Primer group, kit and method for identifying 23bp insertion / deletion polymorphic site of bovine prion protein gene promoter region

By designing specific primer sets and optimizing PCR conditions, an ARMS-PCR typing system was established, and the complexity and high cost of bovine prion gene detection in the existing technology was solved, and rapid and low-cost polymorphism identification was achieved, supporting cattle herd screening and mad cow disease risk assessment.

CN120555656APending Publication Date: 2025-08-29CHINA JILIANG UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510712981.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-08-29

AI Technical Summary

Technical Problem

The prior art has limitations such as high cost, complex operation, and long detection cycle when detecting 23bp insertion/deletion of polymorphic sites in the promoter area of ​​the bovine prion protein gene, which is difficult to meet the needs of grassroots laboratories and animal husbandry enterprises.

Method used

Design specific primer sets and establish a four-primer amplification hindered mutation system PCR technology (Tetra-ARMS PCR), optimize the annealing temperature and primer concentration, and achieve rapid identification of the 23bp insertion/deletion polymorphism of the bovine PRNP promoter region through multiplex PCR amplification and electrophoresis detection.

Benefits of technology

It provides a simple and easy-to-use and low-cost detection method, which can effectively identify the 23bp insertion/deletion polymorphism of the bovine PRNP promoter area on ordinary PCR and electrophoresis detection platforms, supports large-scale screening of bovine herds, evaluates the susceptibility of mad cow disease, and provides a scientific basis for disease-resistant breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555656A_ABST
    Figure CN120555656A_ABST
Patent Text Reader

Abstract

The invention provides a primer group, a kit and a method for identifying 23bp insertion / deletion polymorphic sites of a bovine prion protein gene promoter region, and belongs to the technical field of gene detection. The primer group disclosed by the invention comprises an upstream outer primer 23-PF1, an upstream inner primer 23-IFA4, a downstream inner primer 23-AR2 and a downstream outer primer 23-PR3. A specific primer group is designed aiming at 23bp insertion / deletion polymorphic sites, an ARMS-PCR typing system is established by optimizing annealing temperature and primer concentration gradient, and 23bp insertion / deletion homozygotes and hybrid genotypes of the 23bp insertion / deletion homozygotes in a bovine prion protein gene promoter region can be specifically detected. The technical problem that the current identification of the 23bp insertion / deletion polymorphic site of the prion protein gene promoter region of the cattle product is tedious is solved, the disease resistance of the cattle to the mad cattle disease can be judged, and a scientific basis is provided for genotype identification of the cattle product and mad cattle disease susceptibility evaluation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of gene detection technology, and in particular relates to a primer set, a kit and a method for identifying a 23bp insertion / deletion polymorphic site in a promoter region of a bovine prion protein gene. Background Art

[0002] Bovine Spongiform Encephalopathy (BSE), commonly known as "mad cow disease", is a fatal neurodegenerative disease caused by spatial structural variation of prion protein (PrP). The synthesis of animal prion protein is regulated by the prion protein gene (PRNP). The genetic variation of PRNP directly affects the pathological prion protein (PrP) by regulating the expression level and conformational stability of prion protein. Sc ) pathological accumulation and individual animal susceptibility to BSE. Studies have confirmed that both heterozygous and homozygous individuals carrying the 23bp deletion allele in the PRNP promoter region exhibit a higher risk of BSE, while those carrying the deletion allele have increased resistance. Therefore, PRNP genotyping can assess individual animal susceptibility to BSE and effectively monitor and evaluate cattle and bovine products. This can provide a strategy for low-cost, large-scale screening of high-quality, disease-resistant breeding stock, offer technological breakthroughs in disease-resistant breeding, and provide a scientific basis for ensuring animal husbandry safety and public health risk assessment.

[0003] Traditional methods for detecting the 23bp insertion / deletion polymorphism in the PRNP promoter region include Sanger sequencing, PCR-RFLP, real-time fluorescence quantitative PCR (qPCR), and high-throughput sequencing (NGS). However, these traditional methods are generally limited by high costs, complex procedures, and long detection cycles. For example, Sanger sequencing, the "gold standard" for genetic testing, can accurately interpret sequence information, but can lead to interpretation errors due to peak overlap and is costly. Incomplete enzyme digestion during PCR-RFLP can lead to false-negative results. NGS enables parallel analysis of multiple targets, but the equipment investment and personnel requirements limit the widespread application of these technologies for grassroots laboratories and livestock breeding enterprises. For the detection of this genetic polymorphic site, it is necessary to develop simple, easy-to-use, and scalable identification methods. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a primer set, a kit and a method for identifying the 23bp insertion / deletion polymorphism site in the bovine PRNP promoter region, construct a SNP detection system based on the four-primer amplification blocked mutation system PCR technology (Tetra-ARMS PCR), design and optimize specific primer sets, establish a method for detecting the 23bp insertion / deletion site polymorphism of the bovine PRNP gene, further improve the detection efficiency, enrich the existing detection technology methods, and provide technical support for large-scale population screening of cattle.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer set for identifying a 23bp insertion / deletion polymorphic site in the promoter region of a bovine prion protein gene, the primer set comprising an upstream outer primer 23-PF1, an upstream inner primer 23-IFA4, a downstream inner primer 23-AR2 and a downstream outer primer 23-PR3;

[0007] The nucleotide sequence of the upstream external primer 23-PF1 is shown in SEQ ID NO: 1;

[0008] The nucleotide sequence of the upstream inner primer 23-IFA4 is shown in SEQ ID NO: 2;

[0009] The nucleotide sequence of the downstream inner primer 23-AR2 is shown in SEQ ID NO: 3;

[0010] The nucleotide sequence of the downstream outer primer 23-PR3 is shown in SEQ ID NO: 4.

[0011] The present invention also provides a reagent or kit for identifying the 23bp insertion / deletion polymorphic site in the promoter region of the bovine prion protein gene, comprising the primer set.

[0012] Preferably, it also includes Taq enzyme, PCR buffer, dNTP mixture, Mg 2+ and ddH2O.

[0013] Preferably, the Mg 2+ The addition methods include MgCl2 or MgSO4.

[0014] The present invention also provides a method for identifying a 23 bp insertion / deletion polymorphic site in the promoter region of a bovine prion gene using the primer set, reagent, or kit, comprising the following steps:

[0015] 1) Extracting genomic DNA from the sample to be tested;

[0016] 2) using the genomic DNA extracted in step 1) as a template, performing multiplex PCR amplification using the primer set or the reagent or kit to obtain an amplified product;

[0017] 3) performing electrophoresis detection on the amplified product obtained in step 2);

[0018] 4) When the amplified product has only two electrophoretic bands of 422 bp and 259 bp, it is determined to be a homozygous deletion type; when the amplified product has only two electrophoretic bands of 445 bp and 193 bp, it is determined to be a homozygous insertion type; when the amplified product has only three electrophoretic bands of 445 bp, 259 bp and 193 bp, it is determined to be a heterozygous insertion-deletion type.

[0019] Preferably, in the multiplex PCR amplification reaction system of step 2), the final concentrations of the upstream outer primer 23-PF1, the upstream inner primer 23-IFA4, the downstream inner primer 23-AR2, and the downstream outer primer 23-PR3 are 0.2 μmol / L, 0.2 μmol / L, 0.15 μmol / L, and 0.4 μmol / L, respectively; 2+ The final concentration was 2.5 mmol / L.

[0020] Preferably, the reaction system of the multiplex PCR amplification in step 2) comprises the following components in 20 μL: 10× buffer 2.0 μL, 25 mmol / L dNTP 1.6 μL, 25 mmol / L Mg 2+ 2.0μL, 10μmol / L upstream outer primer 23-PF1 0.4μL, 10μmol / L upstream inner primer 23-IFA4 0.4μL, 10μmol / L downstream inner primer 23-AR2 0.3μL, 10μmol / L downstream outer primer 23-PR3 0.8μL, 5U / μL Taq enzyme 0.4μL, template DNA 3.0μL, ddH2O 9.1μL.

[0021] Preferably, the procedure for the multiplex PCR amplification in step 2) is: pre-denaturation at 95°C for 5-10 min; denaturation at 94°C for 30-50 s, annealing at 66-69°C for 35-60 s, extension at 72°C for 30-60 s, denaturation, annealing, and extension for 30-38 cycles; final extension at 72°C for 5-12 min.

[0022] Preferably, the sample to be tested in step 1) includes blood, hair, embryonic cells, beef, milk, milk powder and cheese.

[0023] Preferably, the resistance of the sample to be tested to BSE is that the insertion homozygous type has higher disease resistance than the insertion-deletion heterozygous type, and the insertion-deletion heterozygous type has higher disease resistance than the deletion homozygous type.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention designs a specific primer set (external primers 23-PF1 / 23-PR3, internal primers 23-IFA4 / 23-AR2) targeting a 23bp insertion / deletion polymorphic site. By optimizing the annealing temperature and primer concentration gradient, an ARMS-PCR typing system is established. The primer set and method of the present invention can specifically detect homozygous 23bp insertion / deletion homozygotes and hybrid genotypes in the bovine PRNP promoter region, resolving the current technical problem of cumbersome steps in identifying the 23bp insertion / deletion polymorphic site in the PRNP promoter region of bovine products. This is an important supplement to current detection technologies for the 23bp insertion / deletion polymorphic site in the PRNP promoter region of bovine products. The method can also determine the resistance of cattle to mad cow disease, providing a scientific basis for genotyping cattle products and assessing susceptibility to mad cow disease.

[0026] This invention is based on a common PCR and electrophoresis detection technology platform, meeting the equipment requirements of nearly all molecular testing laboratories, making it easy to implement and apply the technology. This method can effectively identify all potentially bovine products with simplicity, high efficiency, and low cost. It provides strong technical support for bovine genetic breeding and facilitates the safety and risk assessment of livestock products. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The results of genotype sequencing of different insertion / deletion polymorphism sites at the 23 bp site of the bovine PRNP gene in Example 1 (wherein, (--) represents a homozygous deletion genome, (+-) represents an insertion-deletion heterozygous genome, and (++) represents a homozygous insertion genome);

[0028] Figure 2 Schematic diagram of the design principle of ARMS-PCR primers for the 23 bp insertion / deletion polymorphism site in Example 2;

[0029] Figure 3 3 is a graph showing the optimization results of the annealing temperature conditions for the ARMS-PCR reaction using the bovine PRNP promoter region 23bp insertion / deletion polymorphism of the present invention in Example 3 (wherein, lane M is DNA Marker C (100-1200bp), lane 6 is a blank control, and the annealing temperatures for lanes 1-5 are 60°C, 63°C, 66°C, 69°C, and 72°C);

[0030] Figure 43 is a graph showing the optimization results of the ARMS-PCR reaction cycle number conditions for the bovine PRNP promoter region 23bp insertion / deletion polymorphism of the present invention using Example 3 (wherein, lane M is DNA Marker C (100-1200bp), lane 5 is a blank control, and lanes 1-4 have reaction cycle numbers of 30, 32, 35, and 38);

[0031] Figure 5 Example 3 is the bovine PRNP promoter region 23bp insertion / deletion polymorphism ARMS-PCR reaction Mg 2+ Optimization results of ion concentration conditions (where lane M is DNA Marker C (100-1200bp), lane 5 is blank control, lanes 1-4Mg 2+ Ion concentrations are 1.25mmol / L, 1.875mmol / L, 2.5mmol / L, and 3.125mmol / L);

[0032] Figure 6 3 is a graph showing the optimization results of Taq enzyme dosage conditions for the ARMS-PCR reaction of the bovine PRNP promoter region 23 bp insertion / deletion polymorphism of the present invention using Example 3 (wherein, lane M is DNA Marker C (100-1200 bp), lane 6 is a blank control, and the Taq enzyme dosages in lanes 1-5 are 0.2, 0.3, 0.4, 0.5, and 0.6 μL);

[0033] Figure 7 3 is a graph showing the optimization results of the internal and external primer concentration conditions for the ARMS-PCR reaction of the bovine PRNP promoter region 23bp insertion / deletion polymorphism of the present invention in Example 3 (wherein, lane M is DNA Marker C (100-1200bp), lane 1 is a blank control, and the primer names and corresponding concentrations of lanes 2-5 are 23-PF1 0.25 / 0.25 / 0.25 / 0.2 μmol / L, 23-IFA4 0.25 / 0.25 / 0.25 / 0.2 μmol / L, 23-AR2 0.25 / 0.2 / 0.15 / 0.15 μmol / L, and 23-PR3 0.25 / 0.3 / 0.35 / 0.4 μmol / L, respectively);

[0034] Figure 8 This is a graph showing the genotyping results of Example 3 using the primer set of the present invention to detect different insertion / deletion polymorphisms at the 23 bp site of the bovine PRNP promoter (wherein, lane M is DNA Marker C (100-1200 bp), lane 1 is a blank control, lanes 2-3 are homozygous insertions (+ / +), lanes 4-5 are homozygous deletions (- / -), and lanes 6-7 are heterozygous insertions (+ / -)).

[0035] Figure 9 This is a graph showing the results of Example 4 using the method of the present invention to identify commercially available bovine products (wherein, lane M is DNA Marker C (100-1200 bp), lanes 1, 2, 3, 4, 5, 6, 13, 22, and 23 (corresponding to sample numbers 1-6, 13-15) are insertion homozygous (+ / +), lanes 7, 8, 9, 14, 15, 16, 20, and 24 (corresponding to sample numbers 7-9, 16, 17, and 21-23) are insertion-deletion heterozygous (+ / -), and lanes 10, 11, 12, 17, 18, 19, and 21 (corresponding to sample numbers 10-12, 18-20, and 24) are deletion homozygous (- / -)). DETAILED DESCRIPTION

[0036] The present invention provides a primer set for identifying a 23bp insertion / deletion polymorphic site in the promoter region of the bovine prion protein gene (PRNP), the primer set comprising an upstream outer primer 23-PF1, an upstream inner primer 23-IFA4, a downstream inner primer 23-AR2 and a downstream outer primer 23-PR3;

[0037] The nucleotide sequence of the upstream external primer 23-PF1 is shown in SEQ ID NO: 1, specifically GCAATGCAGCTTCCATGTTGTTTACTGA;

[0038] The nucleotide sequence of the upstream inner primer 23-IFA4 is shown in SEQ ID NO: 2, specifically ACGTTAATCTCAGATGTCTTCCCAACAGC;

[0039] The nucleotide sequence of the downstream inner primer 23-AR2 is shown in SEQ ID NO: 3, specifically ACTCTGCCCCATGACGTCTGAGGTTT;

[0040] The nucleotide sequence of the downstream external primer 23-PR3 is shown in SEQ ID NO: 4, specifically CGTGAGGGTTTGAGGGAACGAAATGAC.

[0041] In the bovine prion protein gene (PRNP), a 23bp insertion / deletion polymorphism in the promoter region is a key factor in regulating gene expression and is significantly associated with bovine transmissible spongiform encephalopathy (BSE) susceptibility. This polymorphic site is located in the promoter sequence region, and its dynamic sequence changes (TCTCAGATGTCTTCCCAACAGCA insertion or deletion) change the three-dimensional conformation of chromatin through binding to the 58kDa repressor protein (RP58), thereby affecting the expression, modification, and product three-dimensional structure of the bovine PRNP gene, ultimately affecting the susceptibility of cattle to BSE. The present invention designs a specific primer set (external primers 23-PF1 / 23-PR3, internal primers 23-IFA4 / 23-AR2) for the 23bp insertion / deletion polymorphic site and establishes an ARMS-PCR typing system by optimizing the annealing temperature and primer concentration gradient. Electrophoresis results showed that individuals homozygous for deletions amplified two bands of 422 bp and 259 bp, while individuals heterozygous for insertions and deletions amplified three bands of 445 bp, 259 bp, and 193 bp. Homozygous insertions specifically amplified two bands of 445 bp and 193 bp. This method can rapidly identify the 23 bp insertion / deletion polymorphism in the PRNP gene during genetic screening for disease resistance in cattle, providing a molecular marker-assisted tool for disease-resistant breeding.

[0042] The present invention also provides a reagent or kit for identifying a 23bp insertion / deletion polymorphic site in the promoter region of bovine prion protein gene (PRNP), comprising the primer set.

[0043] In the present invention, Taq enzyme, PCR buffer, dNTP mixture, Mg 2+ and ddH2O; the Mg 2+ The addition methods include MgCl2 or MgSO4.

[0044] The present invention also provides a method for identifying a 23 bp insertion / deletion polymorphic site in the promoter region of a bovine prion protein gene (PRNP) using the primer set, reagent, or kit, comprising the following steps:

[0045] 1) Extracting genomic DNA from the sample to be tested;

[0046] 2) using the genomic DNA extracted in step 1) as a template, performing multiplex PCR amplification using the primer set or the reagent or kit to obtain an amplified product;

[0047] 3) performing electrophoresis detection on the amplified product obtained in step 2);

[0048] 4) When the amplified product has only two electrophoretic bands of 422 bp and 259 bp, it is determined to be a homozygous deletion type (- / -); when the amplified product has only two electrophoretic bands of 445 bp and 193 bp, it is determined to be a homozygous insertion type (+ / +); when the amplified product has only three electrophoretic bands of 445 bp, 259 bp and 193 bp, it is determined to be a heterozygous insertion-deletion type (+ / -).

[0049] In the present invention, genomic DNA of the sample to be tested is extracted. The sample to be tested includes blood, hair, embryonic cells, beef, milk, milk powder and cheese; after obtaining the genomic DNA of the sample to be tested, the DNA quality is tested to make the DNA quality test D 260 / 280 Reach 1.8 to 2.0, preferably 1.9.

[0050] In the present invention, the genomic DNA extracted in step 1) is used as a template, and the primer set or the reagent or kit is used to perform multiple PCR amplification to obtain an amplified product. The final concentrations of the upstream outer primer 23-PF1, the upstream inner primer 23-IFA4, the downstream inner primer 23-AR2, and the downstream outer primer 23-PR3 in the multiple PCR amplification reaction system are 0.2 μmol / L, 0.2 μmol / L, 0.15 μmol / L, and 0.4 μmol / L, respectively; the Mg 2+ The final concentration of the multiplex PCR amplification reaction system, based on 20 μL, includes the following components: 10× buffer 2.0 μL, 25 mmol / L dNTP 1.6 μL, 25 mmol / L Mg 2+ 2.0 μL, 10 μmol / L upstream outer primer 23-PF1 0.4 μL, 10 μmol / L upstream inner primer 23-IFA4 0.4 μL, 10 μmol / L downstream inner primer 23-AR2 0.3 μL, 10 μmol / L downstream outer primer 23-PR3 0.8 μL, 5 U / μL Taq enzyme 0.4 μL, template DNA 3.0 μL, ddH2O 9.1 μL; the program of the multiplex PCR amplification is preferably: pre-denaturation at 95°C for 5 to 10 min; denaturation at 94°C for 30 to 50 s, annealing at 66 to 69°C for 35 to 60 s, extension at 72°C for 30 to 60 s, and 30 to 38 cycles of denaturation, annealing, and extension; final extension at 72°C for 5 to 12 min; more preferably, pre-denaturation at 95°C for 8 min; denaturation at 94°C for 35 s, annealing at 69°C for 40 s, extension at 72°C for 40 s, and 35 cycles of denaturation, annealing, and extension; and final extension at 72°C for 10 min.

[0051] In the present invention, the amplified product obtained in step 2) is subjected to electrophoresis detection. The initial concentration of agarose during the electrophoresis detection is 1.5-2.5wt%, preferably 1.6-2.4wt%, and more preferably 1.8-2.2wt%. The agarose gel used in the agarose gel electrophoresis detection also contains 0.1% of the nucleic acid dye Gelred.

[0052] In the present invention, when the amplified product has only two electrophoretic bands of 422 bp and 259 bp, it is determined to be a homozygous deletion type (- / -); when the amplified product has only two electrophoretic bands of 445 bp and 193 bp, it is determined to be a homozygous insertion type (+ / +); when the amplified product has only three electrophoretic bands of 445 bp, 259 bp, and 193 bp, it is determined to be a heterozygous insertion-deletion type (+ / -). The resistance of the sample to be tested to mad cow disease is that the homozygous insertion type has higher disease resistance than the heterozygous insertion-deletion type, and the heterozygous insertion-deletion type has higher disease resistance than the homozygous deletion type.

[0053] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1 Confirmation of the Bovine PRNP Gene Sequence

[0055] This example provides a bovine PRNP promoter region specific site, and the specific steps are as follows:

[0056] (1) Six blood samples of cattle were collected (with complete farm pedigree records and confirmed by Sanger sequencing) and genomic DNA was extracted according to the instructions of the animal tissue kit (purchased from Hangzhou Xinjing Biotechnology Co., Ltd.).

[0057] (2) Using the genomic DNA extracted in step (1) as a template, the 23 bp insertion / deletion polymorphism site in the bovine PRNP promoter region was identified. The PCR amplification primers were used according to the literature (Imran M, Mahmood S, Babar ME, et al. PRNP gene variation in Pakistani cattle and buffaloes [J]. Gene, 2012, 505 (1): 180-185.). The primers are as follows:

[0058] Upstream primer 23indelF (SEQ ID NO: 5): 5′-AGCCAGGTAAGAAGCTCATC-3′;

[0059] Downstream primer 23indelR (SEQ ID NO: 6): 5'-CATGAATTGTGTAGGCCAAA-3'.

[0060] (3) The amplified product obtained in step (2) is subjected to agarose gel electrophoresis detection, wherein the initial concentration of agarose during the agarose gel electrophoresis detection is 1.5 wt %, and the agarose gel also contains 0.1% by weight of the nucleic acid dye Gelred.

[0061] (4) When the amplified product has only one electrophoretic band of 245 bp, the individual is determined to be homozygous for the 23 bp deletion in the PRNP promoter region. When the amplified product has only two electrophoretic bands of 245 bp and 268 bp, the individual is determined to be heterozygous for the 23 bp insertion-deletion in the PRNP promoter region. When the amplified product has only one electrophoretic band of 268 bp, the individual is determined to be homozygous for the 23 bp insertion in the PRNP promoter region.

[0062] Based on the above identification, the 23bp insertion / deletion polymorphism sequence product of cattle was amplified and subjected to Sanger sequencing. The PRNP sequence fragments obtained by cattle sequencing were aligned using MegAlign software, which proved that there was a 23bp insertion / deletion polymorphism in the promoter region. The site had different genotypes in the samples, including homozygous deletion, heterozygous insertion-deletion, and homozygous insertion. The experimental results are as follows: Figure 1 shown.

[0063] Example 2 Design of ARMS-PCR Primers for the 23 bp Insertion / Deletion Polymorphism Site in the Bovine PRNP Promoter Region

[0064] With reference to the bovine PRNP sequence (AJ298878.1) and sequencing results, individuals with different polymorphic genotypes of 23bp fragment insertion / deletion were selected from the sample, and four-primer amplification blocked mutation PCR (Tetra-ARMS-PCR) primer design was performed based on the site sequence polymorphism. In order to introduce a positive control in the ARMS-PCR reaction to improve the accuracy of detection, the present invention simultaneously designed a positive control primer and a mutation site detection specific primer. When designing the inner primers, the 3' ends of the upstream and downstream inner primers were placed at the 23bp insertion / deletion polymorphism site in the promoter region, and paired with two different homozygous genotypes respectively. At the same time, a pair of reference outer primers were designed at the same position of the cattle's shared conserved sequence. In order to improve the specificity of the primers, the insertion primer bases were designed to be complementary to the insertion sequence. At the same time, in order to improve the specific effect of the primers, mismatched bases were introduced into the downstream inner primers. The schematic diagram of the primer design principle is shown in FIG. Figure 2 The designed primer sequences are shown in Table 1.

[0065] Table 1 Primer sequences

[0066]

[0067]

[0068] Note: Lowercase letters represent bases that are completely complementary to the inserted sequence, and the bases in the box represent introduced mismatches.

[0069] Example 3 Optimization of ARMS-PCR reaction conditions for the 23 bp insertion / deletion polymorphism in the bovine PRNP promoter region

[0070] (1) The bovine blood sample DNA of Example 1 was used as the template DNA for the optimized ARMS-PCR system of the present invention.

[0071] (2) Amplification was performed using a basic PCR program, and the annealing temperature and number of cycles were optimized using a gradient PCR instrument. The basic program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 35 s; annealing (at 60°C, 63°C, 66°C, 69°C, and 72°C) for 40 s; extension at 72°C for 40 s, for 30, 32, 35, and 38 cycles, and a final extension at 72°C for 10 min. PCR products were detected by agarose gel electrophoresis, and the optimal annealing temperature and number of cycles were determined based on product size, amplification specificity, and amplification efficiency.

[0072] Experimental results: Figure 3 and Figure 4 As shown, the optimal annealing temperature is 69°C and the optimal number of cycles is 35 cycles.

[0073] (3) Under the conditions of (2), Mg 2+ The final concentration (1.25, 1.875, 2.5, 3.125 mmol / L) and Taq enzyme dosage (0.2, 0.3, 0.4, 0.5 and 0.6 μL) were optimized.

[0074] Experimental results: Figure 5 and Figure 6 As shown, it is shown that in the best system: Mg 2+ The optimal final concentration of is 2.5mmol / L, and the optimal dosage of Taq enzyme is 0.4μL.

[0075] (4) Under the conditions of (2) and (3), based on the low amplification efficiency caused by primer mismatch in multiplex PCR and ARMS, the final concentrations of the inner and outer primers were adjusted according to the brightness and specificity of the corresponding PCR product bands (23-PF1 was set to 0.25 / 0.25 / 0.25 / 0.2μmol / L, 23-IFA4 was set to 0.25 / 0.25 / 0.25 / 0.2μmol / L, 23-AR2 was set to 0.25 / 0.2 / 0.15 / 0.15μmol / L, and 23-PR3 was set to 0.25 / 0.3 / 0.35 / 0.4μmol / L). The corresponding concentration combinations were optimized one by one. All optimization results were based on the specificity of the 1.5w% agarose gel electrophoresis test results and the amount of PCR product amplification to screen the best primer concentration combination.

[0076] Experimental results: Figure 7 As shown, the optimal final concentration combinations of the upstream outer primer 23-PF1, the upstream inner primer 23-IFA4, the downstream inner primer 23-AR2 and the downstream outer primer 23-PR3 in the multiplex PCR amplification reaction system are 0.2 μmol / L, 0.2 μmol / L, 0.15 μmol / L and 0.4 μmol / L, respectively.

[0077] (5) Using the cattle product genomic DNA extracted in step (1) as a template, PCR amplification was performed using the primer set in Table 1 to obtain an amplified product.

[0078] The PCR amplification reaction system, calculated as 20 μL, includes the following components: 10× buffer 2.0 μL, dNTP mixture (25 mmol / L) 1.6 μL, MgCl2 (25 mmol / L) 2.0 μL, 10 μmol / L upstream outer primer 23-PF1 0.4 μL, 10 μmol / L upstream inner primer 23-IFA4 0.4 μL, 10 μmol / L downstream inner primer 23-AR2 0.3 μL, 10 μmol / L downstream outer primer 23-PR3 0.8 μL, Taq polymerase (5 U / μL, product of Thermo Fisher Scientific) 0.4 μL, template DNA 3.0 μL, and ddH2O 9.1 μL.

[0079] The PCR amplification program was as follows: pre-denaturation at 95° C. for 8 min; denaturation at 94° C. for 35 s, annealing at 69° C. for 40 s, extension at 72° C. for 40 s, denaturation, annealing, and extension for 35 cycles; and final extension at 72° C. for 10 min.

[0080] (6) The amplified product obtained in step (5) is subjected to agarose gel electrophoresis detection, wherein the initial concentration of agarose during the agarose gel electrophoresis detection is 1.5 wt %, and the agarose gel also contains 0.1% by weight of the nucleic acid dye Gelred.

[0081] (7) When the amplified product has only two electrophoretic bands of 422 bp and 259 bp, it is judged as a deletion homozygous type (- / -); when the amplified product has only two electrophoretic bands of 445 bp and 193 bp, it is judged as an insertion homozygous type (+ / +); when the amplified product has only three electrophoretic bands of 445 bp, 259 bp and 193 bp, it is judged as an insertion-deletion heterozygous type (+ / -).

[0082] The above primer set and the optimized optimal reaction conditions were used to detect the 23bp insertion / deletion polymorphism site in the PRNP promoter region of cattle. The genotyping results are as follows: Figure 8 shown.

[0083] Example 4 ARMS-PCR detection of commercially available samples

[0084] A total of 24 samples of fresh milk, beef, milk powder, and cheese of different dates and batches were purchased from supermarkets and online platforms. The 24 commercially available cattle products were tested and identified using the optimized method for identifying the 23bp insertion / deletion polymorphism site in the bovine PRNP promoter region, as described in Example 3 of the present invention, combined with Sanger sequencing. Sanger sequencing identification was performed with reference to the literature (Imran M, Mahmood S, Babar ME, et al. PRNP gene variation in Pakistani cattle and buffaloes [J]. Gene, 2012, 505(1): 180-185.).

[0085] The main steps of the identification process of commercially available samples using the present invention are as follows:

[0086] (1) The genomic DNA of beef to be tested was extracted using an animal tissue DNA extraction kit (purchased from Hangzhou Xinjing Biotechnology Co., Ltd.); the DNA of dairy products was extracted from fresh milk powder and other samples according to the instructions of the TaKaRaMiniBEST Universal Genomic DNA extraction kit (Bao Ri Yi Biotechnology (Beijing) Co., Ltd.).

[0087] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the primer set in Table 1 to obtain an amplified product.

[0088] (3) The amplified product obtained in step (2) is subjected to agarose gel electrophoresis detection, wherein the initial concentration of agarose during the agarose gel electrophoresis detection is 1.5 wt %, and the agarose gel also contains 0.1% by weight of the nucleic acid dye Gelred.

[0089] (4) When the amplified product has only two electrophoretic bands of 422 bp and 259 bp, it is judged as a deletion homozygous type (- / -); when the amplified product has only two electrophoretic bands of 445 bp and 193 bp, it is judged as an insertion homozygous type (+ / +); when the amplified product has only three electrophoretic bands of 445 bp, 259 bp and 193 bp, it is judged as an insertion-deletion heterozygous type (+ / -).

[0090] Experimental results: As shown in Table 2 and Figure 9 The results show that the present invention can identify polymorphisms by detecting the 23bp site of PRNP in cattle products. It has the advantages of being simple and convenient and meeting the instrument platform requirements of most testing units. It is an important supplement for the screening and prevention of high-risk groups for BSE and provides certain technical support for the identification of the 23bp site polymorphism of cattle PRNP, which is of great significance.

[0091] Table 2 Identification results

[0092]

[0093]

[0094] From the above embodiments and experimental examples, it can be seen that the primer set and identification method of the present invention can specifically detect the 23bp insertion / deletion polymorphism in the PRNP promoter region of cattle products, providing a scientific basis for genotype identification of cattle products and susceptibility risk assessment of BSE.

[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer set for identifying a 23 bp insertion / deletion polymorphism site in the promoter region of the bovine prion protein gene, characterized in that: The primer set includes an upstream outer primer 23-PF1, an upstream inner primer 23-IFA4, a downstream inner primer 23-AR2 and a downstream outer primer 23-PR3; The nucleotide sequence of the upstream external primer 23-PF1 is shown in SEQ ID NO: 1; The nucleotide sequence of the upstream inner primer 23-IFA4 is shown in SEQ ID NO: 2; The nucleotide sequence of the downstream inner primer 23-AR2 is shown in SEQ ID NO: 3; The nucleotide sequence of the downstream outer primer 23-PR3 is shown in SEQ ID NO:

4.

2. A reagent or kit for identifying a 23 bp insertion / deletion polymorphism site in the promoter region of a bovine prion protein gene, characterized in that: Comprising the primer set according to claim 1.

3. The reagent or kit according to claim 2, characterized in that Also includes Taq enzyme, PCR buffer, dNTP mixture, Mg 2+ and ddH2O.

4. The reagent or kit according to claim 3, characterized in that The Mg 2+ The addition methods include MgCl2 or MgSO4.

5. A method for identifying a 23 bp insertion / deletion polymorphism site in the promoter region of a bovine prion gene using the primer set of claim 1 or the reagent or kit of any one of claims 2 to 4, characterized in that: The following steps are involved: 1) Extracting genomic DNA from the sample to be tested; 2) using the genomic DNA extracted in step 1) as a template, performing multiplex PCR amplification using the primer set of claim 1 or the reagent or kit of any one of claims 2 to 4 to obtain an amplified product; 3) performing electrophoresis detection on the amplified product obtained in step 2); 4) When the amplified product has only two electrophoretic bands of 422 bp and 259 bp, it is determined to be a homozygous deletion type; when the amplified product has only two electrophoretic bands of 445 bp and 193 bp, it is determined to be a homozygous insertion type; When the amplified product has only three electrophoretic bands of 445 bp, 259 bp and 193 bp, it is determined to be an insertion-deletion heterozygous type.

6. The method according to claim 5, characterized in that Step 2) The final concentrations of the upstream outer primer 23-PF1, the upstream inner primer 23-IFA4, the downstream inner primer 23-AR2, and the downstream outer primer 23-PR3 in the multiplex PCR amplification reaction system are 0.2 μmol / L, 0.2 μmol / L, 0.15 μmol / L, and 0.4 μmol / L, respectively; 2+ The final concentration was 2.5 mmol / L.

7. The method according to claim 5, characterized in that Step 2) The multiplex PCR amplification reaction system, based on 20 μL, includes the following components: 10× buffer 2.0 μL, 25 mmol / L dNTP 1.6 μL, 25 mmol / L Mg 2+ 2.0μL, 10μmol / L upstream outer primer 23-PF10.4μL, 10μmol / L upstream inner primer 23-IFA40.4μL, 10μmol / L downstream inner primer 23-AR20.3μL, 10μmol / L downstream outer primer 23-PR30.8μL, 5U / μL Taq enzyme 0.4μL, template DNA 3.0μL, ddH2O 9.1μL.

8. The method according to claim 5, characterized in that Step 2) The multiplex PCR amplification procedure is as follows: pre-denaturation at 95°C for 5-10 min; denaturation at 94°C for 30-50 s, annealing at 66-69°C for 35-60 s, extension at 72°C for 30-60 s, denaturation, annealing, and extension for 30-38 cycles; and final extension at 72°C for 5-12 min.

9. The method according to claim 5, characterized in that In step 1), the samples to be tested include blood, hair, embryonic cells, beef, milk, milk powder and cheese.

10. The method according to claim 5, characterized in that The resistance of the sample to be tested to mad cow disease is that the insertion homozygous type has a higher disease resistance than the insertion-deletion heterozygous type, and the insertion-deletion heterozygous type has a higher disease resistance than the deletion homozygous type.