Method for efficient heterologous expression of D-psicose 3-epimerase in aspergillus niger

Abstract

The invention discloses a method for efficient heterologous expression of D-psicose 3-epimerase in aspergillus niger, and belongs to the technical field of bioengineering. The invention discloses a method for efficient heterologous expression of D-psicose 3-epimerase in Aspergillus niger, which comprises the following steps: firstly, constructing a recombinant plasmid containing a DPE gene, introducing the recombinant plasmid into an Aspergillus niger host strain to obtain a constitutive recombinant strain, and then carrying out ultraviolet mutagenesis screening to realize massive secretion of DPE enzyme and greatly improve the enzyme activity at the same time. The highest DPE enzyme activity of the strain obtained by screening reaches 176.94 U / mL. The method disclosed by the invention lays a foundation for further improving the industrial production of psicose.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and more particularly to a method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger. Background Art

[0002] D-psicose 3-epimerase (DPE, EC 5.3.1.3) is a typical ketohexose 3-epimerase that catalyzes the epimerization of D-fructose at the C-3 position to produce D-psicose. To date, among the DPEs with well-defined properties and functions, except for Dorea sp. CAG317 DPE, which has an optimal pH of weakly acidic, C. bolteae ATCC BAA613 DPE, and Flavonifractor plautii DPE, which have neutral pH, the rest are weakly alkalophilic enzymes. Metal ions can stabilize the conformation of DPE, and the optimal ion is usually Mn. 2+ or Co 2+ ; Most enzymes have good thermal stability below 50℃.

[0003] Aspergillus niger is the main strain for making sauce, wine and vinegar. It is the production of enzyme preparations (protease, amylase, pectinase), producing organic acids (such as citric acid, gluconic acid), and is used as the strain for producing saccharified feed in agriculture. Aspergillus niger can be used to measure trace elements such as manganese, copper, molybdenum, zinc and as a mold and rot test bacterium. Aspergillus niger has very strong exogenous gene expression ability and efficient protein expression, secretion and modification ability, and the recombinant has very high genetic stability. In addition, Aspergillus niger can also be used as the production host of heterologous proteins, because it has advantages such as high yield, high secretion, high safety and is widely used in the fermentation industry.

[0004] Therefore, providing a method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger. Aspergillus niger is used as a production strain to construct a recombinant strain capable of heterologously expressing DPE; obtaining a stable Aspergillus niger strain with high enzyme activity not only improves production conversion efficiency but also helps save industrial production costs.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger, comprising the following steps:

[0008] (1) Construction of recombinant vector pAN7-1-DPE

[0009] ① Using the pAN7-1 plasmid as a template and DPE-zai-f / r as primers, PCR amplification was performed to obtain the pAN7-1 vector backbone;

[0010] ② Using the synthesized DPE gene as a template and DPE-f / r as primers, PCR amplification was performed to obtain the DPE gene fragment;

[0011] ③ The vector backbone obtained in step ① and the gene fragment obtained in step ② were cloned and connected in one step to obtain the recombinant vector pAN7-1-DPE;

[0012] (2) Construction of linearized vector pAN7-1-DPE

[0013] The recombinant vector pAN7-1-DPE was linearized by PCR using primers line-pla-f / r to obtain the linearized vector pAN7-1-DPE-line;

[0014] (3) Using Aspergillus niger FG-2 as the starting strain, the recombinant vector pAN7-1-DPE was expressed

[0015] The linearized vector pAN7-1-DPE-line was transformed into Aspergillus niger FG-2 protoplasts and selected with 250 μg / ml hygromycin to obtain the genetically engineered strain FG-2-DPE.

[0016] (4) Obtaining the highly expressed genetically engineered strain FG-2-DPE-Y

[0017] ① subjecting the genetically engineered strain FG-2-DPE obtained in step (3) to UV mutagenesis;

[0018] ② After screening with 250 μg / ml hygromycin, the high-expression genetically engineered strain FG-2-DPE-Y was obtained.

[0019] Furthermore, the DPE gene synthesized in step (1) is codon-optimized for the Aspergillus niger host based on the DPE gene derived from Bacillus subtilis, and the gene sequence is shown in SEQ ID NO.1.

[0020] Further, the sequence of primer DPE-zai-f / r is as follows:

[0021] DPE-zai-f:CGAAGTGTGAatcttcagtatattcatcttcccatccaagaacc;SEQ ID NO.2;

[0022] DPE-zai-r: ATACTTCATgggaaaagaaagagaaaagaaaagagcagctgg; SEQ ID NO.3.

[0023] Further, the sequence of primer DPE-f / r is as follows:

[0024] DPE-f: ctttcttttcccATGAAGTATGGTATCTACTACGCATATTGGGAG; SEQ ID NO.4;

[0025] DPE-r:gatgaatatactgaagatTCACACTTCGAAGACGTGCTTG; SEQ ID NO.5.

[0026] Further, the sequence of primer line-pla-f / r is as follows:

[0027] line-pla-f:gtatagctaccagtgaggaagtggactcaa;SEQ ID NO.6;

[0028] line-pla-r: gactttgatggtcgttgtaggggct; SEQ ID NO.7.

[0029] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger. The Aspergillus niger strain is modified to achieve heterologous expression of D-psicose 3-epimerase in the engineered bacteria, achieving high enzyme activity and large-scale extracellular secretion of the enzyme, providing a new production pathway for the biosynthesis of D-psicose, and will have a positive promoting effect on the industrial production of D-psicose. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0031] Figure 1 The accompanying drawings are PCR verifications of the pAN7-1 vector backbone and DPE gene fragments of the present invention; lane 1: 10000bp Maker; lane 2: pAN7-1 gene amplification product; lane 3: DPE gene amplification product; lane 4: 5000bp Maker;

[0032] Figure 2 The accompanying drawings are verification of the plasmid pAN7-1-DPE of the present invention; lane 1: 5000bp Maker; lanes 2-3: pAN7-1-DPE plasmid amplified DPE fragment; lanes 4-5: pAN7-1-DPE plasmid; lane 6: 10000bp Maker;

[0033] Figure 3 The accompanying drawings are verifications of the linearized vector pAN7-1-DPE-line of the present invention; Lane 1: 10000bp Maker; Lanes 2-3: Verifications of the linearized vector pAN7-1-DPE-line;

[0034] Figure 4 The accompanying figure shows the DPE verification of a positive single colony of the FG-2-DPE strain of the present invention; lane 1: 5000bp Maker; lanes 2-6 and lanes 8-9 are positive single colonies; lane 7 is a negative single colony.

[0035] Figure 5 The accompanying figure shows the protein electrophoresis of the supernatant of the fermentation shake flask of the present invention; M: Protein Maker; Lanes 1-5: Protein electrophoresis of the supernatant of the fermentation shake flask of the FG-2-DPE-Y strain, which are transformants FG-2-DPE-Ya to FG-2-DPE-Ye in order. DETAILED DESCRIPTION

[0036] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0037] Plasmid extraction was performed using the DiaSpin column-based plasmid DNA mini-extraction kit. Specific steps were described in the instruction manual.

[0038] Example 1 Construction of recombinant vector pAN7-1-DPE

[0039] (1) Obtaining vector backbone and gene fragments:

[0040] Using plasmid pAN7-1 as template, primers DPE-zai-f / r were used to amplify the template plasmid by PCR to obtain the vector backbone; using the synthesized DPE gene fragment (as shown in SEQ ID NO.1) as template, primers DPE-f / r were used to amplify the template fragment by PCR to obtain the gene fragment. Figure 1 .

[0041] ATGAAGTATGGTATCTACTACGCATATTGGGAGAAAGAATGGAACGGCGACTACAAGTACTATATCGATAAGATTAGCAAGCTAGGGTTTGACATTCTGGAGATCAGCTGTGGTGCCTTCTCCGACTATTATACCAAGGACCAGGAGCTGATTGACATCGGGAAATATGCCAAGGAGAAGGGAGTGACTTTAACGGCTGGGTATGGACCTCACTTCAACGAAAGTCTTTCGTCAAGTGAACCGAATACACAGAAGCAGGCCATATCGTTCTGGAAGGAAACATTGCGGAAGCTTAAGCTGATGGATATACACATTGTTGGTGGAGCGCTATACGGCTACTGGCCCGTCGATTACTCAAAACCATTTGACAAGAAACGCGATTTGGAAAATTCCATCAAGAACATGAAAATCATCTCTCAGTATGCTGAAGAATACGACATCATGATGGGAATGGAAGTTCTCAATCGGTTTGAGGGGTACATGTTGAACACCTGCGATGAGGCACTCGCCTACGTGGAGGAGGTTGGCAGCTCGAATGTGGGTGTCATGCTCGATACTTTCCATATGAACATTGAGGAAGACAATATCGCTGCCGCCATTCGTAAAGCTGGTGATAGACTCTACCATTTCCACATCGGTGAGGGAAACCGCAAAGTTCCTGGGAAGGGCATGCTGCCGTGGAATGAGATAGGACAAGCGCTGCGAGATATCAACTACCAACATGCTGCAGTGATGGAGCCCTTCGTCATGCAGGGCGGCACGGTAGGCCATGATATTAAAATCTGGAGGGATATCATTGGCAACTGCTCCGAGGTCACCCTTGACATGGACGCGCAATCTGCGCTCCACTTTGT CAAGCACGTCTT CGAAGTGTGA; SEQ ID NO.1.

[0042] The specific primer sequences are as follows:

[0043] DPE-zai-f: CGAAGTGTGAatcttcagtatattcatcttcccatccaagaacc; SEQ ID NO.2;

[0044] DPE-zai-r: ATACTTCATgggaaaagaaagagaaaagaaaagagcagctgg; SEQ ID NO.3;

[0045] DPE-f: ctttcttttcccATGAAGTATGGTATCTACTACGCATATTGGGAG; SEQ ID NO.4;

[0046] DPE-r:gatgaatatactgaagatTCACACTTCGAAGACGTGCTTG; SEQ ID NO.5.

[0047] PCR reaction system: 2× PrimeSTARMax DNA Polymerase 25 μL; Primer-F (10 μM) 2 μL; Primer-R (10 μM) 2 μL; template 1 μL; ddH2O is added to 50 μL.

[0048] PCR reaction procedure: 98°C pre-denaturation for 2 min; 34 cycles of 98°C denaturation for 20 s, 59°C annealing for 20 s, 72°C extension for 30 s / kb; 72°C extension for 5 min; 4°C incubation. Product recovery was performed after verification.

[0049] (2) Connection of vector backbone and gene fragment: Use DpnⅠ enzyme to digest the recovered vector backbone and gene fragment, and then recombinantly react the digested vector backbone pAN7-1 with the target gene fragment DPE by one-step cloning. Then, the recombinant product is transformed into E. coli DH5ɑ competent cells and coated with 1‰ Amp + LB plates were plated and cultured at 37°C overnight. Two single colonies were picked and the plasmid pAN7-1-DPE was extracted. PCR verification was performed using primers DPE-f / r. The results are shown in the figure. Figure 2 The DPE gene is 876 bp in size, the pAN7-1 vector is 6756 bp in size, and the recombinant vector pAN7-1-DPE is 7632 bp in size. PCR verification confirmed that the two single colonies were correct and were therefore preserved.

[0050] Example 2 Construction of linearized vector pAN7-1-DPE-line

[0051] Obtaining the linearized vector pAN7-1-DPE-line: Using the recombinant vector pAN7-1-DPE obtained in Example 1 as a template, PCR amplification was performed using primers line-pla-f / r. Figure 3The vector pAN7-1-DPE was 7632 bp in size and the band size was correct, so the linearized vector pAN7-1-DPE-line was obtained.

[0052] The specific primer sequences are as follows:

[0053] line-pla-f:gtatagctaccagtgaggaagtggactcaa;SEQ ID NO.6;

[0054] line-pla-r: gactttgatggtcgttgtaggggct; SEQ ID NO.7.

[0055] PCR reaction system: 2× PrimeSTAR Max DNA Polymerase 25 μL; Primer-F (10 μM) 2 μL; Primer-R (10 μM) 2 μL; template 1 μL; ddH2O is added to 50 μL.

[0056] PCR reaction procedure: 98°C pre-denaturation for 2 min; 34 cycles of 98°C denaturation for 20 s, 59°C annealing for 20 s, 72°C extension for 30 s / kb; 72°C extension for 5 min; 4°C incubation. Product recovery was performed after verification.

[0057] Example 3 Construction of genetically engineered strains of Aspergillus niger

[0058] (1) Construction of Aspergillus niger FG-2 protoplasts: CYM medium was inoculated with Aspergillus niger FG-2 spores and cultured at 35°C until a large number of mycelial balls were grown. The culture solution was filtered through eight layers of gauze to obtain mycelial balls, which were washed twice with 1M sorbitol solution and then enzymatically hydrolyzed. The enzymatic hydrolyzate composition was 1% cellulase + 1% snail enzyme + 0.1% lysozyme. According to the wet weight of the mycelial balls, 10 ml of enzymatic hydrolyzate was added to each 1 g of mycelial balls. The enzymatic hydrolysis was carried out in a shaker at 35°C and 150 rpm for 2.5 h. After the enzymatic hydrolysis was completed, the solution was filtered through four layers of gauze and centrifuged at 10,000 rpm at 10°C for 10 minutes. The precipitate was washed twice with sorbitol solution and resuspended in 1×STC solution to obtain Aspergillus niger protoplasts. The pellets were aliquoted and stored in a refrigerator at -80°C.

[0059] Cellulase, snail enzyme and lytic enzyme were purchased from SolarBio.

[0060] CYM medium: glucose 2%, peptone 0.2%, yeast extract 0.2%, magnesium sulfate heptahydrate 0.05%, dipotassium hydrogen phosphate 0.1%, potassium dihydrogen phosphate 0.046%.

[0061] Sorbitol solution: sorbitol concentration is 1 mol / L.

[0062] STC solution: sorbitol 21.68%, 1M Tris-HCl (pH 8) 1 ml, 1M CaCl2 10 ml, constant volume 100 ml.

[0063] (2) Obtaining genetically engineered strains of Aspergillus niger

[0064] The successfully verified recombinant plasmid pAN7-1-DPE-line was transformed into the Aspergillus niger host FG-2 using a chemical transformation method, and the genetically engineered strain FG-2-DPE was obtained by screening the transformants for corresponding resistance.

[0065] The specific steps are as follows:

[0066] Chemical transformation method: dilute the linearized vector pAN7-1-DPE-line to 100 ng / μl, take 10 μl, mix with 100 μl of FG-2 protoplasts, then add 200 μl of 60% PEG solution and mix, incubate on ice for 40 minutes, then add 2 ml of 60% PEG solution and let it stand at room temperature for 20 minutes, then mix with 4 ml of STC and 4 ml of the upper resistance culture medium, pour it onto the lower plate, and culture at 35°C.

[0067] After 3 days of culture on the transformation plate, several single colonies grew and all of them grew spores. The inoculation loop was dipped into 30 μL of sterile water, placed at -80°C for 2 hours, then taken out and placed in a 37°C water bath for 2 hours. This process was repeated 3 times of freezing and thawing. Using this spore solution as a template and DPE-f / r as primers, PCR amplification was performed. The single colony with the correct band on agarose gel electrophoresis was the genetically engineered strain FG-2-DPE. The results are shown in the figure. Figure 4 .

[0068] Upper resistance culture medium: CYM medium with 1.5% agar powder, 21.68% sorbitol, and hygromycin resistance added to a final concentration of 250 μg / ml.

[0069] The formula of the lower plate is the same as that of the upper plate resistance culture medium.

[0070] 60% PEG solution: PEG400 12 g, 1 M CaCl2 1 ml, 1 M Tris-HCl (pH 8) 200 μl, and dilute to 20 ml.

[0071] Example 4 Ultraviolet mutagenesis of genetically engineered strains

[0072] (1) Obtaining spore solution of recombinant strain: streak spores of the recombinant strain FG-2-DPE in Example 3 onto CYM plates and culture at 35°C until a large number of spores are produced. Wash the spores with sterile water and count them under a microscope. Dilute the spores to 2 × 10 7 / ml, and the spore liquid is obtained.

[0073] (2) UV mutagenesis step: 1 ml of the recombinant strain spore solution was diluted 10-fold in a glass culture dish and placed 15 cm away from a UV lamp (UV lamp power density 80 W / cm) for 10 min with rotor agitation. After mutagenesis, 100 μl of the spores were spread on a hygromycin (final concentration 250 μg / ml) resistant CYM plate and cultured at 35°C until single colonies grew. Five transformants of the recombinant strain FG-2-DPE-Y were obtained.

[0074] Example 5: Verification of genetically engineered strains at shake flask level

[0075] (1) Inoculation of recombinant strains into shake flasks: The ae of FG-2-DPE-Y and the wild-type FG-2 strain in Example 4 were selected and cultured on hygromycin-resistant CYM plates (final concentration 250 μg / ml) at 35°C until a large number of spores were produced. The spores were washed with sterile water and counted under a microscope. The spores were diluted to 2×10 7 The spore suspension was inoculated into 500 mL shake flasks containing 100 mL shake flask fermentation medium at a 10% inoculation rate, and cultured at 37°C and 220 r / min for 96 h to obtain fermentation broth. Figure 5 .

[0076] Fermentation medium: glucose 2%, potassium dihydrogen phosphate 0.0013%, peptone 0.3%, ammonium nitrate 0.1%, magnesium sulfate 0.002 g / L, calcium carbonate 4 g / L, magnesium chloride 0.95%.

[0077] (2) DPE enzyme activity determination: Take fresh fermentation broth and centrifuge it. The supernatant is the sample to be tested. Take a 1ml centrifuge tube, add 960μl of dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer, add 20μl of 50% fructose, add 10μl of 100mM manganese chloride solution, and finally add 10μl of supernatant and shake well. Quickly place it in a 55℃ water bath and water bath for 10 minutes. After the water bath is completed, boil it for 5 minutes, take it out, cool it, and centrifuge it again. The supernatant enters the liquid phase. The enzyme activity calculation formula is simplified to:

[0078] Enzyme activity (U / mL) = D-psicose peak area × 10 4 / D-fructose peak area × 18.

[0079] The test results are shown in Table 1.

[0080] Table 1 Determination of extracellular DPE enzyme activity of recombinant strains

[0081]

[0082] As shown in Table 1, among the five transformants of the recombinant strain FG-2-DPE-Y, DPE enzyme activity was significantly increased compared to that of the wild-type strain FG-2, exceeding 100 U / ml. The strain with the highest activity among the five transformants was FG-2-DPE-Yd, reaching a maximum of 176.94 U / ml. In all three replicates from the same group, the activity was above 170 U / ml, with an average of 176.05 U / ml across the three replicates. This demonstrates that this method successfully constructed a recombinant Aspergillus niger strain producing heterologous DPE enzyme.

[0083] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger, characterized in that: The specific steps are as follows: (1) Construction of recombinant vector pAN7-1-DPE ① Using the pAN7-1 plasmid as a template and DPE-zai-f / r as primers, PCR amplification was performed to obtain the pAN7-1 vector backbone; ② Using the synthesized DPE gene as a template and DPE-f / r as primers, PCR amplification was performed to obtain the DPE gene fragment; The DPE gene sequence is shown in SEQ ID NO.1; ③ The vector backbone obtained in step ① and the gene fragment obtained in step ② were cloned and connected in one step to obtain the recombinant vector pAN7-1-DPE; (2) Construction of linearized vector pAN7-1-DPE The recombinant vector pAN7-1-DPE was linearized by PCR using primers line-pla-f / r to obtain the linearized vector pAN7-1-DPE-line; (3) Using Aspergillus niger FG-2 as the starting strain, the recombinant vector pAN7-1-DPE was expressed The linearized vector pAN7-1-DPE-line was transformed into Aspergillus niger FG-2 protoplasts and selected with 250 μg / ml hygromycin to obtain the genetically engineered strain FG-2-DPE. (4) Obtaining the highly expressed genetically engineered strain FG-2-DPE-Y ① subjecting the genetically engineered strain FG-2-DPE obtained in step (3) to UV mutagenesis; ② After screening with 250 μg / ml hygromycin, the high-expression genetically engineered strain FG-2-DPE-Y was obtained.

2. The method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger according to claim 1, characterized in that: The sequence of primer DPE-zai-f / r is as follows: DPE-zai-f:CGAAGTGTGAatcttcagtatattcatcttcccatccaagaacc;SEQ ID NO.2; DPE-zai-r: ATACTTCATgggaaaagaaagagaaaagaaaagagcagctgg; SEQ ID NO.

3.

3. The method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger according to claim 1, characterized in that: The sequences of primers DPE-f / r are as follows: DPE-f: ctttcttttcccATGAAGTATGGTATCTACTACGCATATTGGGAG; SEQ ID NO.4; DPE-r:gatgaatatactgaagatTCACACTTCGAAGACGTGCTTG; SEQ ID NO.

5.

4. The method for efficiently heterologously expressing D-psicose 3-epimerase in Aspergillus niger according to claim 1, characterized in that: The sequence of the primer line-pla-f / r is as follows: line-pla-f:gtatagctaccagtgaggaagtggactcaa;SEQ ID NO.6; line-pla-r: gactttgatggtcgttgtaggggct; SEQ ID NO.7.

Images