Preparation methods and applications of fibronectin

Abstract

This invention provides a method for preparing fibronectin and its applications, relating to the field of biotechnology. The preparation method involves expressing fibronectin using HEK-293T cells, with the AGRN protein signal peptide serving as the signal peptide for fibronectin. This method enables HEK-293T cells to secrete and express fibronectin in high quantities and with high bioactivity, which is beneficial for the application of fibronectin in tissue regeneration, wound healing, and other fields.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing fibronectin and its application. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] Fibronectin 1 (FN1) is an important extracellular matrix glycoprotein that mediates various cell interactions with the extracellular matrix (ECM) and is widely involved in physiological processes such as cell adhesion, migration, proliferation, and tissue repair. Its molecular structure contains multiple functional domains, including the RGD (arginine-glycine-aspartic acid) sequence, a heparin-binding domain, and a fibroin-binding domain. Fibronectin participates in a wide range of physiological processes such as cell adhesion, migration, and differentiation, playing a role in tissue regeneration, wound healing, and promoting cell proliferation and differentiation. Currently, it has broad application prospects in medicine, cosmetics, skincare, and scientific research, and can be used to prepare products for tissue engineering, wound repair, drug delivery, and stem cell culture.

[0004] There are currently two main sources of fibronectin:

[0005] (1) Traditional animal blood extraction. On the one hand, purifying natural fibronectin from human plasma is limited by plasma supply, resulting in high costs, large batch-to-batch variations, and the risk of pathogen contamination. On the other hand, fibronectin isolated from animal tissues (such as bovine plasma) is immunogenic and may trigger host immune responses. Therefore, traditional animal-derived fibronectin is difficult to meet the needs of large-scale production and application.

[0006] (2) Sources of Recombinant Expression. Using genetic engineering techniques to express recombinant fibronectin in host cells is an important way to overcome the shortcomings of natural sources. Although recombinant DNA technology has made large-scale production of fibronectin possible, current recombinant expression systems still face many technical bottlenecks. Currently, expression systems mainly include prokaryotic and eukaryotic systems. Prokaryotic expression systems, such as those in *E. coli*, are low-cost, have short cycles, and high yields, but they struggle to achieve correct folding and post-translational modifications of fibronectin, easily leading to domain folding errors or abnormal glycosylation. This results in impaired key functions of the produced fibronectin, such as cell adhesion and matrix assembly, and the formation of inclusion bodies, leading to low protein activity after refolding. Furthermore, there is a risk of immunogenicity and endotoxin contamination, causing safety issues and requiring additional steps to remove endotoxins, increasing production costs. Eukaryotic expression systems typically utilize mammalian cells to express fibronectin, such as CHO and HEK-293T, which can perform complex folding and modification. Their products are close to natural fibronectin, but their expression levels are low (usually <1g / L), and purification steps such as affinity chromatography and ion exchange are required, which greatly increases production costs.

[0007] Therefore, developing an efficient, highly active, low-immunogenic, and low-cost method for preparing recombinant human fibronectin, and expanding its application in the biomedical field, has significant scientific value and market prospects. Summary of the Invention

[0008] The purpose of this invention is to provide a method for preparing fibronectin, so as to alleviate the problem of low efficiency in expressing fibronectin using mammalian cells in the prior art.

[0009] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0010] In a first aspect, a method for preparing fibronectin is provided, the method comprising expressing fibronectin using HEK-293T cells and using AGRN protein signal peptide as the signal peptide of fibronectin.

[0011] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin, respectively.

[0012] Thirdly, a carrier is provided that carries the polynucleotide described in the second aspect.

[0013] Fourthly, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide of the second aspect, or contains the vector described in the third aspect.

[0014] Fifthly, a method for preparing fibronectin as described in the first aspect is provided, or fibronectin prepared by the method described in the first aspect, or the polynucleotide as described in the second aspect, or the vector as described in the third aspect, or the application of recombinant HEK-293T cells as described in the fourth aspect in any one of (i) to (iii):

[0015] (i) Uses for promoting fibroblast adhesion, proliferation and / or migration for purposes other than diagnosis and treatment;

[0016] (ii) Use in the preparation of products for promoting fibroblast adhesion, proliferation and / or migration;

[0017] (iii) Application in the preparation of products for tissue regeneration or wound healing.

[0018] In a sixth aspect, a method for preparing the fibronectin described in the first aspect, or the fibronectin prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the carrier described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, are provided for use in preparing tissue engineering materials, wound repair materials, drug delivery formulations, or stem cell culture formulations.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention utilizes HEK-293T cells to express fibronectin and replaces the traditional signal peptide with the AGRN protein signal peptide, thus successfully achieving the preparation of high-yield, highly bioactive fibronectin. Experiments have confirmed a synergistic effect between the AGRN protein signal peptide and HEK-293T cells; compared to CHO cells, the AGRN protein signal peptide induces higher fibronectin expression levels in HEK-293T cells. Furthermore, the fibronectin prepared by this invention exhibits excellent biological activity, demonstrating its effective promotion of fibroblast proliferation, adhesion, and migration. Based on these superior properties, this preparation method has enormous application potential and a broad market prospect in multiple fields, including tissue regeneration, wound healing, regenerative medicine product development, gene therapy product development, biomaterial preparation, and cosmetic product manufacturing. Attached Figure Description

[0021] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0022] Figure 1The plasmid map of the expression plasmid constructed in Example 1;

[0023] Figure 2 The results of immunoblotting in Example 3 show the expression of fibronectin linked to signal peptides A, B, and C, respectively.

[0024] Figure 3 The results of immunoblotting in Example 4 show the expression of fibronectin, the linking signal peptide C, in CHO cells and HEK-293T cells.

[0025] Figure 4 The relative adhesion rate of fibroblasts in the negative control and after the well plate was coated with fibronectin in Example 5;

[0026] Figure 5 The relative proliferation rate of fibroblasts treated with different concentrations of fibronectin in Example 6;

[0027] Figure 6 These are photographs of fibroblasts at 0h, 6h, and 24h in the cell scratch experiment of Example 7. Detailed Implementation

[0028] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] In this document, “and / or” is used to indicate that one or both of the situations described may occur, for example, A and / or B includes (A and B) and (A or B).

[0030] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order, or importance between these entities or behaviors, such as numbering first, second, etc.

[0031] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0032] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0033] In this article, peptides, polypeptides, and proteins are not strictly distinguished and can be used interchangeably in some cases. Generally, peptides refer to polymers composed of amino acids linked by peptide bonds, whether naturally occurring or synthetic.

[0034] In this document, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, it optionally encodes either the sense or antisense strand. Polynucleotides can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably. In an optional embodiment, the polynucleotide is DNA.

[0035] In this document, the term "vector" refers to a delivery system that can operatively insert a genetic element (such as the aforementioned polynucleotide) into itself and enable the expression of that genetic element, for example, to produce a protein, RNA, or DNA encoded by that genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling the expression of the genetic element they carry within the host cells. Examples of vectors include: plasmids, episome plasmids, microcircular DNA, phage particles, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC), bacteriophages such as λ phage or M13 phage, and animal viruses. Vectors may contain various elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may also include components that facilitate their entry into the cell, including but not limited to viral particles, liposomes, or protein coats. Vectors can be expression vectors or cloning vectors. The vector may also include selection markers, such as, but not limited to, resistance genes and / or fluorescent protein genes.

[0036] In a first aspect, a method for preparing fibronectin is provided, the method comprising expressing fibronectin using HEK-293T cells and using AGRN protein signal peptide as the signal peptide of fibronectin.

[0037] In this article, AGRN protein refers to recombinant protein. AGRN is a multi-domain protein that can be expressed as a membrane protein and secreted in the ECM. AGRN protein contains several laminin G, Kazal-type serine protease inhibitor, and epidermal growth factor domains, and its core protein size is approximately 220 kDa.

[0038] HEK-293T cells (Human Embryonic Kidney 293T cells) are derived from human embryonic kidney cells and are commonly used as host cells for exogenous expression of target proteins. They possess advantages such as stable and high proliferation capacity and high transfection efficiency in vitro. This invention discovers that using the AGRN protein signal peptide as the signal peptide for fibronectin can significantly enhance the expression of fibronectin in HEK-293T cells.

[0039] In an optional implementation, the original signal peptide of fibronectin is replaced with the AGRN protein signal peptide.

[0040] In an alternative implementation, fibronectin is secreted and expressed in HEK-293T cells.

[0041] In an optional embodiment, the amino acid sequence of the AGRN protein signal peptide is shown in SEQ ID NO.1.

[0042] SEQ ID NO. 1: MAGRSHPGPLRPLLPLLVVAACVLPGAGG.

[0043] In an optional embodiment, the nucleotide sequence encoding the AGRN protein signal peptide is shown in SEQ ID NO.2.

[0044] SEQ ID NO.2:

[0045] atggccggccggtcccacccgggcccgctgcggccgctgctgccgctccttgtggtggccgcgtgcgtcctgcccggagccggcggg.

[0046] In an optional embodiment, the preparation method includes expressing a polynucleotide in HEK-293T cells, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin.

[0047] The sequences encoding the AGRN protein signal peptide and the sequences encoding fibronectin can be integrated or not integrated into the genome of HEK-293T cells.

[0048] In an optional embodiment, the preparation method includes: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and causing the HEK-293T cells to express fibronectin.

[0049] In optional embodiments, those skilled in the art can introduce polynucleotides encoding the AGRN protein signal peptide and polynucleotides encoding fibronectin into HEK-293T cells in any known manner of introducing exogenous nucleic acids into cells, such as, but not limited to, liposome transfection, cationic polymer transfection, electroporation, microinjection, gene gun or viral vector-mediated transfection.

[0050] It is understood that those skilled in the art can culture the HEK-293T cells using any methods that are optional and known in the art, including optional and known culture media, culture environments, culture containers, and culture equipment.

[0051] In an optional embodiment, the preparation method further includes isolating, enriching and / or purifying fibronectin expressed in recombinant HEK-293T cells.

[0052] In an optional embodiment, the fibronectin is tagged with His, and the preparation method further includes purifying the fibronectin using a filler modified with nickel ions.

[0053] The fibronectin prepared by the preparation method described in the first aspect includes wild-type fibronectin or artificially modified fibronectin, wherein the artificial modification includes, but is not limited to, mutated, truncated, or fused peptides or proteins with other structural domains.

[0054] The fibronectin prepared by the method described in the first aspect can be fibronectin from any species in the art, such as fibronectin from mammals, including but not limited to humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, alpacas, poultry, goats, and sheep. In an optional embodiment, the fibronectin prepared by the method described in the first aspect is a human-derived fibronectin. In an optional embodiment, the fibronectin expressed by the preparation method is a fibronectin encoded by the nucleotide sequence shown in SEQ ID NO. 7.

[0055] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin, respectively.

[0056] In an optional embodiment, the amino acid sequence of the AGRN protein signal peptide is shown in SEQ ID NO.1.

[0057] In an optional embodiment, the polynucleotide sequence encoding the AGRN protein signal peptide is shown in SEQ ID NO.2.

[0058] Thirdly, a carrier is provided that carries the polynucleotide described in the second aspect.

[0059] In an optional embodiment, the vector is a plasmid.

[0060] In an optional embodiment, the vector is an expression plasmid.

[0061] Fourthly, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T carries the polynucleotide described in the second aspect, or contains the vector described in the third aspect.

[0062] In an optional embodiment, the polynucleotide described in the second aspect may or may not be integrated into the genome of the recombinant HEK-293T cells.

[0063] In an optional embodiment, the recombinant HEK-293T cells contain a plasmid carrying the polynucleotides described in the second aspect.

[0064] Fifthly, a method for preparing fibronectin as described in the first aspect is provided, or fibronectin prepared by the method described in the first aspect, or the polynucleotide as described in the second aspect, or the vector as described in the third aspect, or the application of recombinant HEK-293T cells as described in the fourth aspect in any one of (i) to (iii):

[0065] (i) Uses for promoting fibroblast adhesion, proliferation and / or migration for purposes other than diagnosis and treatment;

[0066] (ii) Use in the preparation of products for promoting fibroblast adhesion, proliferation and / or migration;

[0067] (iii) Application in the preparation of products for tissue regeneration or wound healing.

[0068] In an optional embodiment, (i) is used in the in vitro promotion of fibroblast adhesion, proliferation and / or migration.

[0069] In a sixth aspect, a method for preparing the fibronectin described in the first aspect, or the fibronectin prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the carrier described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, are provided for use in preparing tissue engineering materials, wound repair materials, drug delivery formulations, or stem cell culture formulations.

[0070] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0071] Example 1

[0072] 1. The target gene was ligated into the pCDNA3.1 expression vector using seamless cloning to obtain expression plasmids for different signal peptide fibronectin (FN1) genes. The plasmid maps are shown below. Figure 1 As shown, the nucleotide sequence encoding the signal peptide is attached to the 5' end of the fibronectin gene, the nucleotide sequence of which is shown in SEQ ID NO.7. The fibronectin is attached with a 6×His tag.

[0073] The sequences of the signal peptides are as follows:

[0074] Signal peptide A (fibronectin signal peptide):

[0075] Amino acid sequence, SEQ ID NO.3: MLRGPGPGLLLLAVQCLGTAVPSTG

[0076] Nucleotide sequence, SEQ ID NO.4:

[0077] atgcttaggggtccggggcccgggctgctgctgctggccgtccagtgcctggggacagcggtgccctccacggga

[0078] Signal peptide B (FBLN2 protein signal peptide):

[0079] Amino acid sequence, SEQ ID NO.5:

[0080] MVLLWEPAGAWLALGLALALGPSVAAA

[0081] Nucleotide sequence, SEQ ID NO.6:

[0082] atggtgctgctctgggagcctgcaggagcctggcttgctctgggcctggccctggccctgggccccagcgtggccgcagct

[0083] Signal peptide C (AGRN protein signal peptide):

[0084] Amino acid sequence, SEQ ID NO.1:

[0085] MAGRSHPGPLRPLLPLLVVAACVLPGAGG

[0086] Nucleotide sequence, SEQ ID NO.2:

[0087] atggccggccggtcccacccgggcccgctgcggccgctgctgccgctccttgtggtggccgcgtgcgtcctgcccggagccggcggg

[0088] Three expression plasmids, each integrating a signal peptide and a fibronectin, were obtained and named pA-FN1, pB-FN1, and pC-FN1, respectively. The plasmid maps are shown below. Figure 1 As shown.

[0089] Example 2

[0090] Production and preparation of human fibronectin efficiently secreted by HEK-293T cells:

[0091] HEK-293T cells were seeded and plated one day in advance to ensure 80% confluence before transfection. For transfection, 20 μg of the recombinant expression plasmids pA-FN1, pB-FN1, and pC-FN1 prepared in Example 1 were incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added to the supernatant of the HEK-293T cell culture medium. The supernatant of the transfected HEK-293T culture medium was collected, and fibronectin corresponding to the elution peak was eluted using a nickel ion affinity chromatography column to obtain recombinant human fibronectin.

[0092] Example 3

[0093] Comparison of expression levels of different signal peptides connecting fibronectin:

[0094] The recombinant expression plasmids pA-FN1, pB-FN1, and pC-FN1 prepared in Example 1 were transfected into HEK-293T cells. Cell culture supernatant was collected 72 hours after transfection, and the expression levels of fibronectin were compared using Western blotting. The results are as follows: Figure 2 As shown, when the total protein loading amount per well is consistent, among the fibronectin linked by the three signal peptide sequences (signal peptide A, signal peptide B, and signal peptide C), the expression level of fibronectin linked by signal peptide C is higher. Therefore, using signal peptide C to link fibronectin for expression yields the maximum expression level of fibronectin.

[0095] Example 4

[0096] Comparison of fibronectin expression via signal peptide C in different mammalian cells:

[0097] The recombinant expression plasmid pC-FN1 constructed in Example 1 was transfected into HEK-293T and CHO cells, respectively, and its expression differences in different mammalian cell types were compared. One day before transfection, HEK-293T and CHO cells were seeded in 6-well plates to achieve 80% confluence before transfection. For transfection, 2 μg of the recombinant expression plasmid pC-FN1 was incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added to the culture supernatant of HEK-293T and CHO cells, respectively, using the same amount of plasmid for both transfections. After transfection, the culture supernatant of HEK-293T and CHO cells was collected after 72 h, and the expression level of fibronectin was compared using Western blotting. The results are as follows: Figure 3 As shown, when the total protein loading amount per well was consistent, the expression level of recombinant expression plasmid pC-FN1 in HEK 293T cells was significantly better than that in CHO cells. Therefore, using a recombinant plasmid expressing the signal peptide C-linked fibronectin in HEK-293T cells can efficiently secrete human fibronectin.

[0098] Example 5

[0099] Fibronectin promotes fibroblast adhesion:

[0100] For the cell adhesion assay, 96-well plates were first coated with fibronectin solutions prepared in Example 2 at 10 μg / mL, 5 μg / mL, 2.5 μg / mL, 1 μg / mL, 0.5 μg / mL, and 0 μg / mL at 37°C for 2 h at 37°C. The plates were then incubated with 1% denatured BSA for 1 h, followed by washing the plates three times with serum-free medium to remove excess gel. Fibroblasts were digested, and 5000 cells were seeded into each well. A blank control (no cells, only medium) was added. The plates were incubated at 37°C for 1 h. After 1 h, the medium was removed from each well, and the cells were gently washed three times with PBS to remove non-adhered cells. 100 μL of medium containing 10% CCK-8 was added, and the plates were incubated at 37°C for another 2 h. The absorbance at 450 nm was measured using a microplate reader, and the cell adhesion rate was calculated. Results are as follows: Figure 4 As shown, fibroblast adhesion gradually increases with increasing fibronectin concentration.

[0101] Example 6

[0102] Fibronectin promotes fibroblast proliferation:

[0103] The fibronectin obtained in Example 2 was diluted to appropriate concentrations using DMEM basal medium: 0.4 μg / mL, 0.2 μg / mL, 0.1 μg / mL, 0.05 μg / mL, 0.025 μg / mL, 0.0125 μg / mL, 0.063 μg / mL, and 0.032 μg / mL. The sample group consisted of the above-mentioned diluted fibronectin, while the blank control group used DMEM basal medium. Each group was configured with three replicates. One day prior to the test, fibroblasts were seeded into 96-well plates at 2000 cells per well, with no cells seeded in the outer wells. PBS was added to prevent the inner medium from drying out. Cells were incubated overnight at 37°C. Each cell group was then incubated with a series of diluted fibronectin concentrations and DMEM basal medium, and cultured for another 48 hours. After 48 hours, the culture medium in each well was removed, the cells were washed three times with PBS, and culture medium containing 10% CCK-8 was added. The cells were then incubated at 37°C for another 2 hours, and the absorbance at 450 nm was measured using a microplate reader. Results are as follows: Figure 5 As shown, fibroblast proliferation activity gradually increases with increasing fibronectin concentration.

[0104] Example 7

[0105] Fibronectin promotes fibroblast migration:

[0106] In 24-well plates, the experimental group was coated with 10 μg / mL fibronectin prepared in Example 2 for 2 h, while the negative control group was coated with DMEM without fibronectin. After coating each well, horizontal lines were evenly drawn on the back of the 12-well plate using a marker and a ruler, and fibroblasts in the logarithmic growth phase were digested and counted. 3 x 10⁻⁶ cells were seeded in each well. 5 After cell adhesion was achieved, the confluence reached 100%. On the second day after plating, a 200µl pipette tip was used to make vertical scratches along the bottom line of the plate. After scratching, the cells were rinsed three times with PBS, and 1ml of complete culture medium was added. The cells were then cultured at 37°C, and observed and photographed at 0h, 6h, and 24h. The results are as follows: Figure 6 As shown, the scratch area in fibroblasts coated with fibronectin decreased significantly over time, and their wound healing rate was greater than that of fibroblasts without fibronectin-coated plates.

[0107] The nucleotide sequence of SEQ ID NO.7 is as follows:

[0108]

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing fibronectin, characterized in that, This includes using HEK-293T cells to express fibronectin, with AGRN protein signal peptide as the fibronectin signal peptide; HEK-293T cells were made to express a polynucleotide, wherein the polynucleotide contained, from the 5' end to the 3' end, a sequence encoding the AGRN protein signal peptide and a sequence encoding fibronectin, respectively; The nucleotide sequence encoding the AGRN protein signal peptide is shown in SEQ ID NO.2; The nucleotide sequence encoding fibronectin is shown in SEQ ID NO.

7.

2. The preparation method according to claim 1, characterized in that, The amino acid sequence of the AGRN protein signal peptide is shown in SEQ ID NO.

1.

3. The preparation method according to claim 1 or 2, characterized in that, The preparation method includes: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and causing the HEK-293T cells to express fibronectin.

4. Recombinant HEK-293T cells, characterized in that, The recombinant HEK-293T cells carry a polynucleotide containing, from the 5' end to the 3' end, a sequence encoding the AGRN protein signal peptide and a sequence encoding fibronectin, or a vector carrying the polynucleotide. The polynucleotide sequence encoding the AGRN protein signal peptide is shown in SEQ ID NO.2; The nucleotide sequence encoding fibronectin is shown in SEQ ID NO.

7.

5. The use of the recombinant HEK-293T cells according to claim 4 in the preparation of products for tissue regeneration or wound healing.

Images