A rapid SNP molecular marker screening method for species identification and its application in licorice base seed identification
The rapid SNP molecular marker screening method has solved the problem of identifying the original species of licorice, enabling rapid and accurate identification of licorice, glycyrrhiza glabra, and glycyrrhiza inflata, thus ensuring the efficacy stability of traditional Chinese medicine products and the precision of clinical medication.
Patent Information
- Application Number
- CN202510833406.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2045-06-20
AI Technical Summary
Existing technologies make it difficult to quickly and accurately distinguish between licorice, glossy licorice, and inflated licorice, leading to unstable efficacy of traditional Chinese medicine products and affecting clinical treatment results.
A rapid SNP molecular marker screening method was developed. Four self-developed algorithms were used to screen molecular markers suitable for pyrosequencing. Specific amplification and sequencing primers were designed to achieve rapid identification of licorice, glycyrrhiza glabra, and glycyrrhiza inflata.
This enables rapid and accurate identification of licorice-based original species, ensuring the efficacy stability of traditional Chinese medicine products and the precision of clinical medication.
Smart Images

Figure CN120574980B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a rapid SNP molecular marker screening method for species identification and application thereof in identification of licorice base seed. BACKGROUND
[0002] Traditional Chinese medicine licorice is a multi-base medicinal material, and its base seeds include Glycyrrhiza uralensis Fisch., G. glabra L. and G. inflata Batalin. The main differences among the three in morphological characteristics are in leaves, inflorescences, pods and seeds, while the morphologies of their medicinal parts, roots and rhizomes, are highly similar and difficult to distinguish from appearance. Licorice mainly includes chemical components such as saponins, flavonoids, phenols and the like, and the compositions and contents of the main active ingredients of the three base seeds of licorice are different, and the flavonoid components and triterpenoid saponin components are different. Mixing use without distinguishing base seeds has an impact on the efficacy consistency and stability of herbal products, is not conducive to precise medication in clinic, and causes clinical efficacy fluctuation and quality control problems.
[0003] DNA barcoding technology can realize rapid identification of species by analyzing DNA sequences with evolutionary conservation. Previous studies have shown that the ITS2 and other universal barcoding sequences of the three base seeds of licorice are highly similar, and it is difficult to distinguish species by interval sequence comparison, and it is also difficult to quickly complete species identification by a single molecular marker that is conserved within a species and varies between species. The chloroplast genome can provide more possibilities for the development of molecular markers for the three base seeds of licorice due to its high throughput.
[0004] Pyrosequencing is an enzyme-linked cascade sequencing technology. Under the synergistic action of multiple enzymes, the purpose of real-time determination of known short DNA sequences is achieved by detecting the release and intensity of fluorescence. The species identification detection method (SpeID) based on pyrosequencing has been successfully applied to the adulteration identification of Chinese herbal medicines such as honeysuckle and the forensic identification of animal hair tissues. In the early stage, the team screened species-specific single nucleotide polymorphism (SNP) sites from universal DNA barcoding sequences using pyrosequencing technology, and established a rapid and accurate molecular identification method for distinguishing base seeds in mixed powder of multi-base medicinal material Herba Epimedii. The sensitivity and stability of the method are superior to those of the Sanger sequencing method.
[0005] The specificity SNPs of single species in the mixture detected based on the pyrosequencing platform has good potential for species identification of original plants, traditional Chinese medicines and the like, especially the easily mixed and false low taxonomic level of closely related species. Finding suitable species-specific sites is the key first step for using the pyrosequencing-based method to quantify herbs, and inappropriate sites will lead to false output data and even large bias values. On the basis of obtaining the species-specific sites, it is also necessary to screen the molecular markers meeting the requirements of quantitative sequencing, but the manual operation is tedious, laborious and prone to errors.
[0006] The present application designs a novel SNP molecular marker screening (SLS) method, which simplifies the process of selecting sites from the chloroplast genome, and can quickly identify and verify the molecular markers of the chloroplast genome for the pyrosequencing-based method. The method sequentially completes the preprocessing of sequence data, the identification of conservative and variant sites, the screening of molecular markers suitable for pyrosequencing analysis and the acquisition of characteristic information of the molecular markers through four algorithms. Based on the method, the SNP molecular markers for distinguishing Glycyrrhiza uralensis, G. glabra and G. inflate are obtained, and then specific amplification and sequencing primers are designed to complete the rapid and accurate identification of G. uralensis, G. glabra and G. inflate, thereby laying a foundation for the standard development and utilization of G. uralensis breeding and germplasm resources and medicinal value. SUMMARY
[0007] One of the purposes of the present application is to provide a rapid SNP molecular marker screening method for species identification.
[0008] The second purpose of the present application is to provide molecular markers for identifying G. uralensis, G. glabra and G. inflate in the chloroplast genome, and to realize the application of SNP markers in the identification of different G. uralensis original species.
[0009] The third purpose of the present application is to provide a rapid molecular identification method and process for three G. uralensis original species.
[0010] In order to achieve the above purposes, the technical solutions of the present application are as follows:
[0011] The present application develops a rapid SNP molecular marker screening method for species identification by sequentially completing four main self-developed algorithms. Among them, algorithm 1 is used to rename all chloroplast genome sequences to the format of “genus name_species word_sequence ID”; algorithm 2 is used to obtain the information of conservative sites within a single species and variant sites between species; algorithm 3 is used to screen molecular markers suitable for pyrosequencing analysis; and algorithm 4 is used to extract the characteristic information of the molecular markers in the original sequence data.
[0012] Based on the above-mentioned SNP molecular marker screening method, the present application provides one, five and six specific molecular markers for G. uralensis, G. glabra and G. inflate respectively:
[0013] 1) the 72849th nucleotide is T, referring to the chloroplast genome MT120789, indicating that the sample is Glycyrrhiza-based original species Glycyrrhiza; the PCR forward and reverse amplification primers corresponding to the SNP molecular marker are SEQ ID NO. 2 and SEQ ID NO. 3, and the pyrosequencing primer is SEQ ID NO. 4;
[0014] 2) the 14542th, or 20832th, or 40346th, or 44124th, or 52389th nucleotide is T, G, A, A, T, respectively, referring to the chloroplast genome MT120789, indicating that the sample is Glycyrrhiza-based original species Glycyrrhiza glabra; the PCR forward and reverse amplification primers corresponding to the SNP molecular marker are SEQ ID NO. 6 and SEQ ID NO. 7, SEQ ID NO. 10 and SEQ ID NO. 11, SEQ ID NO. 14 and SEQ ID NO. 15, SEQ ID NO. 18 and SEQ ID NO. 19, SEQ ID NO. 22 and SEQ ID NO. 23, and the pyrosequencing primers are SEQ ID NO. 8, SEQ ID NO. 12, SEQ ID NO. 16, SEQ ID NO. 20, SEQ ID NO. 24, respectively;
[0015] 3) the 9349th, or 21102th, or 43958th, or 71799th, or 80447th, or 115506th nucleotide is C, A, A, C, A, T, respectively, referring to the chloroplast genome MT120789, indicating that the sample is Glycyrrhiza-based original species Glycyrrhiza inflate. The PCR forward and reverse amplification primers corresponding to the SNP molecular marker are SEQ ID NO. 26 and SEQ ID NO. 27, SEQ ID NO. 30 and SEQ ID NO. 31, SEQ ID NO. 34 and SEQ ID NO. 35, SEQ ID NO. 38 and SEQ ID NO. 39, SEQ ID NO. 42 and SEQ ID NO. 43, SEQ ID NO. 46 and SEQ ID NO. 47, and the pyrosequencing primers are SEQ ID NO. 28, SEQ ID NO. 32, SEQ ID NO. 36, SEQ ID NO. 40, SEQ ID NO. 44, SEQ ID NO. 48, respectively.
[0016] Further, the molecular identification method of Glycyrrhiza-based original species Glycyrrhiza, Glycyrrhiza glabra and Glycyrrhiza inflate based on the SNP molecular marker comprises the following steps:
[0017] 1) extract the genomic DNA of the sample to be detected;
[0018] 2) using the genomic DNA as a template, PCR amplification is completed using the forward and reverse amplification primers corresponding to each SNP molecular marker, to obtain the amplification product;
[0019] 3) using the sequencing primers corresponding to each SNP molecular marker, the amplification product is sequenced by pyrosequencing technology to obtain the base results at each molecular marker, and it is determined that the detection sample is licorice, Glycyrrhiza glabra or Glycyrrhiza inflate;
[0020] 4) for the pyrosequencing result of the 72849th position of the chloroplast genome, i.e. the 42nd position of SEQ ID NO. 1, there are three possibilities: case one, if only base T, it can be determined that only licorice exists in the detection sample; case two, if only base C, it can be determined that no licorice exists in the detection sample, which is other species of Glycyrrhiza; case three, if base C and T coexist, it can be determined that licorice and other species of Glycyrrhiza exist in the detection sample.
[0021] 5) for the pyrosequencing result of the 14542nd position, or the 20832nd position, or the 40346th position, or the 44124th position, or the 52389th position of the chloroplast genome, i.e. the 104th position of SEQ ID NO. 5, or the 56th position of SEQ ID NO. 9, or the 58th position of SEQ ID NO. 13, or the 143rd position of SEQ ID NO. 17, or the 86th position of SEQ ID NO. 21, the pyrosequencing result includes the following possibilities: case one, if only bases T, G, A, A, T respectively, it can be determined that only Glycyrrhiza glabra exists in the detection sample; case two, if only bases G, A, G, G, C respectively, it can be determined that no Glycyrrhiza glabra exists in the detection sample, which is other species of Glycyrrhiza; case three, if bases T and G, G and A, A and G, A and G, T and C coexist respectively, it can be determined that Glycyrrhiza glabra and other species of Glycyrrhiza exist in the detection sample.
[0022] 6) For the 9349th position, or the 21102nd position, or the 43958th position, or the 71799th position, or the 80447th position, or the 115506th position of the chloroplast genome, i.e. the 106th position of SEQ ID NO. 25, or the 80th position of SEQ ID NO. 29, or the 115th position of SEQ ID NO. 33, or the 198th position of SEQ ID NO. 37, or the 116th position of SEQ ID NO. 41, or the 111th position of SEQ ID NO. 45, the pyrosequencing result includes the following possibilities: case one, if only bases C, A, A, C, A, T respectively, it can be determined that only Glycyrrhiza inflate exists in the detection sample; case two, if only bases G, G, G, G, G, C respectively, it can be determined that Glycyrrhiza inflate does not exist in the detection sample, and it is other species of Glycyrrhiza; case three, if bases C and G, A and G, A and G, C and G, A and G, T and C coexist respectively, it can be determined that Glycyrrhiza inflate and other species of Glycyrrhiza exist in the detection sample.
[0023] Through the above detection steps, rapid and accurate differentiation and identification of Glycyrrhiza uralensis, Glycyrrhiza glabra and Glycyrrhiza inflate can be achieved.
[0024] The originality of the present application lies in that: first, a rapid SNP molecular marker screening method for species identification is developed; second, molecular markers and specific primers for identification of Glycyrrhiza, Glycyrrhiza glabra and Glycyrrhiza inflate in the chloroplast genome are provided, which are used for efficient amplification of short sequences where each molecular marker is located, and realize the application of SNP markers in the identification of different base species of Glycyrrhiza. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 is a rapid SNP molecular marker screening method for species identification and its main four self-developed algorithms;
[0026] Figure 2 is the information of one SNP site obtained by the molecular marker screening method of Glycyrrhiza uralensis (GU), and the pyrosequencing results of single sample and mixed powder at the site.
[0027] Figure 3 is the information of five SNP sites obtained by the molecular marker screening method of Glycyrrhiza glabra (GG), and the pyrosequencing results of single sample and mixed powder at the site.
[0028] Figure 4 is the information of six SNP sites obtained by the molecular marker screening method of Glycyrrhiza inflate (GI), and the pyrosequencing results of single sample and mixed powder at the site.
[0029] Figure 5are the sequencing results of three self-made Chinese medicines Liuyi San L1-L3 at the 72849th position of the chloroplast genome of Glycyrrhiza uralensis specific molecular marker, i.e., the 42nd position of SEQ ID NO. 1, at the 52389th position of the chloroplast genome of Glycyrrhiza pallida specific molecular marker, i.e., the 86th position of SEQ ID NO. 21, and at the 9349th position of the chloroplast genome of Glycyrrhiza inflate specific molecular marker, i.e., the 106th position of SEQ ID NO. 25. Among them, the L1 sample is composed of 180 mg talcum powder + 30 mg GU, the L2 sample is composed of 40.2 mg GG + 240.1 mg talcum powder + 60.1 mg GI, and the L3 sample is composed of 12.1 mg GG + 36.1 mg GU + 288.0 mg talcum powder + 52.1 mg GI. DETAILED DESCRIPTION
[0030] The embodiments of the present application will be described in detail below with reference to the accompanying drawings. The embodiments are implemented on the basis of the present application and give detailed implementation processes and methods. However, the protection scope of the present application is not limited to the embodiments. The protection scope of the present application is subject to the appended claims.
[0031] The present application will be further described below with reference to the accompanying drawings.
[0032] Example 1: A rapid SNP molecular marker screening method for identifying Glycyrrhiza-based original seeds
[0033] The present embodiment proposes a rapid SNP molecular marker screening method for species identification, which is suitable for the development of molecular markers for Glycyrrhiza-based original seeds. Figure 1 ), specifically including the following steps:
[0034] 1) Obtain 75 chloroplast genome (Chloroplast genome, cp) sequences of 17 Glycyrrhiza species from the GenBank database in NCBI (as of November 15, 2023);
[0035] 2) Use self-developed algorithm 1 to split all sequences into single sequence files, and rename all sequences in the format of “genus name_species word_sequence ID”;
[0036] 3) Take Wisteria sinensis (Sims) Sweet KT200359 and W.floribunda (Willd.) DC. KM103376 as outgroups, and construct a phylogenetic tree of 75 Glycyrrhiza cp sequences to complete sequence data preprocessing;
[0037] 4) Among the 75 cp sequences, 8 sequences were considered to be of poor quality according to the phylogenetic distance, including G. yunnanensis (OQ581697), G. lepidota (KY038482), G. pallidiflora (MN970217), G. uralensis (MZ329074, MZ329065, MN199032 and KU862308) and G. glabra (MG736059). The remaining 67 cp sequences were further aligned into a matrix of 137214 bp (columns) x 67 sequences (rows) as the input data file for the next step;
[0038] 5) Further, 3 specific sites with intraspecific conservation and interspecific variation characteristics were successfully screened out from the medicinal G. uralensis using self-developed algorithm 2, and 95, 112 and 58 sites were preliminarily screened out as specific sites for G. involucrata (GI), G. uralensis (GU) and G. glabra (GG). However, the deletion site “-” is not conducive to subsequent qualitative identification, therefore, the specific sites with only base variation are preferred, and finally 25, 15 and 21 specific sites of GI, GU and GG are screened out;
[0039] 6) Further, the specific sites of each species above were used as the input data of algorithm 3, and the molecular marker sites suitable for pyrosequencing analysis were screened out by three-step judgment criteria: ① In the sequence region interval [site-18, site+8], there is no site with 4 or more continuous same bases; ② In the sequence region interval [site-2, site-1], there is no variation site between all sequences; ③ In the sequence region interval [site-18, site-3], there is no more than 5 variation sites between all sequences. In addition, the specific sites in the AT-rich region are not suitable. Finally, 1 (SNP1), 5 (SNP2, SNP3, SNP4, SNP5, SNP6) and 6 (SNP7, SNP8, SNP9, SNP10, SNP11, SNP12) suitable molecular markers were screened out for GU, GG and GI, respectively;
[0040] 7) Further, in order to facilitate subsequent primer design, the original cp sequence interval of each site [site-200, site+200] is output. The self-developed algorithm 4 is used to output the information of the position of each site in the original cp sequence: the 72849th position of the chloroplast genome (psbB sequence), which is a T / C variation, is a molecular marker of Glycyrrhiza uralensis; the 14542nd position of the chloroplast genome (trnL-UAA sequence), the 20832nd position of the psbA sequence, the 40346th position of the rpoC1 sequence, the 44124th position of the rpoC2 sequence, and the 52389th position of the atpA sequence are T / G, G / A, A / G, A / G, and T / C variations, respectively, which are 5 molecular markers of Glycyrrhiza glabra; the 9439th position of the chloroplast genome (atpE sequence), the 21102nd position of the psbA sequence, the 43958th position of the rpoC2 sequence, the 71799th position of the clpP-psbB sequence, the 80447th position of the rps8 sequence, and the 115506th position of the ndhH sequence are C / G, A / G, A / G, C / G, A / G, and T / C variations, respectively, which are 6 molecular markers of Glycyrrhiza inflate.
[0041] 8) Further, in order to verify the accuracy of the 12 molecular markers obtained by the rapid SNP molecular marker screening method for species identification based on the present application for identifying Glycyrrhiza uralensis, Glycyrrhiza glabra, and Glycyrrhiza inflate, single samples of Glycyrrhiza uralensis and mixed powders were collected, and verification was completed, including the following steps:
[0042] ① Collect fresh root and rhizome samples of Glycyrrhiza uralensis, Glycyrrhiza glabra, and Glycyrrhiza inflate, slice and dry them, crush them, pass them through a 100-mesh sieve, and seal the powders in self-sealing bags for later use.
[0043] ② Take 200 mg of Glycyrrhiza uralensis (sample 1), 200 mg of Glycyrrhiza glabra (sample 2), 200 mg of Glycyrrhiza inflate (sample 3), and 210 mg of a mixed sample (Glycyrrhiza uralensis: Glycyrrhiza glabra: Glycyrrhiza inflate = 1:1:1, sample 4) and extract genomic DNA using the modified CTAB method.
[0044] iii. 4 parts of the sample genomic DNA to be tested as a template, the 72849th position of the chloroplast genome (SNP1, the 42nd nucleotide of SEQ ID NO. 1, the nucleotide is T or C, and the letter Y in SEQ ID NO. 1 represents any one of T or C), using forward primer SEQ ID NO. 2: 5'-TGGGTGTCCGATCCTTATGG-3' and reverse primer SEQ ID NO. 3: 5'-biotin-TCCCTGCTGCAATATGATGAG-3' (Biotin indicates that the 5' end of the sequence is labeled with biotin Biotin) for PCR amplification (obtaining an amplification product), and detecting whether the sample to be tested is licorice;
[0045] SEQ ID NO. 1
[0046] TGGGTGTCCGATCCTTATGGACTAACTGGAAGGGTACAATCYGTAAATCCCGCATGGGGTGTGGAAGGTTTTGATCCTTTTGTTCCGGGAGGAATAGCCTCTCATCATATTGCAGCAGGGA
[0047] PCR amplification reaction system and reaction procedure: the total volume of the amplification reaction system is 25 μL, containing 12.5 μL of 2x TaqMaster Mix, 10 μmol·L-1 of forward and reverse primers, 1 μL of each primer, 1 μL of DNA template and 9.5 μL of deionized water; the reaction procedure is pre-denaturation (94℃, 5 min), denaturation (94℃, 30 s)-annealing (56℃, 30 s)-elongation (72℃, 45 s) for 40 cycles, and elongation (72℃, 10 min); -1 PCR amplification reaction system and reaction procedure: the total volume of the amplification reaction system is 25 μL, containing 12.5 μL of 2x TaqMaster Mix, 10 μmol·L-1 of forward and reverse primers, 1 μL of each primer, 1 μL of DNA template and 9.5 μL of deionized water; the reaction procedure is pre-denaturation (94℃, 5 min), denaturation (94℃, 30 s)-annealing (56℃, 30 s)-elongation (72℃, 45 s) for 40 cycles, and elongation (72℃, 10 min);
[0048] (4) Taking 4 parts of the sample genomic DNA to be tested as a template, respectively, the fragments at the 14542th position (SNP2, the 104th nucleotide of SEQ ID NO. 5, which is T or G, the letter K in SEQ ID No. 5 represents any one of T or G nucleotide) of the chloroplast genome (trnL-UAA sequence), the 20832th position (SNP3, the 56th nucleotide of SEQ ID NO. 9, which is G or A, the letter R in SEQ ID No. 9 represents any one of G or A nucleotide) of the chloroplast genome (psbA sequence), the 40346th position (SNP4, the 58th nucleotide of SEQ ID NO. 13, which is A or G, the letter R in SEQ ID No. 13 represents any one of A or G nucleotide) of the chloroplast genome (rpoC1 sequence), the 44124th position (SNP5, the 143th nucleotide of SEQ ID NO. 17, which is A or G, the letter R in SEQ ID No. 17 represents any one of A or G nucleotide) of the chloroplast genome (rpoC2 sequence), and the 52389th position (SNP6, the 86th nucleotide of SEQ ID NO. 21, which is T or C, the letter Y in SEQ ID No. 21 represents any one of T or C nucleotide) of the chloroplast genome (atpA sequence) are amplified by PCR using the following amplification primers to obtain the amplification products, and detecting whether the sample to be tested is G. glabra;
[0049] SEQ ID NO. 5
[0050] AGTCCGTAGCGTCTACCAATTTCGCCATATCCCCCCTTTTTCTTTGAGATTGGAATCTCATTAGTATATTTTTTTTTTTCATTTATATTATGCCAGAACTGTTKAATTTATTAGATACCTATTCCCATATTGAAAAAAGTTTCCTTCTATTTGTTTGATTGATTTTCTTTCATCTATATCAGATACCCAGATTTGGTCGA
[0051] SEQ ID NO. 9
[0052] ATGGTGCTCGTTTTTCCAATTATGAAGCATGGCTAAACGATCCTACTCACATTGGRCCTAGTGCCCAGGTGGTTTGGCCAATAGTAGGTCAAGAAATATTGAATGGTGATGTAGGCGGAGGTTTCCGAGGAATACAAATAACCTCTGGTTTTTTTCAGATTTGGCG
[0053] SEQ ID NO. 13
[0054] GCGGAAGTCTATCTATCGCATATAGGCTTAAGGACATCGTGGCATAACCGTCGAGGCRACGTCTGGACCTAAAAGATCAAATGGTATGATACATAGACAAGGAAATCTCTTATGAATTCCAGGATACTCCTTTTATTAAGAATTTCTTTTTAGAGGATTCCTCATTCGAAGGGAGGTA
[0055] SEQ ID NO. 17
[0056] TCGCAGGGATCAAGATCAAATTAACATTCATTCTCTTTCTACCGGAAAAAGAAATATTTCTAACCTTTTAATAAGTAATGATCAAGTAAAACATAAATTATTAAGTTTCAATACTTTTGGTACAAAAGAAAGTAGGATTACCRATTATTCAATATTTAATCAAATCAAGGATCATTGTCATTTTATGTATCCTGCTATTTTTCACGATACTTCAGATTTATTGGCA
[0057] SEQ ID NO. 21
[0058] ATCTTCTGTGGCTCAAGTGGTAACTACTTTACAAGAAAGAGGAGCAATGGAATACACTATTATAGTGGCTGAAACAGCAAATTCTYCAGCTACATTACAATATCTCGCCCCTTATACAGGAGCAGCTCTGGCTGAATATTTTATGTATCGTGAACGCCA
[0059] The forward and reverse primers for SNP2 amplification are as follows:
[0060] SEQ ID NO. 6: 5'-AGTCCGTAGCGTCTACCAATTT-3';
[0061] SEQ ID NO. 7: 5'-biotin-TCGACCAAATCTGGGTATCTGA-3';
[0062] The forward and reverse primers for amplifying SNP3 are respectively:
[0063] SEQ ID NO. 10: 5'-ATGGTGCTCGTTTTTCCAATTA-3';
[0064] SEQ ID NO. 11: 5'-biotin-CGCCAAATCTGAAAAAAACC-3';
[0065] The forward and reverse primers for amplifying SNP4 are respectively:
[0066] SEQ ID NO. 14: 5'-GCGGAAGTCTATCTATCGCATA-3';
[0067] SEQ ID NO. 15: 5'-biotin-TACCTCCCTTCGAATGAGGAATC-3';
[0068] The forward and reverse primers for amplifying SNP5 are respectively:
[0069] SEQ ID NO. 18: 5'-TCGCAGGGATCAAGATCAAATTA-3';
[0070] SEQ ID NO. 19: 5'-biotin-TGCCAATAAATCTGAAGTATCGTG-3';
[0071] The forward and reverse primers for amplifying SNP6 are respectively:
[0072] SEQ ID NO. 22: 5'-ATCTTCTGTGGCTCAAGTGGTAA-3';
[0073] SEQ ID NO. 23: 5'-biotin-TGGCGTTCACGATACATAAAATA-3';
[0074] PCR amplification reaction system and reaction procedure: the total volume of the amplification reaction system is 25 μL, containing 12.5 μL of 2 × TaqMaster Mix, 10 μmol·L of forward and reverse primers, 1 μL of template DNA, and 10.5 μL of double-distilled water. -11 μL of each primer, 1 μL of DNA template and 9.5 μL of deionized water; the reaction procedure was pre-denaturation (94℃, 5 min), denaturation (94℃, 30 s)-annealing (56℃, 30 s)-elongation (72℃, 45 s) for 40 cycles, elongation (72℃, 10 min);
[0075] (5) Taking 4 portions of the genomic DNA of the sample to be tested as templates, the fragments at positions 9349 (SNP7, the 106th nucleotide of SEQ ID NO. 25, which is C or G, the letter S in SEQ ID No. 25 represents any one of the nucleotides C or G), 21102 (SNP8, the 80th nucleotide of SEQ ID NO. 29, which is A or G, the letter R in SEQ ID No. 29 represents any one of the nucleotides A or G), 43958 (SNP9, the 115th nucleotide of SEQ ID NO. 33, which is A or G, the letter R in SEQ ID No. 33 represents any one of the nucleotides A or G), 71799 (SNP10, the 198th nucleotide of SEQ ID NO. 37, which is C or G, the letter S in SEQ ID No. 37 represents any one of the nucleotides C or G), 80447 (SNP11, the 116th nucleotide of SEQ ID NO. 41, which is A or G, the letter R in SEQ ID No. 41 represents any one of the nucleotides A or G), and 115506 (SNP12, the 111th nucleotide of SEQ ID NO. 45, which is T or C, the letter Y in SEQ ID No. 45 represents any one of the nucleotides T or C) of the chloroplast genome were amplified by PCR using the following amplification primers, respectively, to obtain the amplification products, and to detect whether the sample to be tested is Glycyrrhiza inflate Fisch.
[0076] SEQ ID NO. 25
[0077] ATCTACTAATAGTGGACAAATTGGAGTATTAGCAAATCATGCCCCTATTGCGACAGCTGTAGATATAGGTATTTTAAGAATACGCCTTAACGACCAATGGTTAACSATGGCTCTGATGGGCGGTTTTGCTAGAATAGGCAATAATGAGATTACTATTTTAGTAAATGATGCAGAGAAAG
[0078] SEQ ID NO. 29
[0079] CCGGTTGGTTTCATTATCACAAAGCTGCTCCAAAATTGGCTTGGTTCCAAGATGTAGAATCTATGTTGAATCACCATTTRGCAGGGCTACTAGGACTGGGGTCTCTTTCTTGGGCGGGGCATCAAGTACATGTATCTTTACCGATTAACCAATTTCTAAATGCTGGAGTAGATCCTAAAGAGATCCCACTTCCTCA
[0080] SEQ ID NO. 33
[0081] AGGGGAAATGCATTGGAGTACCGATGTGTACCATGCATCAGAATTTATGTATAGTAATGTACATATCTTACCAAAAACAAGTCATTTATGGATATTATCAGGAAAGTCATGCAGRTATGATGCAATCGATTTTTTACTTCGCAGGGATCAAGATCAAATTAACATTCATTCTCTTTCTACCGG
[0082] SEQ ID NO. 37
[0083] TCTCTTGGCCTAAAAAAAGCAGTCGTTCTTGATAAAGTCGATTGTATAAGTCAATCCAAGATGCTTCATCGTCACCTGGAACAAGATAGGGTACTTTTGGCACACCGATAGGCATAAAAGTCAAAAAATGAAGTTGGCTATTTTTTTTACTTTGTTGTCTCTTTTACTTTAATGCTAAAACGTGATAAGAATTCTATSTATAATTTTTAAAATACTCTTTTACTTTTAATCAAACAAATATTTGTTTTATTCCACTCTTCCTATTTTCAAAGTCAA
[0084] SEQ ID NO.41
[0085] GCGCCTCTCGATCTGTCATTATACCTCTAGAAGTAGAAAGAATTACAATCCCCATCCCTCCTAAAATTCTAGGAATTCGTTGATAGTTAGAATAGATTCGTAGACCAGGTGTACTRATCCGTTTTAAATTTAAAAAAGTTTTATATGATCCTTTCCTATTTCTTCTATACCGTAGAGTTAAAACTAAAAAGTATTTGTTGCTTTCCCTATGTTTTCTG
[0086] SEQ ID NO. 45: 5'-TGGGAAGTTCAATGGCAAAAAGAAGGAGATTCATTAGCTCGTTATT TAGTTCGAATTGGTGAAATGATGGAATCCATAAAAATTATTCAACAGGCTTTGGAAGGAATTCCYGGCGGGCCATATGAAAATTTAGAAATCCGCTGTTTTGATAGAGAAAGGGAGCCAGAATGGAA-3'
[0087] SEQ ID NO. 46: 5'-biotin-TGGGAAGTTCAATGGCAAAAAGAAGGAGATTCATTAGCTCGTTATT TAGTTCGAATTGGTGAAATGATGGAATCCATAAAAATTATTCAACAGGCTTTGGAAGGAATTCCYGGCGGGCCATATGAAAATTTAGAAATCCGCTGTTTTGATAGAGAAAGGGAGCCAGAATGGAA-3'
[0088] The forward and reverse primers for amplifying SNP7 are as follows:
[0089] SEQ ID NO. 26: 5'-ATCTACTAATAGTGGACAAATTG-3';
[0090] SEQ ID NO. 27: 5'-biotin-CTTTCTCTGCATCATTTACTA-3';
[0091] The forward and reverse primers for amplifying SNP8 are as follows:
[0092] SEQ ID NO. 30: 5'-CCGGTTGGTTTCATTATCACA-3';
[0093] SEQ ID NO. 31: 5'-biotin-TGAGGAAGTGGGATCTCTTTAGGA-3';
[0094] The forward and reverse primers for amplifying SNP9 are as follows:
[0095] SEQ ID NO. 34: 5'-AGGGGAAATGCATTGGAGTA-3';
[0096] SEQ ID NO. 35: 5'-biotin-CCGGTAGAAAGAGAATGAATGTTA-3';
[0097] The forward and reverse primers for SNP10 amplification are as follows:
[0098] SEQ ID NO. 38: 5'-TCTCTTGGCCTAAAAAAAGCAGTC-3';
[0099] SEQ ID NO. 39: 5'-biotin-TTGACTTTGAAAATAGGAAGATGG-3';
[0100] The forward and reverse primers for SNP11 amplification are as follows:
[0101] SEQ ID NO. 42: 5'-GCGCCTCTCGATCTGTCATTATA-3';
[0102] SEQ ID NO. 43: 5'-biotin-CAGAAAACATAGGGAAAGCAACAA-3';
[0103] The forward and reverse primers for SNP12 amplification are as follows:
[0104] SEQ ID NO. 46: 5'-TGGGAAGTTCAATGGCAAAAAG-3';
[0105] SEQ ID NO. 47: 5'-biotin-TTCCATTCTGGCTCCCTTTCTCTA-3';
[0106] PCR amplification reaction system and reaction procedure: the total volume of the amplification reaction system is 25 μL, containing 12.5 μL of 2x TaqMaster Mix, 10 μmol·L -1 1 μL of primer, 1 μL of DNA template and 9.5 μL of deionized water; the reaction procedure is pre-denaturation (94℃, 5 min), denaturation (94℃, 30 s)-annealing (56℃, 30 s)-elongation (72℃, 45 s) for 40 cycles, elongation (72℃, 10 min);
[0107] (6) After obtaining the high-quality PCR products of the four samples respectively, the fragment at the 72849th position of the chloroplast genome (SNP1), i.e., the 42nd position of SEQ ID NO. 1, is sequenced by using the sequencing primer of SEQ ID NO. 4: 5'-GGACTAACTGGAAGGGTA-3' for pyrophosphate sequencing analysis Figure 2). The nucleotide of Glycyrrhiza SNP1 is T, and the nucleotide of the rest of the species of Glycyrrhiza other than Glycyrrhiza is C. The sequencing results are as follows:
[0108] Sample 1 only shows base T, and the identification result is Glycyrrhiza;
[0109] Sample 2 and Sample 3 only show base C, and the identification result is no Glycyrrhiza, but other species of Glycyrrhiza;
[0110] Sample 4 shows the coexistence of bases C and T, and the identification result is the coexistence of Glycyrrhiza and other species of Glycyrrhiza.
[0111] ⑦After obtaining high-quality PCR products of the four samples respectively, the fragments at positions 14542 (SNP2) of the chloroplast genome, i.e., positions 104 of SEQ ID NO. 5, positions 20832 (SNP3) of the chloroplast genome, i.e., positions 56 of SEQ ID NO. 9, positions 40346 (SNP4) of the chloroplast genome, i.e., positions 58 of SEQ ID NO. 13, positions 44124 (SNP5) of the chloroplast genome, i.e., positions 143 of SEQ ID NO. 17, and positions 52389 (SNP6) of the chloroplast genome, i.e., positions 86 of SEQ ID NO. 21, were subjected to pyrosequencing analysis using the following sequencing primers respectively.
[0112] The sequencing primers are as follows:
[0113] SEQ ID NO. 8: 5'-TTTATATTATGCCAGAACTG-3';
[0114] SEQ ID NO. 12: 5'-AAACGATCCTACTCACATT-3';
[0115] SEQ ID NO. 16: 5'-GGCATAACCGTCGAG-3';
[0116] SEQ ID NO. 20: 5'-TACAAAAGAAAGTAGGATTA-3';
[0117] SEQ ID NO. 24: 5'-GCTGAAACAGCAAATT-3';
[0118] The nucleotide of Glycyrrhiza glabra SNP2 is T, and the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza glabra SNP2 is G; the nucleotide of Glycyrrhiza glabra SNP3 is G, and the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza glabra SNP3 is A; the nucleotide of Glycyrrhiza glabra SNP4 is A, and the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza glabra SNP4 is G; the nucleotide of Glycyrrhiza glabra SNP5 is A, and the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza glabra SNP5 is G; the nucleotide of Glycyrrhiza glabra SNP6 is T, and the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza glabra SNP6 is C. The sequencing results are as follows: Figure 3
[0119] Sample 2 shows only bases T, G, A, A and T at positions 14542, 20832, 40346, 44124 and 52389 of the chloroplast genome respectively, and the identification result is Glycyrrhiza glabra;
[0120] Sample 1 and sample 3 show only bases G, A, G, G and C at positions 14542, 20832, 40346, 44124 and 52389 of the chloroplast genome respectively, and the identification result is that Glycyrrhiza glabra does not exist, and it is other species of Glycyrrhiza;
[0121] Sample 4 shows that bases T and G, G and A, A and G, A and G, and T and C coexist at positions 14542, 20832, 40346, 44124 and 52389 of the chloroplast genome respectively, and the identification result is that Glycyrrhiza glabra and other species of Glycyrrhiza exist at the same time.
[0122] (8) After obtaining high-quality PCR products of the four samples respectively, the fragments at positions 9349 (SNP7) of the chloroplast genome, i.e. positions 106 of SEQ ID NO. 25, 21102 (SNP8) of the chloroplast genome, i.e. positions 80 of SEQ ID NO. 29, 43958 (SNP9) of the chloroplast genome, i.e. positions 115 of SEQ ID NO. 33, 71799 (SNP10) of the chloroplast genome, i.e. positions 198 of SEQ ID NO. 37, 80447 (SNP11) of the chloroplast genome, i.e. positions 116 of SEQ ID NO. 41, and 115506 (SNP12) of the chloroplast genome, i.e. positions 111 of SEQ ID NO. 45, were subjected to pyrosequencing analysis using the following sequencing primers respectively.
[0123] The sequencing primers are as follows:
[0124] SEQ ID NO. 28: 5'-TAACGACCAATGGTTA-3';
[0125] SEQ ID NO. 32: 5'-AATCTATGTTGAATCACCAT-3';
[0126] SEQ ID NO. 36: 5'-TTATCAGGAAAGTCATGC-3';
[0127] SEQ ID NO. 40: 5'-TAAAACGTGATAAGAATTCT-3';
[0128] SEQ ID NO. 44: 5'-TTCGTAGACCAGGTGTA-3';
[0129] SEQ ID NO. 48: 5'-GCTTTGGAAGGAATT-3';
[0130] wherein the nucleotide of Glycyrrhiza inflata SNP7 is C, the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza inflata SNP7 is G; the nucleotide of Glycyrrhiza inflata SNP8 is A, the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza inflata SNP8 is G; the nucleotide of Glycyrrhiza inflata SNP9 is A, the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza inflata SNP9 is G; the nucleotide of Glycyrrhiza inflata SNP10 is C, the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza inflata SNP10 is G; the nucleotide of Glycyrrhiza inflata SNP11 is A, the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza inflata SNP11 is G; the nucleotide of Glycyrrhiza inflata SNP12 is T, the nucleotide of the rest of Glycyrrhiza species except Glycyrrhiza inflata SNP12 is C. The sequencing results obtained are as follows: Figure 4
[0131] Sample 3 shows only base C, A, A, C, A, T at the 9349th, 21102nd, 43958th, 71799th, 80447th, 115506th positions of the chloroplast genome respectively, and the identification result is Glycyrrhiza inflata;
[0132] Sample 1 and Sample 2 show only base G, G, G, G, G, C at the 9349th, 21102nd, 43958th, 71799th, 80447th, 115506th positions of the chloroplast genome respectively, and the identification result is that Glycyrrhiza inflata does not exist, and it is other species of Glycyrrhiza;
[0133] Sample 4 shows that base C and G, A and G, A and G, C and G, A and G, T and C coexist at the 9349th, 21102nd, 43958th, 71799th, 80447th, 115506th positions of the chloroplast genome respectively, and the identification result is that Glycyrrhiza inflata and other species of Glycyrrhiza exist at the same time.
[0134] 9) The identification results of the four samples at the 12 SNP sites show that the provided rapid SNP molecular marker screening method for species identification has credibility and accuracy. The accuracy rate of the screened molecular markers for the identification of G. uralensis, G. glabra and G. inflata is 100%.
[0135] Example 2 Identification of G. uralensis from different origins
[0136] This example provides a method for rapidly identifying G. uralensis from different origins, which specifically comprises the following steps:
[0137] (1) 27 G. uralensis samples were collected from Shaanxi Province, Gansu Province, Henan Province, Ningxia Hui Autonomous Region, Inner Mongolia Autonomous Region and Xinjiang Uygur Autonomous Region (Table 1). The 27 root and rhizome samples were sliced, dried, crushed, sieved through a 100-mesh sieve, and the powder was sealed in a self-sealing bag for use.
[0138] (2) 200 mg of each of the 27 tuber powder samples was taken and genomic DNA was extracted using a modified CTAB method.
[0139] (3) One molecular marker was selected from G. uralensis (SNP1), G. glabra (SNP2, SNP3, SNP4, SNP5, SNP6) and G. inflata (SNP7, SNP8, SNP9, SNP10, SNP11, SNP12) for the identification of the origin of the G. uralensis samples. The molecular markers are the chloroplast genome at position 72849 (SNP1) of SEQ ID NO. 1, the chloroplast genome at position 52389 (SNP6) of SEQ ID NO. 21 and the chloroplast genome at position 9349 (SNP7) of SEQ ID NO. 25, respectively.
[0140] (4) The fragments at the above three sites were amplified using the genomic DNA of the sample to be tested as the template, and specific PCR amplification primers and pyrosequencing primers were used to obtain the amplification products and pyrosequencing results (Table 1). It was found that the collected samples included three G. uralensis species. The G. uralensis samples showed only base T at position 72849, only base C at position 52389, and only base G at position 9349; the G. glabra samples showed only base C at position 72849, only base T at position 52389, and only base G at position 9349; and the G. inflata samples showed only base C at position 72849, only base C at position 52389, and only base C at position 9349.
[0141] Table 1 Identification of the origin of G. uralensis samples from different origins
[0142]
[0143]
[0144] Example 3 Identification of licorice base in self-made Chinese medicine Liu Yi San
[0145] The present example proposes a method for rapidly identifying the licorice base in Chinese medicine Liu Yi San, which specifically comprises the following steps:
[0146] (1) Select the dried root and rhizome powder samples of identified licorice, Glycyrrhiza glabra and G. echinata, and refer to the self-made Liu Yi San L1-L3 (Table 2) of the Chinese Pharmacopoeia (2020 edition) to conduct a study on the rapid identification of the licorice base in Chinese medicine Liu Yi San.
[0147] (2) Take 200 mg of L1-L3 samples, respectively, and use the improved CTAB method for genomic DNA extraction.
[0148] (3) Select one molecular marker from licorice, G. glabra and G. echinata, respectively, for the identification of the base of the licorice sample. The molecular markers are the chloroplast genome at position 72849 (SNP1) of SEQ ID NO. 1, the chloroplast genome at position 52389 (SNP6) of SEQ ID NO. 21 for G. glabra, and the chloroplast genome at position 9349 (SNP7) of SEQ ID NO. 25 for G. echinata.
[0149] (4) Use the genomic DNA of the sample to be tested as the template to amplify the fragments at the above-mentioned three positions, and use the specific PCR amplification primers and pyrosequencing primers for each position to obtain the amplification products and pyrosequencing results (Table 2, Figure 5 ), L1 sample shows only base T at position 72849, only base C at position 52389, and only base G at position 9349; L2 sample shows only base C at position 72849, coexistence of bases T and C at position 52389, and coexistence of bases G and C at position 9349; L3 sample shows coexistence of bases T and C at position 72849, coexistence of bases C and T at position 52389, and coexistence of bases C and G at position 9349. The results are all as expected, indicating that this method can be applied to the identification of the licorice base in Chinese medicine Liu Yi San.
[0150] Table 2 Identification of base species of licorice samples from different producing areas
[0151]
[0152] The above merely describes the preferred embodiments of the present application, but is not used to limit the protection scope of the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. The use of SNP molecular markers obtained based on the SLS (Specific loci Screening, SLS) method in identifying licorice base stock, characterized in that, The SLS method uses the following four algorithms in turn: Algorithm 1 is used to split all sequences into single sequence files and rename all sequences to the format of "genus name_species word_sequence ID"; Algorithm 2 is used to obtain the information of conserved sites within a single species and interspecific variable sites; Algorithm 3 is used to screen specific molecular markers suitable for pyrosequencing analysis; The role of algorithm 4 is to extract the characteristic information of specific molecular markers in the original sequence data; The SNPs are SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11 and SNP12, which are 12 SNPs: The SNP1 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 42nd nucleotide in SEQ ID NO. 1 in the sequence listing, and the nucleotide is T or C, and the letter Y in SEQ ID No. 1 represents any one of T or C nucleotide; The SNP2 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 104th nucleotide in SEQ ID NO. 5 in the sequence listing, and the nucleotide is T or G, and the letter K in SEQ ID No. 5 represents any one of T or G nucleotide; The SNP3 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 56th nucleotide in SEQ ID NO. 9 in the sequence listing, and the nucleotide is G or A, and the letter R in SEQ ID No. 9 represents any one of G or A nucleotide; The SNP4 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 58th nucleotide in SEQ ID NO. 13 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No. 13 represents any one of A or G nucleotide; The SNP5 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 143rd nucleotide in SEQ ID NO. 17 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No. 17 represents any one of A or G nucleotide; The SNP6 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 86th nucleotide in SEQ ID NO. 21 in the sequence listing, and the nucleotide is T or C, and the letter Y in SEQ ID No. 21 represents any one of T or C nucleotide; The SNP7 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 106th nucleotide in SEQ ID NO. 25 in the sequence listing, and the nucleotide is C or G, and the letter S in SEQ ID No. 25 represents any one of C or G nucleotide; The SNP8 is a SNP in the chloroplast genome of Glycyrrhiza, which is the 80th nucleotide in SEQ ID NO. 29 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No. 29 represents any one of A or G nucleotide; Said SNP9 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 115 of SEQ ID NO.33 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No.33 represents any one of the nucleotides A or G; Said SNP10 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 198 of SEQ ID NO.37 in the sequence listing, and the nucleotide is C or G, and the letter S in SEQ ID No.37 represents any one of the nucleotides C or G; Said SNP11 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 116 of SEQ ID NO.41 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No.41 represents any one of the nucleotides A or G; Said SNP12 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 111 of SEQ ID NO.45 in the sequence listing, and the nucleotide is T or C, and the letter Y in SEQ ID No.45 represents any one of the nucleotides T or C.
2. Application of SNP sites in identifying licorice base species of Glycyrrhiza uralensis, characterized in that: Said SNP site is SNP1; said SNP1 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 42 of SEQ ID NO.1 in the sequence listing, and the nucleotide is T or C, and the letter Y in SEQ ID No.1 represents any one of the nucleotides T or C.
3. Application of SNP site in identifying licorice base species Glycyrrhiza glabra, characterized in that, Said SNP site is SNP2, SNP3, SNP4, SNP5, SNP6; Said SNP2 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 104 of SEQ ID NO.5 in the sequence listing, and the nucleotide is T or G, and the letter K in SEQ ID No.5 represents any one of the nucleotides T or G; Said SNP3 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 56 of SEQ ID NO.9 in the sequence listing, and the nucleotide is G or A, and the letter R in SEQ ID No.9 represents any one of the nucleotides G or A; Said SNP4 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 58 of SEQ ID NO.13 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No.13 represents any one of the nucleotides A or G; Said SNP5 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 143 of SEQ ID NO.17 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID No.17 represents any one of the nucleotides A or G; Said SNP6 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 86 of SEQ ID NO.21 in the sequence listing, and the nucleotide is T or C, and the letter Y in SEQ ID No.21 represents any one of the nucleotides T or C.
4. Application of SNP site in identifying licorice base species Glycyrrhiza inflate, characterized in that, Said SNP site is SNP7, SNP8, SNP9, SNP10, SNP11, SNP12; Said SNP7 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 106 of SEQ ID NO.25 in the sequence listing, and the nucleotide is C or G, and the letter S in SEQ ID NO.25 represents any one of the nucleotides C or G; Said SNP8 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 80 of SEQ ID NO.29 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID NO.29 represents any one of the nucleotides A or G; Said SNP9 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 115 of SEQ ID NO.33 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID NO.33 represents any one of the nucleotides A or G; Said SNP10 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 198 of SEQ ID NO.37 in the sequence listing, and the nucleotide is C or G, and the letter S in SEQ ID NO.37 represents any one of the nucleotides C or G; Said SNP11 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 116 of SEQ ID NO.41 in the sequence listing, and the nucleotide is A or G, and the letter R in SEQ ID NO.41 represents any one of the nucleotides A or G; Said SNP12 is a SNP in chloroplast genome of Glycyrrhiza, which is nucleotide at position 111 of SEQ ID NO.45 in the sequence listing, and the nucleotide is T or C, and the letter Y in SEQ ID NO.45 represents any one of the nucleotides T or C.
5. A method for identifying the original seeds of Glycyrrhiza uralensis, Glycyrrhiza glabra and Glycyrrhiza inflate by using the specific SNP molecular marker in claim 1, characterized in that, Said specific SNP molecular marker is SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11 and SNP12, and the method comprises the following steps: 1) extracting genomic DNA of a sample to be detected; 2) using the genomic DNA as a template, and using the forward and reverse primers corresponding to the SNP molecular marker in claim 2, 3 or 4 to complete PCR amplification, to obtain an amplification product; 3) using the sequencing primer corresponding to the SNP molecular marker to sequence the amplification product by pyrosequencing technology, to obtain a base result at the SNP site, and to determine whether the sample to be detected is Glycyrrhiza, Glycyrrhiza glabra or Glycyrrhiza inflate. 4) when the pyrosequencing result of the amplification product at position 42 of SEQ ID NO. 1 is only base T, it can be determined that only liquorice is present in the detection sample; when the pyrosequencing result of the amplification product at position 104 of SEQ ID NO. 5, or position 56 of SEQ ID NO. 9, or position 58 of SEQ ID NO. 13, or position 143 of SEQ ID NO. 17, or position 86 of SEQ ID NO. 21 is only base T, G, A, A, T, respectively, it can be determined that only glabrous liquorice is present in the detection sample; when the pyrosequencing result of the amplification product at position 106 of SEQ ID NO. 25, or position 80 of SEQ ID NO. 29, or position 115 of SEQ ID NO. 33, or position 198 of SEQ ID NO. 37, or position 116 of SEQ ID NO. 41, or position 111 of SEQ ID NO. 45 is only base C, A, A, C, A, T, respectively, it can be determined that only inflated liquorice is present in the detection sample.
6. The method of claim 5, wherein, The forward and reverse primers corresponding to the SNP molecular markers SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11 and SNP12 are respectively: SEQ ID NO. 2 and SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 7, SEQ ID NO. 10 and SEQ ID NO. 11, SEQ ID NO. 14 and SEQ ID NO. 15, SEQ ID NO. 18 and SEQ ID NO. 19, SEQ ID NO. 22 and SEQ ID NO. 23, SEQ ID NO. 26 and SEQ ID NO. 27, SEQ ID NO. 30 and SEQ ID NO. 31, SEQ ID NO. 34 and SEQ ID NO. 35, SEQ ID NO. 38 and SEQ ID NO. 39, SEQ ID NO. 42 and SEQ ID NO. 43, SEQ ID NO. 46 and SEQ ID NO.
47.
7. The method of claim 5, wherein, The sequencing primers corresponding to the SNP molecular markers SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11 and SNP12 are respectively: SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 12, SEQ ID NO. 16, SEQ ID NO. 20, SEQ ID NO. 24, SEQ ID NO. 28, SEQ ID NO. 32, SEQ ID NO. 36, SEQ ID NO. 40, SEQ ID NO. 44, SEQ ID NO. 48.
Citation Information
Patent Citations
Multi-species feature selection and unknown gene identification methods
CN106446597A
Molecular marker and primer for identifying stress resistance of flood-resistant arbors and screening method of molecular marker and primer
CN115948594A