalk trait.

[0009] The present invention also provides a kit for detecting the SNP molecular marker, which comprises primers, probes or sequencing reagents for detecting the SNP site.

[0010] Preferably, the primer sequences are shown in SEQ ID NO: 4 (front primer) and SEQ ID NO: 5 (back primer). The primers have high specificity and can efficiently amplify molecular marker fragments.

[0011] The present invention also provides a method for regulating corn plant height, using gene editing technology to mutate the 201st base of the sequence shown in SEQ ID NO: 1 from C to T to obtain a corn variety with an appropriate height.

[0012] The gene editing technology is CRISPR / Cas9, CRISPR / Cas12a, TALEN, PE (Prime Editors), or ZFN. In other words, in some specific embodiments, the gene editing tool can be a CRISPR / Cas9 system, a CRISPR / Cas12a system, a Prime Editor (PE), a ZFN (Zinc Finger Nucleases), a TALEN (Transcription Activator-Like Effector Nucleases) or other existing technology tools.

[0013] The present invention also provides a maize plant height regulating protein associated with the SNP molecular marker, and the amino acid sequence of the protein is shown in SEQ ID NO:3.

[0014] The present invention also provides a gene encoding the protein, the nucleotide sequence of which is shown in SEQ ID NO: 2. The expression level of the protein or gene is positively correlated with the growth of corn plant height.

[0015] The present invention also provides the use of the SNP molecular marker, the protein or the gene in corn molecular marker-assisted breeding, including: screening of tall or short corn varieties, whole genome selection breeding (GS) or gene editing breeding.

[0016] That is, its application scope includes but is not limited to: using this molecular marker to carry out breeding strategies such as molecular marker-assisted selection (MAS), molecular marker-assisted backcrossing (MABC), genotype selection (GS) and / or whole genome selection (GWS) of corn varieties, so as to efficiently and accurately cultivate new tall or short corn varieties; it can also be used for the evaluation and screening of plant height traits of corn germplasm resources.

[0017] The present invention also provides a method for identifying or assisting in identifying corn plant height based on the molecular marker, comprising the following steps: Extracting DNA from corn samples to be tested; Detect the genotype of Chr1:SNP-25,296,496; If the genotype of the 201 bp position of the molecular marker is TT, it is determined to be tall corn; if it is CC, it is determined to be dwarf corn.

[0018] In some specific embodiments, the product for detecting the molecular marker of the SNP site can be a detection product designed for the site of the present invention based on known single nucleotide polymorphism (SNP) detection methods such as Sanger sequencing, TaqMan probe method, ARMS-PCR method (Amplification Refractory Mutation S Yanshantem PCR), KASP (Kompetitive Allele-Specific PCR) method, etc.

[0019] The present invention features the following: A single nucleotide polymorphism (SNP) molecular marker (Chr1: SNP-25,296,496) on maize chromosome 1, associated with plant height regulation, has been discovered. Its sequence is shown in SEQ ID NO: 1. The base polymorphism (C / T) at this site is significantly correlated with maize plant height: a CC genotype results in short stalks, while a TT genotype results in tall stalks. Detection of this SNP can aid in the breeding of tall or short stalk maize varieties.

[0020] This study used the dwarf inbred line Ye107 as the male parent and crossed it with maize from five different ecotypes (one temperate and four tropical / subtropical) to construct a multi-parent population (917 recombinant inbred lines) with significant differences in plant height. Genome-wide association studies (GWAS) and linkage analyses mapped SNPs -25,296,496, and the QTL interval validated the reliability of this locus. qRT-PCR revealed that the expression level of Zm00001eb008340 (encoding ubiquitin carboxyl-terminal hydrolase 26), a gene associated with this SNP, was significantly higher in the tall parent than in the dwarf parent. The present invention also discovered that the expression of the gene Zm00001eb008340 (encoding ubiquitin carboxyl-terminal hydrolase 26), associated with this SNP, is positively correlated with plant height, with particularly high expression during the V14 growth stage of maize. Primers and a kit for detecting this gene or protein are provided (e.g., primers set forth in SEQ ID NOs: 4 and 5).

[0021] Compared with the prior art, the present invention has the following beneficial effects: 1. Precision breeding technology: The present invention provides a SNP molecular marker (Chr1: SNP-25,296,496) that is significantly correlated with maize plant height. By detecting C / T polymorphism, it can quickly screen tall or short stalk varieties, significantly shortening the breeding cycle.

[0022] 2. Functional gene verification: This paper discovered and verified for the first time that gene Zm00001eb008340 (encoding ubiquitin carboxyl-terminal hydrolase) affects plant height by regulating the auxin signaling pathway, providing a new target for molecular design breeding.

[0023] 3. Multi-environment stability: The present invention uses GWAS and QTL joint analysis to confirm that the site is stably associated in three environments (PVE is 3.59%), overcoming the limitations of a single method and achieving high reliability of the results.

[0024] 4. Development of efficient tools: Supporting kits and gene editing methods (such as CRISPR targeted mutagenesis) can achieve targeted improvement of corn plant height and are suitable for molecular marker-assisted selection (MAS) and genotype selection (GS).

[0025] 5. Wide application: It is suitable for temperate, tropical / subtropical corn germplasm resources and can be flexibly used in the breeding of high-density lodging-resistant dwarf varieties or tall varieties with increased biomass yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0027] Figure 1A pedigree of NAM populations with significant differences in plant height was constructed for hybrids of five tropical / subtropical / temperate parents with the superior temperate dwarf parent Ye107. Figure 2 The scatter plots of plant height phenotype frequency distribution and correlation matrix of multi-parent populations under three environments are shown; Figure 3 (A) SNPs marker density heat map; (B) phylogenetic tree of multi-parent population; (C) three-dimensional principal component analysis (PCA) plot; (D) linkage disequilibrium (LD) decay plot; Figure 4 Manhattan plot (left) and QQ plot (right) of maize plant height-related SNPs analyzed using GWAS in different environments. Significant SNPs associated with maize plant height in (A) the 21st Jinghong environment, (B) the 22nd Yanshan environment, (C) the 23rd Yanshan environment, and (D) the BLUP (Best Linear Unbiased Prediction) environment. Figure 5 Overlapping of SNPs and QTL intervals significantly associated with maize plant height identified by GWAS and QTL mapping. Red lines indicate QTLs identified in the 21 Jinghong environment, and blue lines indicate colocalization of SNPs identified by GWAS in the 21 Jinghong, 22 Yanshan, and 23 Yanshan environments and BLUP analysis. Figure 6 The relative expression levels of Zm00001eb008340 gene at different stages. A represents the growth and development dynamics of the 7th internode of the five parents at four stages (V8, V14, VT, R3). B represents the relative expression levels of Zm00001eb008340 gene in the five parents. The symbol ** indicates P Significance < 0.005, *** indicates P The significance was < 0.001, and ns indicated that the difference was not significant. DETAILED DESCRIPTION

[0028] To further illustrate the present invention, the following description of the molecular marker site Chr1: SNP-25,296,496 on chromosome 1 of maize that regulates plant height, the Zm00001eb008340 gene or protein associated with the site, and their applications are described in detail in conjunction with the accompanying drawings and examples. However, they should not be construed as limiting the scope of protection of the present invention.

[0029] On one hand, the present invention provides a SNP molecular marker site Chr1: SNP-25,296,496 on chromosome 1 of maize that regulates plant height. The site is referenced to genome B73 (RefGen_v5). In some specific embodiments, for detecting the SNP site, the present invention provides a molecular marker sequence as shown in SEQ ID NO: 1. The base of the 201 bp position from the 5' end of the sequence as shown in SEQ ID NO: 1 presents a C / T polymorphism. Those skilled in the art can design corresponding products for detection based on the sequence as shown in SEQ ID NO: 1 provided by the present invention, using detection methods known in the art. Based on the test results, if the genotype of the site is TT, the corn sample to be tested is judged to be a corn variety with an appropriate height.

[0030] On the other hand, the present invention uses GWAS and linkage analysis to locate Chr1: SNP-25,296,496 on chromosome 1 that is significantly correlated with plant height regulation, and then discovers the functional gene Zm00001eb008340 that regulates corn plant height. The amino acid sequence of the Zm00001eb008340 protein is shown in SEQ ID NO: 3, and the gene sequence encoding the protein is shown in SEQ ID NO: 2. The qRT-PCR results show that the expression level of this gene is significantly increased in the internodes of the four parents at the V14 stage, that is, the expression level of this gene or protein is positively correlated with the regulation of corn plant height. In some specific embodiments, those skilled in the art can design corresponding detection products based on the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3 provided by the present invention, and screen tall-stalked or short-stalked high-yield corn varieties through the expression level of Zm00001eb008340.

[0031] The present invention also provides a kit for detecting the SNP molecular marker, which comprises primers, probes or sequencing reagents for detecting the SNP site, and the primer sequences are shown in SEQ ID NO: 4 (front primer) and SEQ ID NO: 5 (back primer).

[0032] The SNP site of the present invention represents: the SNP site located at 25,296,496 bp of chromosome 1 (Chromosome 1) of the maize B73 reference genome (RefGen_v5) is named Chr1: SNP-25,296,496, and the site is a C / T polymorphism (reference allele C, variant allele T).

[0033] The gene Zm00001eb008340 is named according to the B73 RefGen_v5 genome annotation, MaizeGDB database ID: Zm00001eb008340; Zm=maize, 00001eb=genome version identifier, 008340=gene ID.

[0034] The meanings of the English abbreviations involved in the following examples are as follows: GWAS (Genome-Wide Association Study); QTL (Quantitative Trait Locus); RILs (Recombinant Inbred Lines); LD (Linkage Disequilibrium); PCA (Principal Component Analysis); MLM (Mixed Linear Model); qRT-PCR (quantitative RealTime PCR); SNP (Single Nucleotide Polymorphism).

[0035] Example 1

[0036] 1 Experimental Methods

[0037] 1.1 Plant materials and experimental design In this study, five backbone maize inbred lines (YML32, CML171, TML418, NK40-1, and Chang7-2) were used as female parents and crossed with Ye107, a temperate maize dwarf inbred line with high density tolerance and high yield combining ability, as the male parent to obtain F1 hybrids. The F1 plants were self-pollinated for seven generations using the single-seed method to construct five multi-parent populations consisting of subpopulations: population 1 (YML32×Ye107), population 2 (CML171×Ye102), population 3 (TML418×Ye102), population 4 (NK40-1×Ye107), and population 5 (Chang7-2×Ye107). A total of 917 F8 RILs ( Figure 1). The distribution is as follows: population 1 (173), population 2 (190), population 3 (176), population 4 (180) and population 5 (198). The parents and recombinant inbred lines of these multi-parent populations were planted in Jinghong City, Yunnan Province (N 21°27′~22°36′, E 100°25′~101°31′, 552.7m above sea level) in 2021, and in Yanshan County, Yunnan Province (N 23°60′, E 104°4′, 1572m above sea level) in 2022 and 2023. This experiment was conducted using a randomized complete block design (RCBD), with three biological replicates set up in each environment. The row length of each experimental plot was 3.5 meters, the row spacing was 70 cm, the plant spacing was 25 cm, and there were 14 plants per row. Twenty days after maize flowering, 5–10 plants were randomly selected from each plot and their plant height (measured in centimeters) was measured from the ground to the top of the tassel. The pedigrees, heterotic groups, and ecotypes of the six parents are shown in Table 1.

[0038] Table 1 Parent information

[0039] 1.2 Heritability analysis After systematically organizing and quality-controlling the phenotypic data collected over three consecutive years, statistical analysis was performed using SPSS Statistics 26. This included calculations of mean, minimum, maximum, standard deviation, coefficient of variation, skewness, and kurtosis. Kurtosis and skewness were used to assess the normal distribution of the phenotypic data. Pearson correlation coefficient analysis and related graphs were performed using Origin (Origin 2022). Broad-sense heritability was calculated according to the method of Knapp et al.

[0040] 1.3 DNA extraction and genome sequencing Genomic DNA was first extracted from young leaves of F8 RIL maize using the cetyltrimethylammonium bromide (CTAB) method. DNA purity was assessed using a nanophotometer (IMPLEN, CA, USA), and DNA concentration was measured using the Qubit™ DNA Assay Kit and the Qubit 2.0 Fluorometer (Life Technologies, Grand Island, NY, USA). For library preparation, 1.5 µg of high-quality DNA was processed per sample using the TruSeq Nano DNA HT Sample Preparation Kit (Illumina, USA). DNA was fragmented to an average size of 350 bp by sonication, followed by end-repair, 3′-end adenylation, and Illumina adapter ligation. Adapter-ligated DNA was amplified by polymerase chain reaction (PCR), and the resulting library was purified using the AMPure XP system. Library fragment size distribution was verified using an Agilent 2100 Bioanalyzer and quantified by real-time PCR. Sequencing was performed on the Illumina NovaSeq 6000 platform, generating 150 bp paired-end reads with an insert length of 350 bp. Raw sequencing data were quality-controlled (QC) and filtered. Clean reads were aligned to the reference genome B73 (RefGen_v5) using BWA (Burrows-Wheeler Aligner) software to identify all genetic variants across the genome. SNPs were called using the Genome Analysis Toolkit software, and SNPs were filtered using PLINK v1.9 with the -geno 0.2 and -maf 0.05 parameters. SNPs with a missingness greater than 10% and a minimum allele frequency (MAF) less than 5% were removed. Finally, functional annotation of the identified SNPs was performed using ANNOVAR software.

[0041] 1.4 Phylogenetic tree, PCA, and linkage disequilibrium analysis The maximum parsimony (MP) method was used to calculate the distance matrix and construct the phylogenetic tree. Principal component analysis (PCA) was performed using GCTA software and cluster analysis was performed using the GAPIT package in R software. PCA results were then visualized using scatter plots. The degree of linkage disequilibrium (r) between pairwise SNP markers across the genome was calculated using PopLDdecay software. 2 ), and the software's included script, Plot_OnePop.pl, was used to visualize the LD decay analysis results. Based on the LD decay pattern, the number of markers required for GWAS and its detection efficiency were further evaluated.

[0042] 1.5 Genome-wide association analysis After sequencing on the Illumina NovaSeq6000, the BAM files were processed and then a genome-wide association study (GWAS) of plant height was performed using a mixed linear model (MLM) in the GEMMA software. In the GWAS analysis, individual kinship and population stratification are the main factors causing false positives. Therefore, this study used MLM for marker-trait association analysis, taking population genetic structure as a fixed effect and individual kinship as a random effect to correct for the effects of population structure and individual kinship. The minor allele frequency (MAF) > 5% and r 2 <0.2 was used to screen for SNPs associated with plant height, with the plink-indep-pairwise parameter set to 5050.2. A statistical significance threshold of −log10(p) > 6 was calculated using the formula −log10(1 / total number of SNPs), and SNPs significantly associated with pH were identified based on this threshold. Quantile-quantile (QQ) and Manhattan plots were then generated using R software (v4.3.3). Significant SNPs were screened using Bed Tools v1.7. Furthermore, candidate genes associated with plant height were identified within 20 kb upstream and downstream of the significant SNPs based on the B73 v5 reference genome and annotation information.

[0043] 1.6 Construction of genetic linkage maps Linkage maps were constructed using JoinMap 4.0 software, and the LOD threshold was determined using 1000 random permutation tests. QTLs were considered significant if the LOD threshold was ≥2.5. Linkage groups were defined based on a LOD cutoff value ≥2.5, and a genetic linkage map was constructed using SNP markers that met the criteria. Progeny genotyping was filtered based on 0.8 completeness and 0.001 partial segregation to obtain six population markers. Bins were then drawn based on every 15th population marker that did not show linkage, resulting in the final population markers. The bins for each population were sorted using JoinMap 4.0, and the genetic distances (cM) between markers were calculated using the Kosambi function.

[0044] 1.7 QTL mapping analysis QTL mapping was performed using the composite interval mapping (CIM) method in Windows QTL Cartographer 2.0. Phenotypic data for plant height were integrated into a high-density genetic linkage map. SNP markers with a missingness ratio ≥ 0.2 and loci with a minor allele frequency less than 0.05 were excluded, and a threshold of 0.21 cM was used to identify parental polymorphic QTLs. A 95% confidence interval threshold was determined using 1000 random permutations. A LOD threshold of 2.5 was set for flanking markers to identify QTLs regulating plant height.

[0045] 1.8 Identification and functional annotation of candidate genes By integrating GWAS and QTL mapping results, the physical locations of significant SNPs identified by GWAS were compared with the QTL intervals. The physical location of the significant SNP was determined using the BLAST function in MaizeGDB. Candidate genes regulating plant height were discovered within the 20 kb region upstream and downstream of the significant SNP. Functional annotation of the identified genes was performed using the NCBI, MaizeGDB, InterPro, and UniProt databases, and candidate genes involved in plant height regulation were identified.

[0046] 1.9 Relative expression analysis of candidate genes in parents In this study, samples were collected from the middle of the seventh internode of five parental lines at four developmental stages: the eighth leaf stage (V8), the rapid growth stage (V14), the tasseling stage (VT), and the milky stage (R3). Total RNA was extracted using the Tiangen RNAprep Pure Plant Kit, and genomic DNA was removed and cDNA synthesized using the FastKing RT Kit (with gDNase). Real-time quantitative PCR (qRT-PCR) was used to determine the relative expression levels of four candidate genes in the five parental lines using the Tiangen SuperReal PreMix Plus (SYBR Green) Kit (Tiangen, Beijing). The maize actin 1 gene (Actin) was used as an internal reference gene (primer sequences: SEQ ID NO. 6 F - 5'TACGAGATGCCTGATGGTCAGGTCA, SEQ ID NO. 7 R - 5'TGGAGTTGTACGTGGCCTCATGGA). qRT-PCR was performed using the standardized protocol used by Bi et al. Three technical replicates were performed for each sample, and relative gene expression was calculated using the method described above.

[0047] 2 Experimental Results

[0048] 2.1 Plant height phenotypic analysis A preliminary statistical analysis of the plant height phenotypic data of the five RIL subpopulations revealed that the plant heights of all female plants (156.0-216.0 cm) were significantly different from the male plant, PH Ye 107 (155.0 cm). The plant heights of the RILs population also showed a wide range of phenotypic variations ( Figure 1 ). Descriptive statistics of the plant height phenotypic data of the five RILs groups were performed. As shown in Table 2, the plant height of group 4 ranged from 116.0 to 253.0 cm, with the highest mean value of 190.0 cm among the five groups, and the coefficient of variation values ​​in the three environments were 13.6%, 13.2%, and 13.1%, respectively. The plant height of group 5 had the lowest mean value of 164.4 cm, ranging from 82.0 to 258.0 cm, but its variation range was the largest, with the coefficient of variation values ​​in the three environments as high as 18.9%-19.2%, indicating that this group had richer phenotypic variation. Frequency distribution analysis of the plant height phenotypic data showed that the absolute values ​​of the skewness and kurtosis of all groups in different environments were less than 1, which was consistent with the normal distribution characteristics (Table 2, Figure 2 ), meeting the prerequisite for quantitative trait genetic analysis. The broad-sense heritability of plant height in populations 1 to 5 was 97.9%, 96.9%, 98.3%, 97.5%, and 96.2%, respectively. Pearson correlation analysis (significance level p < 0.05) showed that there was a highly significant positive correlation (0.94-0.97) between the plant heights of RILs in the same population in three different environments ( Figure 2 ), indicating that maize plant height is mainly regulated by genetic factors and is less affected by the environment.

[0049] Table 2 Descriptive statistical analysis of plant height in multi-parent populations

[0050] 2.2 Phylogenetic tree analysis, principal component analysis (PCA), and linkage disequilibrium analysis Whole genome sequencing (WGS) technology was used to scan the whole genome of maize, and a total of 6,389,682 high-quality SNPs were identified on 10 chromosomes. The SNP marker density heat map showed that the number of SNPs on chromosomes 1-10 was 891,814, 699,810, 717,023, 880,707, 669,104, 485,237, 564,060, 545,295, 473,708, and 462,924, respectively. Among them, the number of SNPs on chromosome 1 was the largest, while the number of SNPs on chromosome 10 was the smallest ( Figure 3 A). Phylogenetic analysis showed that the phylogenetic tree constructed using the neighbor-joining method can be divided into five significantly different subpopulations ( Figure 3B). The PCA results are highly consistent with the phylogenetic classification, with five distinct subgroups ( Figure 3 C). 6,389,682 high-quality SNPs were used for LD decay analysis. It was found that when r 2 When the plateau threshold is reached, the physical distance of LD decay is about 20 kb ( Figure 3 D). Based on this feature, the present invention screened candidate genes within 20 kb upstream and downstream of significant SNPs.

[0051] 2.3 Discovery and validation of molecular markers

[0052] 2.3.1 Genome-wide association analysis of PH in multi-parent populations Based on the phenotypic data of 917 F8 RILs in a multi-parent population and 6,389,682 high-quality SNPs, a mixed linear model (MLM) was used for GWAS analysis. Under the condition of a significance threshold of −log10 (p)>6, multiple SNPs significantly associated with plant height were detected, among which Chr1: SNP-25,296,496 was detected in all environments (21 Jinghong, 22 Yanshan, 23 Yanshan and BLUP) ( Figure 4 ), and SNP-25,296,496 had high p-values ​​ranging from 6.95 to 7.56, explaining 3.07% to 3.59% of the phenotypic variation. This locus provides important clues for further exploring candidate genes regulating maize plant height. Because artificial populations can lead to false positives in GWAS analysis, this study will further validate the molecular markers identified by GWAS using QTL analysis to improve identification accuracy.

[0053] 2.3.2 QTL mapping and validation of GWAS results Using plant height phenotypic data from various populations under different environments, combined with a constructed high-density genetic map, QTL mapping for maize plant height was performed. The mapping results were compared with GWAS analysis results. Ultimately, under the 21 Jinghong environment, a QTL interval, qPH1-1, was identified in the NK40-1×Ye107 population, explaining 6.35% of the phenotypic variation. This QTL interval encompassed the Chr1: SNP-25,296,496 sites identified by GWAS ( Figure 5 ), indicating that the molecular marker Chr1: SNP-25,296,496 site discovered by GWAS analysis was verified by QTL positioning, confirming that this is the same key site.

[0054] 2.4 Identification and functional verification of candidate genes related to plant height regulation

[0055] 2.4.1 Identification of candidate genes This study used the B73_RefGen_v5 reference genome to identify candidate genes regulating maize plant height within the 20 kb range upstream and downstream of SNP-25,296,496 in the qPH1-1 interval. Functional annotation of the candidate genes was performed using databases such as Maize GDB, InterPro, UniProt, and NCBI. Two candidate genes (Zm00001eb008340) were identified within the 20 kb range upstream and downstream of SNP-25,296,496 as being significantly associated with maize plant height regulation. Gene functional annotation revealed that the candidate genes, Zm00001eb008340, encode ubiquitin carboxyl-terminal hydrolase 26 (UCH26). In Arabidopsis, UCH1 and UCH2 regulate auxin-dependent developmental pathways through their deubiquitinating enzyme activities. Specifically, these two enzymes directly affect the deubiquitination process of ubiquitin substrates during auxin signal transduction by regulating the protein turnover of AXR3, a key regulatory factor in the auxin response pathway, and may thus participate in the regulation of maize plant height growth and development.

[0056] 2.4.2 Relative expression levels of Zm00001eb008340 in parental materials (qRT-PCR verification) To investigate the regulatory role of the candidate gene Zm00001eb008340 on maize plant height, qRT-PCR was used to analyze the expression patterns of five parental lines at four different maize developmental stages. Internode length measurements showed that internode length in parent NK40-1 was the longest at all stages, while that in parent Ye107 remained the shortest ( Figure 6 A). Therefore, the dwarf parent Ye 107 was used as a reference. The analysis results showed that the expression level of gene Zm00001eb008340 in parents YML 32, CML171, TML418 and NK40-1 increased significantly from V8 to V14, and V14 is the most critical period for stem growth and development. In addition, the relative expression level of gene Zm00001eb008340 in NK40-1 and CML171 was significantly higher than that in YML32 and TML418 ( Figure 6 B). This expression pattern is consistent with the pH distribution trends of NK40-1 and CML171, indicating that gene Zm00001eb008340 positively regulates maize plant height. qRT-PCR further validated the function of the gene associated with this molecular marker, confirming its involvement in plant height regulation.

[0057] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker related to maize plant height regulation, characterized in that: The SNP site is located on Chr1: SNP-25,296,496 of maize chromosome 1. The molecular marker sequence is shown in SEQ ID NO: 1, wherein the 201st base presents a C / T polymorphism.

2. The SNP molecular marker according to claim 1, characterized in that When the genotype of the 201st site in the molecular marker is CC, the corn exhibits a dwarf stalk trait; when the base mutation is TT, the corn exhibits a tall stalk trait.

3. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The kit comprises primers, probes or sequencing reagents for detecting the SNP site.

4. The kit according to claim 3, wherein The primer sequences are shown in SEQ ID NO: 4 and SEQ ID NO:

5.

5. A method for regulating corn plant height, characterized in that: Gene editing technology was used to mutate the 201st base of the sequence shown in SEQ ID NO: 1 to T to obtain a tall corn variety with suitable height.

6. The method according to claim 5, characterized in that The gene editing technology is CRISPR / Cas9, CRISPR / Cas12a, TALEN, PE or ZFN.

7. A maize plant height regulating protein associated with the SNP molecular marker according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:

3.

8. A gene encoding the protein according to claim 7, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO: 2; the expression level of the protein or gene is positively correlated with the growth of corn plant height.

9. Use of the SNP molecular marker according to claim 1 or 2, the protein according to claim 7, or the gene according to claim 8 in maize molecular marker-assisted breeding, characterized in that: include: Screening of tall or dwarf maize varieties, whole genome selection breeding (GS) or gene editing breeding.

10. A method for identifying or assisting in identifying corn plant height based on the molecular markers according to claim 1 or 2, characterized in that: The following steps are involved: Extracting DNA from corn samples to be tested; Detect the genotype of Chr1:SNP-25,296,496; If the genotype of the 201 bp position of the molecular marker is TT, it is determined to be tall corn; if it is CC, it is determined to be dwarf corn.

Images