Tomato DOF transcription factor gene and application thereof

Abstract

The invention discloses a tomato DOF transcription factor gene SlDOF 3.4. The nucleotide sequence of the tomato DOF transcription factor gene SlDOF 3.4 is as shown in SEQ ID NO: 1; the gene is applied to improvement of the drought tolerance of tomatoes, experimental results show that the SlDOF3.4 gene is over-expressed in transgenic tomatoes, the root length, the plant height and the fresh weight of the transgenic tomatoes are increased compared with those of wild tomatoes under the drought condition, the growth of the transgenic tomatoes is obviously superior to that of the wild tomatoes, the expression quantities of antioxidant enzyme genes SlSOD, SlPOD, SlCAT and SlAPX are remarkably increased, and the drought tolerance of the tomatoes is improved. Results show that the SlDOF3.4 transgenic tomato has drought tolerance, a new germplasm resource is provided for cultivating a new variety of drought-tolerant tomato, good potential application value is achieved, and a certain theoretical basis is laid for researching a tomato drought stress response molecular mechanism and improving plant stress resistance.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a tomato DOF transcription factor gene SlDOF 3.4 and its application in improving drought tolerance of tomatoes. Background Art

[0002] In recent years, increasing atmospheric carbon dioxide concentrations have exacerbated global climate change, leading to widespread drought in many regions and severely limiting crop growth and yield. Statistics show that global wetland area is decreasing, while drought-sensitive areas are increasing. Drought is one of the most harmful abiotic stressors that limit plant growth, development, and productivity, significantly impacting ecosystem health and sustainable agricultural development. Drought stress not only causes water shortages in plants, thereby affecting their water and nutrient absorption, but also affects their morphological structure and physiological processes. In particular, drought stress induces the production of reactive oxygen species (ROS) in plants, leading to oxidative damage in biofilms. Furthermore, drought stress primarily affects plant antioxidant systems by affecting the activities of enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT).

[0003] The DOF (DNA binding with One Finger) family is a type of TF family unique to plants. In recent years, a large number of studies have found that DOFs also play an important role in regulating plant life processes such as leaf growth, seed and root development, flowering, growth regulation under adverse conditions, and reproductive period. DOF is a transcription factor with a single zinc finger structure. Its uniqueness is reflected in the fact that it is unique to plants, the DNA domain is highly conserved, and the zinc finger characteristics it possesses are also called DOF domains. The key to the activity of DOF protein is the four Cys residues and one Zn 2+ Binding. The DOF domain can specifically recognize the -AAAG- sequence on the downstream gene promoter sequence. The variable transcriptional regulatory domain is located at the C-terminus, which gives the DOF protein a variety of functions. DOF transcription factors are involved in a large number of regulatory pathways and play a vital role in plant growth and development, physiological metabolism, etc. However, the DOF transcription factor gene SlDOF 3.4 The function of this compound in drought stress has not been reported. Summary of the Invention

[0004] The present invention provides a DOF transcription factor gene SlDOF 3.4, which is derived from tomatoes ( Solanum lycopersicum L. Ailsa Craig), the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0005] Another object of the present invention is to transform the tomato DOF transcription factor geneSlDOF 3.4 Application in improving drought tolerance of tomatoes.

[0006] The present invention adopts the following technical solutions to achieve the purpose of the present invention: 1. Construction of plant expression vector (1) RNAiso Plus (Takara) reagent was used to extract tomato total RNA and reverse transcribed to obtain tomato cDNA; tomato was searched in NCBI. SlDOF 3.4 cDNA sequence of the gene, and design of gene-specific primers containing vector homology arms using DNAman software; Upstream primer 5′-TACGAACGATACTCGACCCCATGACTTTGGAATCAAGTG; Downstream primer 3′-CTAGAGTCGACGGATCCCCCATTAAAATAATCTCCACTTC; Using tomato cDNA as template, PCR amplification was performed to obtain SlDOF 3.4 Full-length DNA of the gene (612 bp); (2) Recovery and purification SlDOF The full-length DNA fragment of 3.4 gene was connected to the pCAMBI1300 vector by homologous recombination and transformed into Escherichia coli DH5a. The plasmid DNA was extracted and the correct recombinant plasmid pCAMBI1300-GFP- SlDOF 3.4; 2. Tomato Transformation The recombinant plasmid pCAMBI1300-GFP- SlDOF 3.4 Introduce into Agrobacterium competent cells LBA4404, spread on rifampicin (Rif) and kanamycin (Kan) plates and grow for two days, pick single colonies and use colony PCR to detect whether the plasmid has been transformed into Agrobacterium; PCR amplification is used SlDOF 3.4 upstream and downstream primers, the theoretical length of the amplified fragment is 612bp, and the PCR product is consistent with the theoretical value by electrophoresis detection, indicating that the plasmid has been transferred into Agrobacterium; at the same time, prepare tomato ( Solanum lycopersicum L. Ailsa Craig) sterile seedlings, tomato tissues were transformed by Agrobacterium-mediated method, and then redifferentiated callus was obtained by tissue culture, which was transferred to MS medium (containing 3% sucrose) containing kanamycin and continued to be cultured to obtain sterile transgenic tomato plants; 3. Detection of genetically modified tomatoes (1) To detect target genes SlDOF3.4 Whether to insert into the tomato genome, the whole genome DNA of the transgenic tomato seedlings differentiated by tissue culture was used as a template, and the cloned DNA was cloned with 35S-F: GACGCACAATCCCACTATCC. SlDOF PCR detection was performed using primers 3.4-R: CTAGAGTCGACGGATCCCCCATTAAAATAATCTCCACTTC. The theoretical length of the PCR amplified product was 612 bp. Electrophoresis detection of the PCR product showed that it was consistent with the theoretical value, indicating that the target gene SlDOF 3.4 has been inserted into the tomato genome; (2) To detect target genes SlDOF 3.4 Whether the transgenic tomato is transcribed normally, RNA was extracted from different transgenic tomato lines, and the gene transcription level was detected by real-time fluorescence quantitative PCR. SlDOF 3.4 The gene expression level was significantly higher than that of wild-type tomatoes, indicating SlDOF 3.4 The gene is transcribed normally in transgenic tomatoes; 4. SlDOF 3.4 Drought tolerance testing of transgenic tomato seeds during germination Wild-type tomato (WT) seeds and SlDOF 3.4 After germinating seeds from different transgenic tomato lines on filter paper, seeds with consistent whitening length were selected and placed in a tomato nutrient solution (control) and a tomato nutrient solution containing 5% PEG (polyethylene glycol) (experimental) for a short period of approximately four days. Phenotypic observations were made. The results showed that compared to wild-type tomatoes, the transgenic tomatoes treated with the 5% PEG solution showed significantly enhanced physiological indicators such as root length, fresh weight, and plant height. 5. SlDOF 3.4 Drought tolerance testing of transgenic tomatoes at the seedling stage Wild-type tomato (WT) and SlDOF 3.4 Transgenic tomato seeds of different strains were germinated on filter paper. The germinated WT and overexpressing tomato seeds were then planted in sterile soil. When they grew to approximately three true leaves, the control group was irrigated with conventional water, while the experimental group was not irrigated. The seeds were observed continuously until they wilted, and their phenotypes were observed. The results showed that, under simulated drought conditions, the transgenic tomatoes exhibited significantly enhanced physiological indicators such as root length, fresh weight, and plant height compared to wild-type tomatoes. 6. Effects of drought stress on SlDOF 3.4 Effects of oxidative damage on transgenic tomatoes Under drought stress SlDOF 3.4 Transgenic tomato and WT tomato seedlings were sampled, RNA was extracted and reverse transcribed into cDNA, and antioxidant enzyme genes were quantitatively analyzed by real-time fluorescence quantitative method. The results showed that under drought stress, SlDOF3.4 Genetically modified tomatoes SlSOD 、 SlPOD 、 SlCAT 、 SlAPX The expression level was significantly higher than that of WT.

[0007] The present invention provides a new method for improving plant drought tolerance. The present invention cultivates transgenic overexpression by genetic engineering means. SlDOF 3.4 Tomatoes: Under drought conditions, the root length, plant height, and fresh weight of transgenic tomatoes increased compared to wild-type tomatoes, and their growth was significantly better than that of wild-type tomatoes. SlSOD, SlPOD, SlCAT, SlAPX The expression level of SlDOF 3.4 Transgenic tomatoes have drought tolerance. The present invention provides new germplasm resources for breeding new drought-resistant tomato varieties, has good potential application value, and lays a certain theoretical foundation for studying the molecular mechanism of tomato drought stress response and improving plant resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 For plant overexpression vector pCAMBI1300-GFP- SlDOF3.4 Construction and transformation verification diagram: Figure A is a tomato SlDOF 3.4 Gene cloning; Figure B is pCAMBI1300-GFP- SlNLP4 Verification of recombinant plasmid transformation into Escherichia coli DH5α bacterial solution; Figure 2 The test results of genetically modified tomatoes are shown in Figure A. SlDOF PCR detection results of 3.4 genes in the transgenic tomato genome; Figure B is SlDOF 3.4 Detection results of gene transcription levels in transgenic tomatoes and wild-type tomatoes (WT); in the figure, M is DNA marker, OE5, OE6, and OE7 are transgenic tomatoes, and P is pCAMBI1300-GFP- SlDOF 3.4 Recombinant plasmids, WT is wild-type tomato; Figure 3 Under drought stress SlDOF 3.4 Phenotypes of transgenic and wild-type tomato seeds during germination. Scale bar is 2 cm. CK represents normal culture medium, and PEG represents drought culture medium. Figure 4 Under drought stress SlDOF 3.4 Results of physiological index measurements of transgenic and wild-type tomato seeds during germination, where Figure A shows root length, Figure B shows fresh weight, and Figure C shows plant height. Figure 5 Under drought stress SlDOF 3.4 Phenotypes of transgenic and wild-type tomatoes at the seedling stage; Figure 6 Under drought stress SlDOF 3.4 Changes in the expression of antioxidant-related genes in transgenic and wild-type tomatoes; Figure A shows SlSOD Gene, Figure B is SlPOD Gene, Figure C SlCAT Gene, D Figure SlAPX Gene. DETAILED DESCRIPTION

[0009] The present invention is further described in detail below through the accompanying drawings and examples, but the scope of protection of the present invention is not limited to the contents described above. The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0010] The reagents used in this practice mainly include molecular biology experimental reagents, culture media required for plant genetic transformation, and various reagents required for transgenic plant identification and detection; various restriction endonucleases, Taq DNA polymerase, reverse transcriptase, RNase inhibitors, dNTPs, plasmid extraction kits, RNA extraction kits, etc. are products of Bao Bioengineering Co., Ltd. (Dalian); the remaining reagents are all domestically produced analytical grade; the instruments are all commonly used instruments in molecular biology and genetic engineering laboratories; all primer sequences are synthesized at Shanghai Jierui Biological Co., Ltd.

[0011] Example 1: DOF transcription factor gene SlDOF 3.4 Acquisition 1. Search for tomato from NCBI SlDOF 3.4 cDNA sequence of the gene, and design of gene-specific primers containing vector homology arms using DNAman software; Upstream primer 5′-TACGAACGATACTCGACCCCATGACTTTGGAATCAAGTG; Downstream primer 3′-CTAGAGTCGACGGATCCCCCATTAAAATAATCTCCACTTC; Total RNA was extracted from tomato seedlings using TRIzoL Reagent (Takara). Approximately 0.1 g of tender tomato roots were added to 1 mL of TRIzoL extract and ground in a mortar. After standing at room temperature for 5 min, the tube was transferred to a centrifuge tube. 0.2 mL of chloroform was added and the tube was shaken to mix. The tube was centrifuged at 12,000 rpm for 15 min. The supernatant was transferred to a new tube, 0.5 mL of isopropanol was added, the tube was mixed and allowed to stand at room temperature for 10 min, and the tube was centrifuged at 12,000 rpm at 4°C for 10 min. The supernatant was discarded and the precipitate was washed with 1 mL of 75% ethanol and centrifuged at 7,500 rpm at 4°C for 5 min. The ethanol was discarded and the precipitate was dried under vacuum or allowed to air dry. The RNA was dissolved in 20 μL of diethyl pyrocarbonate (DEPC)-treated water. cDNA synthesis was performed using the M-MuLV Reverse Transcriptase Kit (TaKaRa). Approximately 0.1-5 μg of total plant RNA, 50 ng of oligo(dT), and 1 μL of 10 mM dNTP mix were taken and made up to 10 μL with DEPC-treated water. After mixing, the mixture was briefly centrifuged to collect the residue at the bottom of the tube. The tube was heated at 65°C for 5 min and then ice-bathed for 10 min. 9 μL of the reaction mixture (4 μL of 5× reaction buffer, 4 μL of 25 mM MgCl2, 2 μL of 0.1 M DTT, and 1 μL of RNase inhibitor) was added. The mixture was mixed and briefly centrifuged to collect the residue at the bottom of the tube. The tube was incubated at 25°C for 2 min. 1 μL of M-MuLV Reverse Transcriptase was added and the mixture was mixed and briefly centrifuged to collect the residue at the bottom of the tube. The tube was incubated at 25°C for 20 min and then at 42°C for 70 min to synthesize cDNA.

[0012] Using cDNA as template, SlDOF PCR was performed using primers specific for the upstream and downstream of the 3.4 gene cDNA. The PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 2 min 40 s, 30 cycles; 72°C for 10 min, 12°C infinity. The reaction system (20 μL) consisted of 0.5 μL cDNA, 10 μL 2× Long Taq Buffer, 0.5 μL dNTPs (10 mM each), 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 0.5 μL ex Taq DNA polymerase (2 U / μL), and 7.5 μL ddH2O. After the PCR was completed, 10 μL was used for agarose gel electrophoresis to obtain the product. SlDOF3.4 The full-length cDNA is 612 bp ( Figure 1 A); Example 2: Plant expression vector pCAMBI1300-GFP- SlDOF Build 3.4 The DH5α bacterial solution containing the pCAMBIAI1300-GFP plasmid was propagated, and the plasmid was extracted using the full-strength gold plasmid extraction kit and then digested with enzymes. The enzyme digestion system was 50 μL. After the plasmid was quantified, 200-400 ng was added. The general system was: 20 μL of GFP plasmid, Sma Ⅰ enzyme 1μL, buffer 5μL, ddH2O 24μL, 37℃ 3 hours; prepare agarose gel electrophoresis, cut the gel after running and perform gel recovery, gel recovery uses the full gold gel recovery kit method.

[0013] The recovered vector and target fragment were ligated using homologous recombination. First, the recovered vector and target fragment were quantified using a quantification system consisting of 10 μL, 1 μL of recovered product, 1 μL of 10× buffer, and 8 μL of ddH₂O. Two Maker systems (Qingke Bio) were used to run the gel. A 5 μL gel was run and compared with the brightest band in the 5 μL Maker system. The brightest band was 150 ng, while the brightest band was 50 ng. The vector amount (X) (ng) = target fragment × 0.02, and the vector amount (Y) (ng) = vector size × 0.04. The ligation system is 10 μL, 2 μL of target fragment, 2 μL of vector, 1 μL of C112 enzyme (ligase), 2 μL of C112 buffer, ddH2O is added to 10 μL, 37°C for 30 minutes, then cooled on ice and 33 μL of DH5α is added, ice transformation is carried out for 30 minutes, heat shock is carried out at 42°C for 45 seconds, and after cooling on ice, antibiotic-free LB is added and shaken at 37°C and 200 rpm for 1-2 hours; centrifuge at 1000 rpm for 5 minutes, pour the supernatant, and resuspend the remaining 100 μL of supernatant in the bacterial suspension and apply it to a Kan (50mM) plate. After overnight, single colonies are picked and shaken with antibiotic-free culture medium for PCR identification ( Figure 1 B) After success, shake the bacteria with Kan-resistant LB, store the bacteria in 50% glycerol at -20℃, and extract the recombinant plasmid to obtain pCAMBI1300-GFP- SlDOF 3.4 Recombinant plasmid.

[0014] Example 3: pCAMBI1300-GFP- SlDOF 3.4 Transformation of Agrobacterium with Plant Expression Vectors pCAMBI1300-GFP- SlDOF3.4 The plasmid was transferred into Agrobacterium LBA4404 using the liquid nitrogen freeze-thaw method. The competent Agrobacterium LBA4404 was obtained from Qingke Biotechnology Co., Ltd. The competent Agrobacterium was thawed on ice, 3 μL of plasmid was added to a sterile operating table, and the transformation was carried out on ice for 30 minutes. The plasmid was quickly frozen in liquid nitrogen for 5 minutes, placed in a 37°C water bath for 5 minutes, and cooled on ice. Antibiotic-free YEP was added and the tube was shaken at 28°C and 200 rpm for 3 hours. Centrifuged at 10,000 rpm for 5 minutes, and the supernatant was poured out. The remaining 50-100 μL of supernatant was used to resuspend the bacterial pellet and apply it to Kan (50mM) + Rif (100mM) plates. After growing for 2-3 days, a single colony was picked and shaken with antibiotic-free culture medium. After successful PCR identification, the bacteria were propagated by shaking with culture medium containing resistance and maintained with 50% glycerol.

[0015] Example 4: Using SlDOF 3.4 Agrobacterium-mediated transformation of tomato with plant expression vectors Agrobacterium culture: Pick a single colony of Agrobacterium overexpressing the vector plasmid and place it in 5 mL of liquid culture medium with resistance and selection factors (100 mM Rif and 50 mM Kan), and culture it in a shaker at 28°C for 36 hours. Pipette 200 µL of activated bacterial solution and apply it to the YEP resistance plate, and culture it in a constant temperature box at 28°C for 36 hours. After the colonies have covered the plate, operate in a clean bench. Use 10 mL of MS liquid culture medium containing 40 mM acetosyringone to suspend the bacteria on the plate; after centrifugation, dilute and take an appropriate amount of bacteria in MS (40 mM acetosyringone) liquid culture medium, shake it in a constant temperature box at 28°C and 200 rpm for 1-2 hours, and then dilute the bacterial solution to OD 600 The value is about 0.5, which is used for tomato transformation experiments.

[0016] Explant preparation: Soak the seeds in sterile water for 3-6 hours to accelerate germination. Work on a sterile operating table. First, discard the water used to soak the seeds. Disinfect with 75% alcohol for 1 minute, rinse three times with sterile water, then disinfect with 60% sodium hypochlorite for 6 minutes, rinse three times with sterile water, and soak in sterile water for 20 minutes. After disinfection, sow the seeds on the surface of MS solid culture medium with distinct particles. Culture in a tissue culture room at a constant temperature of 25°C for 1-2 days, then culture under a 16-day light / 8-day dark cycle until two cotyledons grow. Cut the cotyledons, split one cotyledon in half, and place them in a co-culture medium for pre-culture.

[0017] Explant transformation and culture: In a sterile operating table, carefully pick up the cut tomato cotyledons with tweezers and place them in Agrobacterium for 10 minutes, shaking slightly during the process. Then gently remove them, dry the Agrobacterium liquid with filter paper, and place them in the co-culture medium for dark culture for 3 days. After 2 days of dark culture, transfer the tomato leaves to differentiation medium for differentiation, changing the medium every 20 days. When the plantlets have grown fully, have a clear plant center, and grow to 3-5 cm, cut them with a blade and insert them into the rooting medium to allow them to root. When the roots are fully developed and grow to the top of the bottle, slightly open the lid and acclimate them to the external environment for 3-4 days before transplanting them into the soil of the flowerpot. After transplanting them into the flowerpot, grow them in the tissue culture room for 2-3 weeks before moving them to the greenhouse.

[0018] Example 5: SlDOF 3.4 Detection of gene insertion and expression levels in transgenic tomatoes The transgenic tomatoes screened were further identified using PCR to confirm that the transgenic tomato lines selected by kanamycin did contain the introduced target gene DNA fragments. First, the plant genome was extracted using the CTAB method: about 0.2 g of plant leaves were weighed and placed in a 1.5 mL centrifuge tube, and ground into powder using a special pestle with liquid nitrogen. 1 mL of 2× CTAB buffer (Tris-HCl pH 7.5 100 mM, EDTA 20 mM, NaCl 1.4 M, CTAB 2%) was added, and the tube was heated in a 65°C water bath for 20 min, then removed and cooled. 500 μL of a chloroform-isoamyl alcohol mixture (24:1) was added and shaken, and the tube was centrifuged at 4°C and 7500 rpm for 10 min, and the supernatant was transferred to a 1.5 mL EP tube. 500 μL of a chloroform-isoamyl alcohol mixture (24:1) was added again and shaken, and the tube was centrifuged at 4°C and 7500 rpm for 10 min. The supernatant was removed and placed in a new EP tube, and 1 / 10 volume of 3M Sodium acetate at pH 5.2 and an equal volume of isopropanol were added, shaken, and centrifuged at 4°C and 12,000 rpm for 20 min. The supernatant was discarded, washed twice with 75% ethanol, dried, and RNA was dissolved and degraded with TE buffer containing RNase to obtain a genomic DNA sample. The whole genomic DNA of the transgenic tomato seedlings redifferentiated from tissue culture was used as a template, and the genomic DNA was obtained with the 35S-F: GACGCACAATCCCACTATCC, SlDOF 3.4-R: CTAGAGTCGACGGATCCCCCATTAAAATAATCTCCACTTC was used as the primer, and three strains were identified. SlDOF 3.4 Overexpression plants (OE5, OE6, OE7), WT negative control has no bands, SlDOF 3.4 The position of plant PCR bands is consistent with that of plasmid PCR ( Figure 2 A), indicating the target gene SlDOF 3.4 has been inserted into the tomato genome.

[0019] To detect target genes SlDOF 3.4 To determine whether transcription is normal in transgenic tomatoes, total RNA isolated with Trizol reagent (Invitrogen) was used for reverse transcription according to the kit instructions, and RT-qPCR was performed using the TaKaRa SYBR Premix Ex Taq II Kit. SlActin was used as a reference gene to normalize expression values. All experiments were repeated three times, and three independent biological experiments were performed. Melting curves were generated to estimate the specificity of these reactions, and the results were analyzed using the delta-delta threshold cycle method. SlDOF3.4 The gene expression level was significantly increased compared with the wild-type tomato ( Figure 2 B) Description SlDOF 3.4 The gene is transcribed normally in transgenic tomatoes.

[0020] Example 6: Drought stress resistance detection of transgenic tomato seeds during germination T2 generation seeds of transgenic tomatoes OE5, OE6, and OE7 and wild-type tomato (WT) seeds were selected, and the seeds were soaked in warm water at about 50°C for 30 minutes. The seeds were placed in a culture dish covered with filter paper, wrapped in a black plastic bag, and placed in a 25°C incubator for germination. After about 2-3 days, WT and transgenic tomato seeds with the same whitening length were picked and evenly arranged in culture dishes containing tomato nutrient solution (CK) (1L hydroponic tomato nutrient solution formula: 590 mg calcium nitrate tetrahydrate, 404 mg potassium nitrate, 136 mg potassium dihydrogen phosphate, 246 mg magnesium sulfate heptahydrate, 27.8 mg ferrous sulfate, 37.2 mg EDTA, 28.6 mg boric acid, 21.3 mg manganese sulfate tetrahydrate, 2.2 mg zinc sulfate heptahydrate, 0.8 mg copper sulfate pentahydrate, and 0.2 mg ammonium molybdate) and drought tomato nutrient solution (tomato nutrient solution containing 5% PEG), and placed in a tissue culture room at 25°C for 16 h of light and 8 h of darkness. h for cultivation. After about 4-5 days, when the cotyledons were fully expanded and the true leaves began to grow, the growth conditions of the control group and the experimental group were photographed and observed, and physiological indicators such as root length, plant height, and fresh weight were measured. Figure 3 、 4 The results showed that the root length, plant height and fresh weight of transgenic tomatoes cultured in tomato nutrient solution (CK) had no significant difference compared with wild-type tomatoes, but the root length, plant height and fresh weight of transgenic tomatoes cultured in tomato nutrient solution containing 5% PEG were increased compared with wild-type tomatoes. SlDOF 3.4 Tomatoes have a higher drought tolerance than wild-type tomatoes.

[0021] Example 7: Drought stress resistance detection in transgenic tomato seedlings WT seeds and transgenic SlDOF 3.4 Tomato seeds of OE5, OE6, and OE7 were germinated and whitened on filter paper. WT and transgenic tomato seedlings of uniform size were selected and planted in sterile soil pots. Four-week-old WT and OE seedlings were placed under simulated natural drought stress. The control group (CK) was irrigated with conventional water, while the experimental groups were not irrigated until wilting of the experimental plants was observed. The growth status of the control and experimental groups was photographed and observed, and fresh samples were collected and preserved for subsequent parameter measurement.

[0022] Figure 5 The results showed that there was no overall difference between the transgenic tomato plants and the WT plants when irrigated with conventional water, but under drought conditions, SlDOF 3.4 The growth of transgenic tomato plants was significantly better than that of WT plants.

[0023] Example 8: SlDOF3.4 Determination of the expression levels of antioxidant-related genes in transgenic tomatoes under drought conditions In Example 7, conventional water irrigation and soil culture treatment for three weeks under drought conditions SlDOF 3.4 Fresh samples of transgenic tomatoes (OE5, OE6, OE7) and wild-type tomatoes were collected, and RNA was extracted and reverse transcribed into cDNA using the method of Example 1. After the concentration was determined, the samples were diluted to the same level and the antioxidant enzyme genes were quantitatively analyzed using real-time fluorescence quantification.

[0024] See the results Figure 6 , during drought SlDOF 3.4 Transgenic tomato plants SlSOD, SlPOD, SlCAT, SlAPX The expression of SlDOF34. Genetically modified tomatoes SlSOD, SlPOD, SlCAT, SlAPX There was no significant difference between the expression level of WT and that of SlDOF 3.4 Compared with WT, the antioxidant capacity of transgenic tomatoes under drought conditions was improved.

Claims

1. A tomato DOF transcription factor gene SlDOF 3.4, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. The tomato DOF transcription factor gene according to claim 1 SlDOF 3.4 Application in improving drought tolerance of tomatoes.

Images