Optimized protein linkers and methods of use

Abstract

The present invention relates to peptide linkers and fusion proteins comprising linkers designed to optimize the activity of the proteins comprised therein, and methods for using the same. The present invention further relates to a newly designed cytosine base editor based on Cas12a.

Description

[0001] This application is a divisional application of the invention patent application with application date of July 17, 2020, application number 202080064288.2, and invention name “Optimized protein connector and use method”.

[0002] Statement Regarding Electronic Submission of Sequence Listings

[0003] In lieu of a paper copy, a sequence listing in ASCII text format is provided, filed in accordance with 37 CFR §1.821, named 1499-6WO_ST25.txt, 727,526 bytes in size, generated on July 17, 2020, and submitted via EFS-Web. This sequence listing is hereby incorporated herein by reference in the specification with respect to its disclosure.

[0004] Priority Declaration

[0005] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 62 / 876,275, filed on July 19, 2019, the entire contents of which are incorporated herein by reference. Field of the Invention

[0006] The present invention relates to peptide linkers and fusion proteins comprising linkers designed to optimize the activity of proteins contained therein, and methods for using the same. The present invention further relates to newly designed cytosine base editors based on Cas12a. Background of the Invention

[0007] In the past six years, gene editing tools based on CRISPR (especially those based on Cas9) have become increasingly popular. Although early tools rely on the ability of Cas9 to generate blunt-ended double-strand breaks in DNA and double-strand break repair mechanisms such as homologous recombination and non-homologous end joining, newer methods have been developed, which mainly use a modified version of the nuclease as a targeting tool for other covalently linked effector proteins. It is worth noting that the first Cas9-based base editor has been developed by connecting Cas9 to the deaminase domain (see, for example, Gaudelli et al., Nature 551:464-471 (2017)). The initial cytosine base editor was established by connecting rat APOBEC1 domains (apolipoprotein B mRNA editing enzymes) (which deaminate cytosine to uracil in both RNA and DNA) to the N-terminus of Cas9 using a connector based on previously published unstructured XTEN proteins (Komor et al., Nature 533 (7603):420-424 (2016)). A uracil-DNA glycosylase inhibitor (UGI) domain was attached to the C-terminus of Cas9 to reduce base excision repair activity. Later versions of the Cas9 cytosine base editor (CBE) doubled the length of both linkers by adding flexible glycine and serine residues and added additional UGI domains. The most recent version of this base editor has been optimized for use in human cells through codon optimization and improved nuclear localization signals and ancestral reconstruction of the deaminase domain.

[0008] Cas12a (also known as Cpf1) is a more recently discovered CRISPR endonuclease that has also been increasingly used as a genome editing tool. Cas12a is different from Cas9 in several aspects, including, for example, its size, its nuclease activity, the structure of the guide RNA (guide RNA), the orientation taken by the nuclease in conjunction with its guide RNA and the original spacer adjacent motif (PAM) identified. Although some changes in cytosine base editors based on Cas12a have been tested, they have lower activity compared to versions based on Cas9. Therefore, in order to overcome the shortcomings in this area, it is necessary to use a new adenosine base editing tool using Cas12a. SUMMARY OF THE INVENTION

[0009] The CRISPR-based cytosine base editors of the prior art are heavily based on Cas9, and the published versions of the cytosine base editors based on Cas12a are relatively ineffective compared to the versions based on Cas9. Part of this defect may be due to the different structures and binding orientations of Cas12a compared to Cas9. The cytosine base editors based on Cas9 rely on simple GS connectors or previously designed unstructured sequences, and their length and composition have been designed for the optimal arrangement of the deaminase and UGI domains relative to the edited DNA. In addition, the base editors derived from Cas12a have not yet reached an activity level suitable for commercial applications. The inventors have designed novel connector sequences and optimized domain architectures for cytosine base editors based on Cas12a, which can now allow targeting of new sites and / or expansion of the reservoir of site-specific base editing tools, and / or it can be suitable for commercial use. Also provided is a method for modifying nucleic acids using the fusion protein of the present invention and / or the polynucleotide encoding it. These editors can be used for prokaryotic and / or eukaryotic applications, including editing the genomes of commercially relevant crop plants.

[0010] One aspect of the present invention provides a polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1-24 (L1-L24).

[0011] A second aspect of the present invention provides a polypeptide comprising a Cas12a domain and any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0012] A third aspect of the present invention provides a fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0013] A fourth aspect provides a V-type clustered regularly interspaced short palindromic repeats (Clustered Regularly Interspaced Short Palindromic Repeats; CRISPR)-associated (Cas) (CRISPR-Cas) system, comprising: (a) a fusion protein comprising a Cas12a domain, a linker comprising an amino acid sequence of any one of SEQ ID NOs: 1-24, and a polypeptide of interest, wherein the Cas12a domain is connected to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24; or a nucleic acid encoding the fusion protein; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA, gRNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein, and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, whereby the system is capable of modifying or regulating the target nucleic acid.

[0014] A fifth aspect of the present invention provides a fusion protein comprising: (a) a Cas12a domain, wherein when associated with a bound guide nucleic acid (e.g., gRNA), the Cas12a domain specifically binds to a target nucleic acid sequence; (b) a cytidine deaminase domain, wherein when associated with the Cas12a domain and the gRNA, the cytidine deaminase domain deaminates cytosine bases in the single-stranded portion of the target nucleic acid sequence; and (c) a uracil glycosylase inhibitor (UGI) domain, wherein the UGI domain inhibits uracil-DNA glycosylase, wherein the Cas12a domain is connected to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0015] A sixth aspect provides a fusion protein comprising: (a) a cytosine deaminase domain; (b) a Cas12a domain; and (c) a uracil-DNA glycosylase inhibitor (UGI) domain, wherein the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, and the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain, or the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-9, and the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain.

[0016] A seventh aspect provides a fusion protein comprising: (a) a Cas12a (Cpf1) domain; (b) a uracil-DNA glycosylase inhibitor (UGI) domain; and (c) a cytosine deaminase domain, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 10-12, and the C-terminus of the UGI domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, wherein the amino acid sequences of SEQ ID NOs: 10-12 and 13-16 are independently selected.

[0017] An eighth aspect provides a fusion protein comprising: (a) a uracil-DNA glycosylase inhibitor (UGI) domain; (b) a Cas12a (Cpf1) domain, wherein the Cas12a domain comprises a mutation in the nuclease active site; and (c) a cytosine deaminase domain, wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain, or wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20-24.

[0018] A ninth aspect of the invention provides a method for modifying a target nucleic acid, the method comprising contacting the target nucleic acid with: (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid; (b) a complex comprising the fusion protein of the invention and the guide nucleic acid; (c) a composition comprising the fusion protein of the invention and the guide nucleic acid; and / or (d) a system of the invention, thereby modifying the target nucleic acid.

[0019] The tenth aspect of the present invention provides a method for modifying a target nucleic acid, the method comprising contacting a cell or a cell-free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a polypeptide or fusion protein of the present invention, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and / or (b) a nucleic acid construct encoding a complex comprising the fusion protein of the present invention and the guide nucleic acid, or an expression cassette or vector comprising the same, under certain conditions, thereby modifying the target nucleic acid, the conditions being conditions wherein when the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizes with the target nucleic acid.

[0020] An eleventh aspect of the invention provides a method for editing a target nucleic acid, the method comprising contacting the target nucleic acid with: (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid; (b) a complex comprising the fusion protein of the invention and a guide nucleic acid; (c) a composition comprising (i) the fusion protein of the invention and (ii) a guide nucleic acid; and / or (d)(i) a system of the invention, wherein the cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to produce a (point) mutation.

[0021] The twelfth aspect of the present invention provides a method for editing a target nucleic acid, the method comprising contacting a cell or a cell-free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a fusion protein of the present invention, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and / or (b) a nucleic acid construct encoding a complex comprising the fusion protein of the present invention and the guide nucleic acid, or an expression cassette or vector comprising the same, under certain conditions, wherein when the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizes with the target nucleic acid, wherein the cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to produce a (point) mutation.

[0022] The present invention further provides constructs, complexes, compositions, expression cassettes, vectors and cells comprising the polypeptides and / or fusion proteins of the present invention, and / or polynucleotides and nucleic acid constructs encoding the fusion proteins and complexes of the present invention.

[0023] These and other aspects of the invention are set forth in more detail in the following description of the invention.

[0024] Sequence Description

[0025] SEQ ID NOs: 1-24 are amino acid sequences of the present invention useful for linking polypeptides.

[0026] SEQ ID NOs: 25-28 are amino acid sequences of exemplary peptide linkers useful for linking polypeptides.

[0027] SEQ ID NOs: 29-45 are exemplary Cas12a amino acid sequences that can be used in the present invention.

[0028] SEQ ID NOs: 46-47 and SEQ ID NOs: 76-82 are exemplary cytosine deaminase amino acid sequences that can be used in the present invention.

[0029] SEQ ID NO: 48 is an exemplary uracil-DNA glycosylase inhibitor (UGI).

[0030] SEQ ID NOs: 49-72 and SEQ ID NOs: 91-107 are exemplary fusion proteins.

[0031] SEQ ID NOs: 83-88 are exemplary spacer sequences.

[0032] SEQ ID NO: 89 and SEQ ID NO: 90 are exemplary intron sequences of human and soybean, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 AC provides exemplary domain arrangements of Cas12a-based cytosine base editors of the present invention that were selected for experimental screening in mammalian cells. Figure 1 A(ACU) and Figure 1 For constructs in C(UCA), each linker to APOBEC1 or UGI was tested independently and paired with a control linker (8-residue GS linker, XTEN linker, or GS-XTEN-GS linker). Figure 1 For constructs in B (CUA), all combinations of linkers were tested.

[0034] Figure 2 Two Cas12a cytosine base editor designs are provided for use as illustrations.

[0035] Figure 3 Shown are the results of C to T editing using EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0036] Figure 4 Shown are the results of C to T editing using RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0037] Figure 5 Results are shown for C to T editing using RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data were available for constructs UCA_L2_1, UCA_L2_1R, UCA_L2_4, CUA control, or ShanghaiTech control.

[0038] Figure 6 Shown are the results of C to T editing using DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0039] Figure 7 Results for C to T editing using DNMT1 spacer 2: GCTCAGCAGGCACCTGCCTCAGC (SEQ ID NO: 87) are shown. The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data were available for construct ACU_L1_1.

[0040] Figure 8 Shown are the results of C to T editing using EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0041] Figure 9 Shown are the results of C to T editing using RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84).

[0042] Figure 10 Results for C to T editing using DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86) are shown. The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data were available for constructs ACU_L1_2, ACU_L2_2R.

[0043] Figure 11 Shown are the results of C to T editing using DNMT1 spacer 2: GCTCAGCAGGCACCTGCCTCAGC (SEQ ID NO: 87). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0044] Figure 12 Shown are the results of C to T editing using EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0045] Figure 13 Shown are the results of C to T editing using RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0046] Figure 14 Results are shown for C to T editing using RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data were available for constructs ACU_L1_1, ACU_L1_2, ACU_L1_3, ACU_L1_3R, ACU_L1_5R, CUA_L1_3_L2_1, UCA_L1_1, UCA_L2_1, UCA_L2_1R, and UCA_L2_4.

[0047] Figure 15Shown are the results of C to T editing using AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0048] Figure 16 Shown are the results of C to T editing using DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0049] Figure 17 Shown are the results of C to T editing using EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0050] Figure 18 Shown are the results of C to T editing using RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0051] Figure 19 Shown are the results of C to T editing using AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0052] Figure 20 Results for C to T editing using DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86) are shown. The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data were available for construct ACU_L1_2 (A3A).

[0053] Figure 21 Shown are the results of C to T editing using EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0054] Figure 22 Shown are the results of C to T editing using AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0055] Figure 23 Results for C to T editing using RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84) are shown. The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data (ND) is available for construct UC_L2_1 (A3A+intron) and the ACU control.

[0056] Figure 24 Results for C to T editing using RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85) are shown. The Y axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer. No editing data (ND) was available for construct UC_L2_4.

[0057] Figure 25 Shown are the results of C to T editing using DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C->T editing observed for a given cytosine at a specific position within the spacer.

[0058] Figure 26 Shown are the results of using the editor constructs of the invention to edit three different nucleic acid targets (Locus 1, Locus 2, Locus 3) in soybean, as described in Example 4. Detailed Description of the Invention

[0059] The present invention will now be described hereinafter with reference to the accompanying drawings and examples (in which embodiments of the present invention are shown). This description is not intended to be a detailed catalog of all the different ways in which the present invention can be implemented or all the features that can be added to the present invention. For example, the features illustrated for one embodiment may be incorporated into other embodiments, and the features illustrated for a particular embodiment may be deleted from that embodiment. Therefore, the present invention contemplates that in some embodiments of the present invention, any feature or combination of features set forth herein may be excluded or omitted. In addition, in view of this disclosure, the numerous changes and additions to the various embodiments suggested herein will be apparent to those skilled in the art and do not depart from the present invention. Therefore, the following description is intended to illustrate some particular embodiments of the present invention, rather than to exhaustively describe in detail all permutations, combinations, and variations thereof.

[0060] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the description of the invention herein are for describing particular embodiments only and are not intended to be limiting of the invention.

[0061] All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0062] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein may be used in any combination. Furthermore, the present invention contemplates that, in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted. For purposes of illustration, if the specification states that a composition comprises components A, B, and C, it is specifically intended that any one of A, B, or C, or any combination thereof, may be omitted or disclaimed, individually or in any combination.

[0063] As used in the description of the invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0064] Furthermore, as used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the conjoined listed items, as well as the lack of any combination, when interpreted in the alternative ("or").

[0065] As used herein, when referring to a measurable value such as an amount or concentration, the term "about" is meant to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified value as well as the specified value. For example, "about X" (where X is a measurable value) means including X, as well as variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of X. Ranges provided herein for measurable values ​​may include any other ranges and / or individual values ​​therein.

[0066] As used herein, phrases such as "between X and Y" and "between approximately X and Y" should be interpreted to include X and Y. As used herein, phrases such as "between approximately X and Y" mean "between approximately X and approximately Y," and phrases such as "from about X to Y" mean "from about X to about Y."

[0067] As used herein, the terms “comprises,” “comprising,” and “includes” specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0068] As used herein, the transitional phrase "consisting essentially of" means that the scope of a claim will be interpreted to encompass the specified materials or steps recited in the claim, as well as those that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term "consisting essentially of" is not intended to be interpreted as equivalent to "comprising."

[0069] As used herein, the terms "increase" and "enhance" (and grammatical variations thereof) describe an improvement of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more compared to a control.

[0070] As used herein, the terms "reduce," "decrease," and "reduce" (and grammatical variations thereof) describe, for example, a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% relative to a control. In particular embodiments, the decrease can result in no or substantially no (i.e., an insignificant amount, e.g., less than about 10% or even 5%) detectable activity or amount.

[0071] A "heterologous" or "recombinant" nucleotide sequence is a nucleotide sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleotide sequence.

[0072] A "native" or "wild-type" nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence. Thus, for example, a "wild-type mRNA" is an mRNA that occurs naturally in or is endogenous to an organism. A "homologous" nucleic acid sequence is a nucleotide sequence that is naturally associated with the host cell into which it is introduced.

[0073] As used in this article, the terms "nucleic acid," "nucleic acid molecule," "nucleotide sequence," and "polynucleotide" refer to linear or branched, single-stranded or double-stranded RNA or DNA, or a hybrid thereof. The term also encompasses RNA / DNA hybrids. When synthetically producing dsRNA, less common bases (e.g., inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and others) can also be used for antisense dsRNA and for pairing with ribozymes. For example, polynucleotides comprising C-5 propyne analogs of uridine and cytidine have been shown to bind RNA with high affinity and are powerful antisense inhibitors of gene expression. Other modifications, such as modifications of the phosphodiester backbone of RNA or the 2'-hydroxyl group in the ribose group, can also be performed.

[0074] As used in this article, term " nucleotide sequence " refers to the heteropolymer of nucleotide, or the order of these nucleotides from 5 ' to 3 ' ends of nucleic acid molecule, and comprises DNA or RNA molecule, comprises cDNA, DNA fragmentation or part, genomic DNA, synthetic (for example, chemically synthesized) DNA, plasmid DNA, mRNA and antisense RNA, any of which can be single-stranded or double-stranded.Term " nucleotide sequence ", " nucleic acid ", " nucleic acid molecule ", " oligonucleotide " and " polynucleotide " also can be used interchangeably in this article, to refer to the heteropolymer of nucleotide.Nucleic acid molecule and / or nucleotide sequence provided in this article are presented from left to right with 5 ' to 3 ' direction in this article, and are represented using the standard code for representing nucleotide characters, as set forth in U.S. sequence rule 37CFR§§1.821-1.825 and World Intellectual Property Organization (WIPO) standard ST.25.As used in this article, " 5 ' district " can mean the region of the polynucleotide of 5 ' ends closest to polynucleotide. As used herein, "3' district" refers to a region of a polynucleotide that is closest to the 3' end of a polynucleotide. As used herein, "3' district" refers to a region of a polynucleotide that is closest to the 3' end of a polynucleotide. As used herein, "3' district" refers to a region of a polynucleotide that is closest to the 3' end of a polynucleotide. As used herein, "3' district" refers to a region of a polynucleotide that is closest to the 3' end of a polynucleotide.

[0075] As used in this article, term " gene " refers to the nucleic acid molecule that can be used to produce mRNA, antisense RNA, miRNA, anti-microRNA antisense oligodeoxyribonucleotide (AMO) etc.Gene can or can not be used to produce functional protein or gene product.Gene can comprise coding region and non-coding region (for example, intron, regulatory element, promoter, enhancer, terminator sequence and / or 5 ' and 3 ' non-translational region).Gene can be " separation ", it means such nucleic acid, it is in fact or substantially without the component that is usually found associated with this nucleic acid in its native state.Such component comprises other cellular materials, the culture medium from recombinant production and / or the various chemicals used in chemically synthesizing this nucleic acid.

[0076] By way of example, introns useful in the constructs of the present invention include, but are not limited to, SEQ ID NO: 89 or SEQ ID NO: 90.

[0077] The term "mutation" refers to a point mutation (e.g., missense, nonsense, or insertion or deletion of a single base pair resulting in a frameshift), insertion, deletion, and / or truncation. When a mutation is a substitution of one residue within an amino acid sequence for another residue or a deletion or insertion of one or more residues within the sequence, the mutation is typically described by identifying the original residue, followed by the position of the residue within the sequence and the identity of the newly replaced residue.

[0078] As used in this article, the term "complementary" or "complementarity" refers to the natural binding of polynucleotides under permissive salt and temperature conditions by base pairing. For example, the sequence "AGT" (5' to 3') binds to the complementary sequence "TCA" (3' to 5'). The complementarity between two single-stranded molecules can be "partial," where only some nucleotides bind, or it can be complete, where complete complementarity exists between the single-stranded molecules. The degree of complementarity between nucleic acid chains has a significant impact on the efficiency and intensity of hybridization between the nucleic acid chains.

[0079] As used herein, "complement" can mean 100% complementarity to a comparator nucleotide sequence, or it can mean less than 100% complementarity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc., complementarity).

[0080] A "part" or "fragment" of a nucleotide sequence of the present invention will be understood to mean a nucleotide sequence that has a reduced length (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides) relative to a reference nucleic acid or nucleotide sequence and comprises, consists essentially of and / or consists of the following nucleotide sequence. Composition:With reference nucleic acid or nucleotide sequence identical or almost identical (for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) nucleotide sequence of the adjacent nucleotide.When suitable, such nucleic acid fragment or part according to the present invention can be included in the larger polynucleotide of its constituent component.As an example, the repetitive sequence of the guidance nucleic acid of the present invention can include a part for wild-type Cas12a repetitive sequence.

[0081] As used herein with respect to polypeptides, the terms "fragment" or "portion" may refer to a polypeptide that is reduced in length relative to a reference polypeptide and comprises, consists essentially of, and / or consists of an amino acid sequence that is identical or nearly identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the corresponding portion of the reference polypeptide. Where appropriate, such polypeptide fragments may be included in the larger polypeptide of which they are a constituent. In some embodiments, the polypeptide fragment comprises, consists essentially of, or consists of at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 260, 270, 280, 290 or more contiguous amino acid residues of a reference polypeptide.

[0082] Different nucleic acids or proteins with homology are referred to as "homologs" in this article. The term "homolog" includes homologous sequences from the same and other species, and straight homologous sequences from the same and other species." homology" refers to the similarity level (for example, sequence similarity or identity) between two or more nucleic acids and / or amino acid sequences in terms of positional identity percentage. Homology also refers to the concept of similar functional properties among different nucleic acids or proteins. Therefore, the compositions and methods of the present invention further comprise the homologs of nucleotide sequences of the present invention and peptide sequences. As used in this article, "straight homology" refers to the homologous nucleotide sequences and / or amino acid sequences in different species produced from common ancestral genes during species formation. Homologs of the nucleotide sequences of the invention have substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) to the nucleotide sequences of the invention.

[0083] As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are invariant over the entire component (eg, nucleotide or amino acid) alignment window. "Identity" can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology (Lesk, AM, ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM and Griffin, HG, eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

[0084] As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in the linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, "percent identity" can refer to the percentage of identical amino acids in an amino acid sequence compared to a reference polypeptide.

[0085] As used herein, the phrases "substantially identical" or "substantial identity" in the context of two nucleic acid molecules, nucleotide sequences, or protein sequences refers to two or more sequences or subsequences that have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence as measured by using one of the following sequence comparison algorithms or by visual inspection. In some embodiments of the invention, substantial identity exists over a region of contiguous nucleotides of a nucleotide sequence of the invention that is about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 25 nucleotides, about 30 nucleotides to about 40 nucleotides, about 50 nucleotides to about 60 nucleotides, about 70 nucleotides to about 80 nucleotides, about 90 nucleotides to about 100 nucleotides, or more, and any range therein, up to the full length of the sequence. In some embodiments, the nucleotide sequences may be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides). In some embodiments, substantially identical nucleotide or protein sequences perform substantially the same function as the nucleotide sequence (or encoded protein sequence) to which it is substantially identical.

[0086] For sequence comparison, a sequence typically serves as a reference sequence to which a test sequence is compared. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are assigned (if necessary), and sequence algorithm program parameters are assigned. The sequence comparison algorithm then calculates the sequence identity percentage for the test sequence relative to the reference sequence based on the assigned program parameters.

[0087] Optimal alignment of sequences for alignment over a comparison window is well known to those skilled in the art and can be performed by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA (which are known as Wisconsin (A part of Accelrys Inc., San Diego, CA). The "identity score" for an aligned segment of a test sequence and a reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the segment of the reference sequence (e.g., the entire reference sequence or a smaller defined portion of the reference sequence). The percent sequence identity is expressed as the identity score multiplied by 100. Comparison of one or more polynucleotide sequences can be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For the purposes of the present invention, "percent identity" can also be determined by using BLASTX version 2.0 (for translated nucleotide sequences) and BLASTN version 2.0 (for polynucleotide sequences).

[0088] When two nucleotide sequences hybridize to each other under stringent conditions, the two sequences can also be considered to be substantially complementary. In some representative embodiments, two nucleotide sequences that are considered to be substantially complementary hybridize to each other under highly stringent conditions.

[0089] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments, such as Southern and Northern hybridizations, are sequence-dependent and are different under different environmental parameters. A comprehensive guide to nucleic acid hybridization can be found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Chapter 2, Part I, "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York (1993). In general, highly stringent hybridization and wash conditions are selected to be below the thermal melting point (Tf) for the specific sequence at a defined ionic strength and pH. m ) about 5℃.

[0090] T m The temperature at which 50% of the target sequence hybridizes to a perfectly matched probe (under defined ionic strength and pH). Very stringent conditions are chosen to be equal to the T for a particular probe. m An example of stringent hybridization conditions for hybridization of complementary nucleotide sequences having more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide with 1 mg of heparin at 42° C., where hybridization is performed overnight. An example of highly stringent wash conditions is 0.15 M NaCl at 72° C. for approximately 15 minutes. An example of stringent wash conditions is a 0.2×SSC wash at 65° C. for 15 minutes (see, Sambrook (below), for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example of a moderate stringency wash for, for example, a duplex of more than 100 nucleotides is 1×SSC at 45° C. for 15 minutes. An example of a low stringency wash for, for example, a duplex of more than 100 nucleotides is 4-6×SSC at 40° C. for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve a salt concentration of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and a temperature of typically at least about 30°C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Typically, a signal-to-noise ratio of 2x (or higher) compared to that observed for an unrelated probe in a particular hybridization assay indicates that specific hybridization has been detected. Nucleotide sequences that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This can occur, for example, when a copy of a nucleotide sequence is produced using the maximum codon degeneracy allowed by the genetic code.

[0091] Any nucleotide sequence, polynucleotide and / or recombinant nucleic acid construct of the present invention can be codon optimized for expression in any target organism. Codon optimization is well known in the art and involves modifying a nucleotide sequence with respect to codon usage bias using a species-specific codon usage table. The codon usage table is generated based on sequence analysis of the most highly expressed genes of the target organism / species. When the nucleotide sequence is to be expressed in the nucleus, the codon usage table is generated based on sequence analysis of highly expressed nuclear genes of the target species. Modification of the nucleotide sequence is determined by comparing the species-specific codon usage table with the codons present in the native polynucleotide sequence. As is understood in the art, codon optimization of a nucleotide sequence results in a nucleotide sequence that has less than 100% identity to a native nucleotide sequence (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% and any range or value therein), but still encodes a polypeptide that has the same function as the polypeptide encoded by the original native nucleotide sequence. Therefore, in some embodiments of the present invention, the polynucleotides, nucleic acid constructs, expression cassettes and / or vectors of the present invention (which contain / encode polypeptides, fusion proteins, complexes of the present invention, such as Cas12a, polypeptides of interest, cytosine deaminase, linkers) can be codon-optimized for expression in specific species of interest, such as specific plant species, specific bacterial species, specific animal species, etc. In some embodiments, the codon-optimized polynucleotides, nucleic acid constructs, expression cassettes and / or vectors of the invention are about 70% to about 99.9% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100%) identical or more to a polynucleotide, nucleic acid construct, expression cassette and / or vector of the invention that is not codon-optimized.

[0092] In any of the embodiments described herein, the polynucleotides or nucleic acid constructs of the present invention can be operably associated with a variety of promoters or other regulatory elements for expression in the target organism and / or cells of the target organism. Thus, in some embodiments, the expression cassette or vector comprising the polynucleotides or nucleic acid constructs of the present invention can further comprise one or more promoters, enhancers, and / or terminators operably linked to the one or more polynucleotides or nucleic acid constructs.

[0093] As used herein, "operably connected" or "operably associated" means that the elements shown are functionally linked to each other and are generally also physically associated. Thus, as used herein, the terms "operably connected" or "operably associated" refer to nucleotide sequences on a single nucleic acid molecule that are functionally associated. Thus, a first nucleotide sequence that is operably connected to a second nucleotide sequence means the situation when the first nucleotide sequence is placed in a manner that has a functional relationship with the second nucleotide sequence. For example, a promoter is operably associated with a nucleotide sequence if the promoter affects the transcription or expression of the nucleotide sequence. Those skilled in the art will appreciate that a control sequence (e.g., a promoter) does not need to be adjacent to the nucleotide sequence to which it is operably associated, as long as the control sequence functions to direct its expression. Thus, for example, an intervening non-translated (however transcribed) sequence may be present between a promoter and a nucleotide sequence, and the promoter may still be considered to be "operably connected" to the nucleotide sequence.

[0094] As used herein, with respect to polypeptides, the term "linked" refers to the attachment of one polypeptide to another polypeptide. A polypeptide can be linked to another polypeptide (at the N-terminus or C-terminus) directly (e.g., via a peptide bond) or through a linker.

[0095] The term "linker" is recognized in the art and refers to a bond, chemical group or molecule that connects two molecules or parts (e.g., two domains of a fusion protein, such as a Cas12a domain and a nucleic acid editing domain (e.g., cytosine deaminase)). A linker can be composed of a single linker molecule (e.g., an amino acid) or can contain more than one linker molecule. In some embodiments, the linker can be an organic molecule, a group, a polymer or a chemical moiety. In some embodiments, the linker can be an amino acid or peptide linker. In some embodiments, the peptide linker can be about 4, 5 to 100 or more amino acids in length, for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 208, 209 In some embodiments, the linker can comprise the amino acid sequence SGGS (SEQ ID NO: 25), (GGS)n, or S(GGS)n (one or more repeats of SEQ ID NO: 25), wherein n is 1-20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and any range or value therein). In some embodiments, the linker can comprise the amino acid sequence SGGSGGSGGS (SEQ ID NO: 26). In some embodiments, the linker can comprise the amino acid sequence SGSETPGTSESATPES (SEQ ID NO: 27), also referred to as an XTEN linker. In some embodiments, the linker can comprise the amino acid sequence SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO: 28), also referred to as a GS-XTEN-GS linker. In some embodiments, the linker comprises, consists essentially of, or consists of any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0096] "Promoter" is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) that is operably associated with the promoter. The coding sequence controlled or regulated by the promoter can encode a polypeptide and / or functional RNA. Typically, a "promoter" refers to a nucleotide sequence that contains a binding site for RNA polymerase II and directs transcription initiation. Generally speaking, a promoter is found 5' or upstream of the start point of the coding region relative to the corresponding coding sequence. The promoter region may include other elements that act as regulators of gene expression. These include the TATA box consensus sequence, and often, the CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50: 349). In plants, the CAAT box can be replaced by an AGGA box (Messing et al., (1983) Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (editor), Plenum Press, pp. 211-227).

[0097] Promoters can include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and / or tissue-specific promoters for use in preparing recombinant nucleic acid molecules, such as "synthetic nucleic acid constructs" or "protein-RNA complexes." These various types of promoters are known in the art.

[0098] The selection of promoter can depend on the time and space requirement for expression and change, and also can change based on host cell to be transformed.Promoters for many different organisms are well-known in the art.Based on the detailed knowledge existing in this area, suitable promoters can be selected for specific purpose host organisms.Therefore, for example, about the promoters upstream of genes highly constitutively expressed in model organisms, a lot is known, and this type of knowledge can be easily obtained and implemented (when suitable) in other systems.

[0099] In some embodiments, the polynucleotides and / or nucleic acid constructs of the present invention can be or can be contained within an "expression cassette." As used herein, an "expression cassette" refers to a recombinant nucleic acid molecule comprising, for example, a nucleic acid construct of the present invention (e.g., encoding a complex of the present invention (e.g., a fusion protein of the present invention and a guide nucleic acid)), wherein the nucleic acid construct is operably associated with at least one control sequence (e.g., a promoter). Thus, some embodiments of the present invention provide expression cassettes designed to express, for example, a nucleic acid construct of the present invention.

[0100] The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components (e.g., a promoter from a host organism operably linked to a polynucleotide of interest to be expressed in the host organism, wherein the polynucleotide of interest is from an organism different from the host or is not normally found in association with that promoter). The expression cassette may also be one that occurs in nature but has been obtained in a recombinant form useful for heterologous expression.

[0101] The expression cassette optionally can include transcription and / or translation termination region (that is, termination region) and / or enhancer region that function in the selected host cell. Various transcription terminators and / or enhancers are available for use in the expression cassette, and are responsible for the termination of transcription and correct mRNA polyadenylation. Termination region and / or enhancer region can be natural for the transcription initiation region, can be natural for the nucleotide sequence of interest that is operably connected, can be natural for the host cell, or can be from another source (for example, exogenous or heterologous for promoter, nucleotide sequence of interest, host or its any combination).

[0102] The expression cassette of the present invention can also include a nucleotide sequence encoding a selective marker (which can be used to select transformed host cells). As used in this article, a "selective marker" means a nucleotide sequence that, when expressed, gives the host cell expressing the marker a different phenotype, and therefore allows such transformed cells to be distinguished from those without the marker. Such nucleotide sequences can encode selectable or screenable markers, depending on whether the marker imparts a trait that can be selected by chemical means, such as by using a selection agent (e.g., antibiotics, etc.), or depends on whether the marker is only a trait that can be identified by observation or testing, such as by screening (e.g., fluorescence). Many examples of suitable selective markers are known in the art and can be used in expression cassettes described herein.

[0103] In addition to expression cassettes, nucleic acid molecules / constructs and polynucleotide sequences described in this article can also be used in conjunction with vectors. The term "vector" refers to a composition for transferring, delivering or introducing nucleic acid into a cell. A vector comprises a nucleic acid molecule containing a nucleotide sequence to be transferred, delivered or introduced. The vector used in the transformation of host organisms is well known in the art. The non-limiting example of the general class of vectors includes, but is not limited to, viral vectors, plasmid vectors, phage vectors, phagemid vectors, clay vectors, F clay (fosmid) vectors, phage, artificial chromosomes, minicircles or Agrobacterium binary vectors, in double-stranded or single-stranded linear or circular form, which may or may not be self-transmitted or removable. In some embodiments, viral vectors may include, but are not limited to, retroviruses, slow viruses, adenoviruses, adeno-associated viruses or herpes simplex virus vectors. Vectors defined in this article can be transformed prokaryotic or eukaryotic hosts by being integrated into the cell genome or existing (for example, with an autonomously replicating plasmid with a replication origin) outside the chromosome. Also included are shuttle vectors, which mean a DNA carrier that can (naturally or by design) be replicated in two different host organisms, which host organisms can be selected from actinomycetes and related species, bacteria and eukaryotic organisms (e.g., higher plants, mammals, yeast or fungal cells). In some embodiments, the nucleic acid in the vector is under the control of a suitable promoter or other regulatory element for transcription in the host cell and is operably connected thereto. The vector can be a bifunctional expression vector that functions in a variety of hosts. In the case of genomic DNA, this can include its own promoter or other regulatory elements, and in the case of cDNA, this can be under the control of a suitable promoter or other regulatory element for expression in the host cell. Therefore, the polynucleotides of the present invention and nucleic acid constructs and / or expression cassettes comprising them can be included among vectors described herein and known in the art.

[0104] As used herein, "contacting" and grammatical variations thereof refer to placing the components of a desired reaction together under conditions suitable for carrying out the desired reaction (e.g., conversion, transcriptional control, genome editing, gap generation and / or cutting). Thus, for example, a target nucleic acid can be contacted with a fusion protein of the present invention and a guide nucleic acid to modify the target nucleic acid. In some embodiments, a target DNA can be contacted with a polynucleotide or nucleic acid construct encoding a fusion protein of the present invention and a guide nucleic acid under conditions wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, which then hybridizes with the target nucleic acid to modify the target nucleic acid.

[0105] As used herein, "modification" with respect to a target nucleic acid includes editing (e.g., mutation), covalent modification, exchange / substitution of nucleic acid / nucleotide bases, deletion, cleavage, nicking, and / or transcriptional control of the target nucleic acid.

[0106] In the context of a polynucleotide of interest, "introducing" (and grammatical variations thereof) means presenting a nucleotide sequence of interest (e.g., a polynucleotide, a nucleic acid construct, a complex (e.g., a protein-RNA chimeric complex) and / or a guide nucleic acid) to a host organism or a cell of the organism (e.g., a host cell) in such a manner that the nucleotide sequence is able to enter the interior of the cell. Thus, for example, a polynucleotide encoding a fusion protein of the invention and a guide nucleic acid can be introduced into a cell of an organism to transform the cell.

[0107] As used herein, the term "transformation" refers to the introduction of a heterologous nucleic acid into a cell. The transformation of a cell can be stable or transient. Thus, in some embodiments, a host cell or host organism is stably transformed with a nucleotide molecule of the present invention. In other embodiments, a host cell or host organism is transiently transformed with a recombinant nucleic acid molecule of the present invention.

[0108] "Transient transformation" in the context of a polynucleotide means that the polynucleotide is introduced into a cell and does not integrate into the genome of the cell.

[0109] "Stably introduced" in the context of a polynucleotide introduced into a cell means that the introduced polynucleotide is stably incorporated into the genome of the cell and that the cell is thereby stably transformed with the polynucleotide.

[0110] As used herein, "stable transformation" or "stably transformed" means that a nucleic acid molecule is introduced into a cell and integrated into the genome of the cell. Thus, the integrated nucleic acid molecule is capable of being inherited by its progeny, more particularly by multiple successive generations. As used herein, "genome" includes both the nuclear genome and the plastid genome, and therefore includes integration of the nucleic acid into, for example, the chloroplast or mitochondrial genome. As used herein, "stable transformation" also refers to a transgene that is maintained extrachromosomally, for example as a minichromosome or plasmid.

[0111] Transient conversion can be detected by, for example, enzyme-linked immunosorbent assay (ELISA) or Western blotting, which can detect the presence of peptides or polypeptides encoded by one or more transgenics introduced into the organism. The stable conversion of cells can be detected by, for example, Southern blot hybridization assays of the genomic DNA of the cells, which use nucleic acid sequences that specifically hybridize with the nucleotide sequences of the transgenics introduced into the organism (for example, plant). The stable conversion of cells can be detected by, for example, Northern blot hybridization assays of the RNA of the cells, which use nucleic acid sequences that specifically hybridize with the nucleotide sequences of the transgenics introduced into the host organism. The stable conversion of cells can also be detected by, for example, polymerase chain reaction (PCR) or other amplification reactions (as well known in the art), which employ specific primer sequences that hybridize with the target sequence of the transgenics, thereby causing the amplification of the transgenic sequence, which can be detected according to standard methods. Conversion can also be detected by direct sequencing and / or hybridization protocols well known in the art.

[0112] Thus, in some embodiments, the nucleotide sequences, nucleic acid constructs and / or expression cassettes of the invention can be transiently expressed and / or can be stably incorporated into the genome of a host organism. Thus, in some embodiments, a fusion protein of the invention or a polynucleotide encoding the same can be introduced into a cell with a guide nucleic acid, and thus no DNA is maintained in the cell.

[0113] Can be by any method well known by persons skilled in the art nucleic acid construct of the present invention / polynucleotide is introduced into cell.In some embodiments of the present invention, the conversion of cell comprises nuclear transformation.In other embodiments, the conversion of cell comprises plastid transformation (for example, chloroplast transformation).In further embodiment, can be via conventional breeding technology nucleic acid construct of the present invention / polynucleotide is introduced into cell.

[0114] Procedures for transforming both eukaryotic and prokaryotic organisms are well known and routine in the art and are described throughout the literature (see, eg, Jiang et al., 2013. Nat. Biotechnol. 31:233-239; Ran et al., Nature Protocols 8:2281-2308 (2013)).

[0115] In some embodiments, the nucleotide sequence of the present invention is introduced into the host organism or its cell in a manner well known in the art. Method of the present invention does not rely on the specific method for introducing one or more nucleotide sequences into the organism, as long as they are able to enter the inside of at least one cell of the organism. When more than one nucleotide sequence is to be introduced, they can be assembled as a part of a single nucleic acid construct, or as a separate nucleic acid construct, and can be located on the same or different nucleic acid construct. Therefore, nucleotide sequence can be introduced into the target cell in a single transformation event or in a separate transformation event, or alternatively, in the relevant case, nucleotide sequence can be incorporated into the plant, for example, as a part of a breeding protocol.

[0116] The present invention is directed to polypeptides (e.g., SEQ ID NOs: 1-24) that can be used, for example, to link two or more proteins / protein domains. In some embodiments, a polypeptide of the invention can be about 70% to 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) to any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the present invention provides a polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 1-24, and / or a polynucleotide having 70% to 100% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity) to a polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 1-24 can be codon-optimized for expression in an organism.

[0117] The present invention is also intended to comprise the fusion protein of the synthesis of these polypeptides.In some embodiments, the invention provides polypeptide, it comprises any one and the target polypeptide in the amino acid sequence of SEQ ID NO:1-24.In some embodiments, the target polypeptide can be connected to any one in its C-terminal and / or its N-terminal with the amino acid sequence of SEQ ID NO:1-24, optionally at C-terminal and / or N-terminal.In some embodiments, the target polypeptide can comprise two or more target polypeptides (for example, 2,3,4,5,6,7 or more), it can be identical or different, wherein at least two of the two or more target polypeptides can be connected to each other via any one in the amino acid sequence of SEQ ID NO:1-24.

[0118] Polypeptides of interest useful for the present invention can include, but are not limited to, polypeptides or protein domains having the following activities: deaminase (deamination) activity (e.g., cytosine deaminase, adenine deaminase), nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or photolyase activity. In some embodiments, the polypeptide of interest is adenine deaminase, cytosine deaminase, Fok1 nuclease, or uracil-DNA glycosylase inhibitor. In some embodiments, the polynucleotide of interest may be codon-optimized for expression in an organism.

[0119] In some embodiments, the polypeptide of interest is a CRISPR Cas12a polypeptide or a Cas12a domain, wherein the Cas12a is linked at its C-terminus and / or N-terminus to the C-terminus or N-terminus of any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0120] In some embodiments, a fusion protein is provided, which comprises Cas12a, a target polypeptide, and SEQ ID NO: Any one of the amino acid sequences of 1-24. In some embodiments, the amino acid sequence of SEQ ID NO: 1-24 enables Cas12a and one or more (e.g., 1, 2, 3, 4, 5, 6, 7 or more) target polypeptides (e.g., cytosine deaminase domains, glycosylase inhibitors (e.g., uracil-DNA glycosylase inhibitors (UGI)) to be optimally arranged relative to the Cas12a domain. SEQ ID NO: The amino acid sequence of 1-24 can be used to connect Cas12a and the target polypeptide in a manner that allows access to the single-stranded portion of the non-target chain, for example, for nucleic acid modification, such as base editing.

[0121] In some embodiments, when used to connect Cas12a and target polypeptide, SEQ ID NO:1-24 amino acid sequences can provide different windows for modification or editing of nucleic acid.For example, the amino acid sequence of SEQ ID NO:1-24 connecting target polypeptide to Cas12a can provide a window for editing or modification (for example, 1 to about 25 nucleotides from the corresponding PAM (protospacer adjacent motif) in the target nucleic acid (for example, DNA) (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides and any range or value thereof) from PAM. In some embodiments, the editing or modification window can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 to about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides from the PAM (e.g., 1 to 20, 1 to 15, 1 to 10, 3 to 15, 4 to 10, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 7 to 15 nucleotides from the PAM, etc.).

[0122] Cas12a is a V-type clustered regularly spaced short palindromic repeats (CRISPR)-Cas nuclease. Cas12a is different from the more well-known type II CRISPR Cas9 nuclease in several aspects. For example, Cas9 recognizes the protospacer adjacent motif (PAM) (3'-NGG) rich in G at 3' of its guide RNA (gRNA, sgRNA) binding site (protospacer, target nucleic acid, target DNA), while Cas12a recognizes the PAM (5'-ttN, 5'TTTN) rich in T at 5' of target nucleic acid. In fact, Cas9 and Cas12a are very nearly opposite in terms of their N and C-terminal orientation in conjunction with the orientation taken by their guide RNA. Further, Cas12a enzyme uses a single guide RNA (gRNA, CRISPR array, crRNA), rather than the dual guide RNA (sgRNA (e.g., crRNA and tracrRNA)) found in the natural Cas9 system, and Cas12a processes its own gRNA. In addition, Cas12a nuclease activity produces staggered DNA double-strand breaks rather than the blunt ends produced by Cas9 nuclease activity, and Cas12a relies on a single RuvC domain to cleave both DNA strands, while Cas9 utilizes both the HNH domain and the RuvC domain for cleavage.

[0123] CRISPR Cas12a polypeptides or CRISPR Cas12a domains useful for the present invention can be any known or later identified Cas12a nuclease (formerly known as Cpf1) (see, e.g., U.S. Patent No. 9,790,490, which is incorporated by reference for its disclosure of Cpf1 (Cas12a) sequences). The terms "Cas12a," "Cas12a polypeptide," or "Cas12a domain" refer to RNA-guided nucleases comprising a Cas12a polypeptide or a fragment thereof (which comprises a guide nucleic acid binding domain of Cas12a, and / or an active, inactive, or partially active DNA cleavage domain of Cas12a). In some embodiments, the Cas12a useful for the present invention can comprise a mutation in the nuclease active site (e.g., the RuvC site of the Cas12a domain). A Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site and therefore no longer comprising nuclease activity is commonly referred to as deadCas12a (e.g., dCas12a). In some embodiments, a Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site can have impaired activity.

[0124] In some embodiments, the Cas12a domain can include but is not limited to SEQ ID NO: any one of 29-45 (e.g., SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45) amino acid sequence; or a polynucleotide encoding the same. In some embodiments, the fusion protein of the present invention can include a Cas12a domain (e.g., SEQ ID NO: 29) from Lachnospiraceae bacteria ND2006 Cas12a (LbCas12a).

[0125] In some embodiments, the polynucleotides encoding the Cas12a domains can be codon optimized for expression in organisms. Therefore, in some embodiments, the invention provides polynucleotides encoding SEQ ID NOs: 29-45 having at least about 70% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identity) to the amino acid sequence of any one of the polynucleotides.

[0126] In some embodiments, a V-type clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system is provided, the system comprising: (a) a fusion protein comprising a Cas12a domain, a linker comprising any one of the amino acid sequences of SEQ ID NOs: 1-24, and a polypeptide of interest, or a nucleic acid encoding the fusion protein, wherein the Cas12a domain is connected to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein, and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, whereby the system is capable of modifying (e.g., cutting or editing) or regulating (e.g., regulating transcription) the target nucleic acid.

[0127] In some embodiments, a fusion protein is provided, which comprises Cas12a, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24, wherein the polypeptide of interest is a cytosine deaminase polypeptide or domain.

[0128] In some embodiments, the present invention provides a fusion protein comprising: (a) a Cas12a domain, wherein when associated with a bound guide nucleic acid (e.g., gRNA), the Cas12a domain specifically binds to a target nucleic acid sequence; (b) a cytidine deaminase domain, wherein when associated with the Cas12a domain and the gRNA, the cytidine deaminase domain deaminates cytosine bases in the single-stranded portion of the target nucleic acid sequence; and (c) a uracil glycosylase inhibitor (UGI) domain, wherein the UGI domain inhibits uracil-DNA glycosylase, wherein the Cas12a domain is linked to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the N-terminus of the Cas12a domain can be connected to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, the C-terminus of the Cas12a domain can be connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-12, the N-terminus of the cytosine deaminase domain can be connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, the N-terminus of the Cas12a domain can be connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and / or the N-terminus of the cytosine deaminase domain can be connected to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 20-24. In some embodiments, when the N-terminus of the Cas12a domain is connected to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NO: 1-5, the C-terminus of the Cas12a domain can be connected to the UGI domain via a GS connector. In some embodiments, when the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NO: 6-12, the N-terminus of the Cas12a domain can be connected to the cytosine deaminase domain via a GS connector. In some embodiments, when the N-terminus of the Cas12a domain is connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NO: 17-19, the C-terminus of the Cas12a can be connected to the cytosine deaminase via a GS connector.In some embodiments, when the N-terminus of the cytosine deaminase domain is connected to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NO: 20-24, the C-terminus of the Cas12a is connected to the cytosine deaminase via a GS connector. Exemplary fusion proteins of the present invention include, but are not limited to, SEQ ID NO: 49-72 amino acid sequences.

[0129] In some embodiments, a fusion protein is provided, which comprises: (a) a cytosine deaminase domain; (b) a Cas12a domain; and (c) a uracil-DNA glycosylase inhibitor (UGI) domain, wherein the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via SEQ ID NO: Any one of the amino acid sequences of 1-5, and the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain, or the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via SEQ ID NO: Any one of the amino acid sequences of 6-9, and the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain. In some embodiments, the C-terminus of the Cas12a domain can be connected to the N-terminus of the UGI domain via a GS linker. In some embodiments, the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via a GS connector. In some embodiments, the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via the amino acid sequence of SEQ ID NO: 29. Exemplary fusion proteins of the present invention include, but are not limited to, any one of the amino acid sequences of SEQ ID NO: 64-72.

[0130] In some embodiments, a fusion protein is provided, comprising: (a) a Cas12a (Cpf1) domain; (b) a uracil-DNA glycosylase inhibitor (UGI) domain; and (c) a cytosine deaminase domain, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NO: 10-12, and the C-terminus of the UGI domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NO: 13-16, wherein the amino acid sequences of SEQ ID NO: 10-12 and SEQ ID NO: 13-16 are independently selected. Exemplary fusion proteins of the present invention include, but are not limited to, any one of the amino acid sequences of SEQ ID NO: 58-63.

[0131] In some embodiments, a fusion protein is provided, comprising: (a) a uracil-DNA glycosylase inhibitor (UGI) domain; (b) a Cas12a (Cpf1) domain, wherein the Cas12a domain comprises a mutation in the nuclease active site; and (c) a cytosine deaminase domain, wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain, or wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20-24. In some embodiments, the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via a GS connector. In some embodiments, the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via the amino acid sequence of SEQ ID NO:28. In some embodiments, the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via a GS connector. Exemplary fusion proteins of the present invention include, but are not limited to, any one of the amino acid sequences of SEQ ID NO:49-72.

[0132] The cytosine deaminase (or cytidine deaminase) useful for the present invention can be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Patent No. 10,167,457; and Thuronyi et al., Nat. Biotechnol. 37:1070-1079 (2019), each of which is incorporated herein by reference for its disclosure of cytosine deaminases. A cytosine deaminase can catalyze the hydrolytic deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. In some embodiments, the deaminase polypeptide or deaminase domain is a cytidine deaminase domain that catalyzes the hydrolytic deamination of cytosine to uracil. In some embodiments, the cytosine deaminase can be a variant of a naturally occurring cytosine deaminase, including but not limited to primates (e.g., humans, In some embodiments, the cytosine deaminase useful in the present invention can be about 70% to 100% identical to a wild-type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a naturally occurring cytosine deaminase, and any range or value therein). In some embodiments, the polynucleotide encoding the cytosine deaminase polypeptide / domain can be codon-optimized for expression in an organism.

[0133] In some embodiments, the cytosine deaminase useful in the present invention can be an apolipoprotein B mRNA editing complex (APOBEC) family deaminase. In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, an APOBEC4 deaminase, a human activation-induced deaminase (hAID), rAPOBEC1, FERNY and / or CDA1, optionally pmCDA1, atCDA1 (e.g., At2g19570) and / or an evolved version thereof. In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase having the amino acid sequence of SEQ ID NO: 46. In some embodiments, the cytosine deaminase can be an APOBEC3A deaminase having the amino acid sequence of SEQ ID NO: 47. In some embodiments, a cytosine deaminase useful for the present invention can be about 70% to 100% identical to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical). In some embodiments, a cytosine deaminase useful for the present invention can be about 70% to 99.5% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO: 46 or SEQ ID NO: 47 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO: 46 or SEQ ID NO: 47). In some embodiments, a polynucleotide encoding a cytosine deaminase can be codon-optimized for expression in an organism, and the codon-optimized polypeptide can be about 70% to 99.5% identical to a reference polynucleotide.

[0134] A "uracil glycosylase inhibitor" useful for the present invention can be any protein capable of inhibiting uracil-DNA glycosylase base excision repair enzyme. In some embodiments, the UGI domain comprises wild-type UGI or a fragment thereof. In some embodiments, the UGI domain useful for the present invention can be about 70% to 100% identical to the amino acid sequence of a naturally occurring UGI domain (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical, and any range or value therein). In some embodiments, the UGI domain can comprise the amino acid sequence of SEQ ID NO:48, or a polypeptide having about 70% to 99.5% identity to the amino acid sequence of SEQ ID NO:48 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:48). For example, in some embodiments, the UGI domain can comprise a fragment of the amino acid sequence of SEQ ID NO: 48 that is 100% identical to a portion of contiguous nucleotides (e.g., 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 contiguous nucleotides; e.g., about 10, 15, 20, 25, 30, 35, 40, 45 to about 50, 55, 60, 65, 70, 75, 80 contiguous nucleotides) of the amino acid sequence of SEQ ID NO: 48. In some embodiments, the UGI domain can be a variant of a known UGI (e.g., SEQ ID NO: 48) having 70% to 99.5% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity, and any range or value therein) to the known UGI. In some embodiments, the polynucleotide encoding the UGI can be codon-optimized for expression in an organism, and the codon-optimized polynucleotide can be approximately 70% to 99.5% identical to the reference polynucleotide.

[0135] The fusion protein of the present invention comprising the Cas12a domain connected with the purpose polypeptide described in this article can be used in combination with the guide RNA (gRNA, CRISPR array, CRISPR RNA, crRNA) designed to play a function together with the Cas12a domain, to modify the target nucleic acid. The guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) useful for the present invention includes a spacer sequence and repetitive sequence. The guide nucleic acid can form a complex with the Cas12a domain of the fusion protein, and the spacer sequence can hybridize with the target nucleic acid, so that the Cas12a domain and the purpose polypeptide are guided to the target nucleic acid, wherein the target nucleic acid is modified (for example, cutting or editing) or regulated (for example, regulating transcription) by the purpose polypeptide of the fusion protein. As an example, the fusion protein comprising the Cas12a domain connected with the cytosine deaminase domain described in this article can be used in combination with Cas12a guide nucleic acid to modify the target nucleic acid, wherein the cytosine deaminase domain of the fusion protein deaminates the cytosine base in the target nucleic acid, so as to edit the target nucleic acid.

[0136] As used herein, "guide nucleic acid", "guide RNA", "gRNA", "CRISPR RNA / DNA", "crRNA" or "crDNA" means a nucleic acid comprising at least one spacer sequence complementary to (and hybridizing with) a target DNA (e.g., a protospacer), and at least one repetitive sequence (e.g., a repetitive sequence of a V-type Cas12a CRISPR-Cas system, or a fragment or portion thereof), wherein the repetitive sequence is connected to the 5' end of the spacer sequence. The design of the gRNA of the present invention is based on the V-type Cas12a CRISPR-Cas system. In some embodiments, the gRNA for Cas12a may include (from 5' to 3'): a repetitive sequence (full length or a portion thereof (" handle "); for example, a pseudoknot-like structure); and a spacer sequence. In some embodiments, the guide nucleic acid can comprise more than one repeat-spacer sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeat-spacer sequences) (e.g., repeat-spacer-repeat; e.g., repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer, etc.). The guide nucleic acids of the invention are synthetic, artificial, and not found in nature. The gRNA can be quite long and can be used as an aptamer (e.g., in an MS2 recruitment strategy) or other RNA structure suspended from a spacer.

[0137] As used in this article, " repetitive sequence " refers to, for example, any repetitive sequence of wild-type CRISPR Cas12a locus or the repetitive sequence of the crRNA synthesized. Repetitive sequence useful for the present invention can be the repetitive sequence of any known or later identified CRISPR Cas12a locus (V type), or it can be designed to be the repetitive sequence of the synthesis that functions in V type CRISPR-Cas system. Repetitive sequence can include hairpin structure and / or stem-loop structure. In some embodiments, repetitive sequence can form pseudoknot-like structure (that is, " handle ") at its 5 ' end. Therefore, in some embodiments, repetitive sequence can be identical or substantially identical (for example, at least 70% identical) with the repetitive sequence from wild-type V type CRISPR locus. The repetitive sequence from wild-type Cas12a (V type) CRISPR locus can be determined by established algorithm, for example, using CRISPRfinder provided by CRISPRdb (see Grissa et al., Nucleic Acids Res.35 (Web Server issue): W52-7). In some embodiments, the repeat sequence or a portion thereof is linked to the 5' end of the spacer sequence, thereby forming a repeat sequence-spacer sequence (eg, guide RNA, crRNA).

[0138] In some embodiments, the repeat sequence comprises, consists essentially of, or consists of at least 10 nucleotides, depending on the particular repeat sequence and whether the guide RNA comprising it is processed or unprocessed (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 to 100 or more nucleotides, or any range or value therein). In some embodiments, the repetitive sequence comprises, consists essentially of, or consists of about 10 to about 20, about 10 to about 30, about 10 to about 45, about 10 to about 50, about 15 to about 30, about 15 to about 40, about 15 to about 45, about 15 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 40 to about 80, about 50 to about 100, or more nucleotides.

[0139] The repetitive sequence connected to the 5' end of the spacer sequence can include a portion of the repetitive sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more adjacent nucleotides of the wild-type repetitive sequence). In some embodiments, the length of the portion of the repetitive sequence connected to the 5' end of the spacer sequence can be about five to about ten consecutive nucleotides (e.g., about 5, 6, 7, 8, 9, 10 nucleotides) and has at least 90% identity (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the same region (e.g., 5' end) of the wild-type Cas12a repeat nucleotide sequence. In some embodiments, a portion of the repeat sequence comprises a pseudoknot-like structure (eg, a "handle") at its 5' end.

[0140] As used in this article, "spacer sequence" is a nucleotide sequence that is complementary to a target nucleic acid (e.g., target DNA) (e.g., a protospacer). The spacer sequence can be completely complementary to the target nucleic acid or substantially complementary (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)). Therefore, in some embodiments, the spacer sequence can have one, two, three, four or five mispairings compared to the target nucleic acid, and the mispairings can be contiguous or non-contiguous. In some embodiments, the spacer sequence can have 70% complementarity with the target nucleic acid. In other embodiments, the spacer nucleotide sequence can have 80% complementarity with the target nucleic acid.In other embodiments, the spacer nucleotide sequence can have 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% complementarity with the target nucleic acid (protospacer), etc. In some embodiments, the spacer sequence is 100% complementary to the target nucleic acid. The spacer sequence can have a length of about 15 nucleotides to about 30 nucleotides (for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, or any range or value therein). Therefore, in some embodiments, the spacer sequence can have complete complementarity or substantial complementarity in the region of the target nucleic acid (for example, protospacer) of at least about 15 nucleotides to about 30 nucleotides in length. In some embodiments, the length of the spacer is about 20 nucleotides. In some embodiments, the spacer is about 23 nucleotides in length.

[0141] In some embodiments, the 5' region of the spacer sequence of the guide RNA can be identical to the target DNA, while the 3' region of the spacer can be substantially identical to the target DNA, and thus the total complementarity of the spacer sequence to the target DNA can be less than 100%. Thus, for example, the first 1, 2, 3, 4, 5, 6, 7, 8, etc. nucleotides (i.e., the seed region) in the 5' region of a spacer sequence having, for example, 20 nucleotides can be 100% complementary to the target DNA, while the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 70% complementary). In some embodiments, the first 1 to 8 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8 nucleotides, and any range therein) of the 5' end of the spacer sequence can be 100% complementary to the target DNA, while the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 50% complementary (e.g., 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)). In some embodiments, the seed region of the spacer can be about 5 to 6 nucleotides in length. In some embodiments, the seed region of the spacer is 5 nucleotides in length. In some embodiments, the seed region of the spacer is 6 nucleotides in length.

[0142] As used herein, "target nucleic acid," "target DNA," "target nucleotide sequence," "target region," or "target region in a genome" refers to a region of the genome of an organism that is fully complementary (100% complementary) or substantially complementary (e.g., at least 70% complementary (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)) to a spacer sequence in a guide RNA of the invention. Target regions useful for the CRISPR-Cas12a system are located immediately 3' to the PAM sequence in the genome of an organism. The target region can be selected from any of at least 15 consecutive nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides, etc.) immediately adjacent to the PAM sequence.

[0143] "Protospacer sequence" refers to a target double-stranded DNA, and specifically refers to that portion of a target DNA (e.g., a target region in a genome) that is completely or substantially complementary (and hybridized) to a spacer sequence of a CRISPR repeat-spacer sequence (e.g., a guide RNA, a CRISPR array, a crRNA). In the case of a V-type CRISPR-Cas Cas12a system, the protospacer sequence is flanked by (immediately adjacent to) a protospacer adjacent motif (PAM). The PAM is located at the 5' end on the non-target strand and the 3' end of the target strand (as an example, see below).

[0144]

[0145] The canonical Cas12a PAM is T-rich. In some embodiments, the canonical Cas12a PAM sequence can be 5'-TTN, 5'-TTTN, or 5'-TTTV. In some embodiments, a non-canonical PAM can be used, but it may be less efficient.

[0146] Other PAM sequences can be determined by those skilled in the art by established experiments and computational methods.Therefore, for example, experimental methods include targeting sequences flanked by all possible nucleotide sequences, and identifying sequence members that do not undergo targeting, such as by conversion of target plasmid DNA (Esvelt et al., 2013.Nat.Methods 10:1116-1121; Jiang et al., 2013.Nat.Biotechnol.31:233-239). In some aspects, computational methods can include performing a BLAST search of natural spacers to identify the original target DNA sequence in phage or plasmid, and aligning these sequences to determine the conserved sequence adjacent to the target sequence (Briner and Barrangou.2014.Appl.Environ.Microbiol.80:994-1001; Mojica et al., 2009.Microbiology 155:733-740).

[0147] In some embodiments, a complex or composition is provided, which comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or more) fusion proteins of the present invention and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or more) guide nucleic acids (e.g., CRISPR RNA / DNA, such as crRNA / crDNA). In some embodiments, a polynucleotide or nucleic acid construct is provided, which encodes a polypeptide, fusion protein, guide nucleic acid and / or complex of the present invention. In some embodiments, a nucleic acid construct, expression cassette and / or vector is provided, which comprises a polynucleotide and / or one or more guide nucleic acids of the present invention. In some embodiments, the polynucleotide encoding the fusion protein of the present invention can be encoded on a polynucleotide, nucleic acid construct, expression cassette or vector that is the same as or separate from the polynucleotide comprising the guide nucleic acid. When the fusion protein is encoded on a polynucleotide, nucleic acid construct, expression cassette or vector that is separate from the polynucleotide comprising the guide nucleic acid, the polynucleotide, nucleic acid construct, expression cassette or vector encoding the fusion protein of the present invention can be provided before, simultaneously with, or after providing the guide nucleic acid (e.g., contacting with a target nucleic acid).

[0148] In some embodiments, the polynucleotides, nucleic acid constructs, expression cassettes and / or vectors of the present invention can be codon-optimized for expression in an organism. In some embodiments, the optimized polynucleotides, nucleic acid constructs or expression cassettes of the present invention can be about 70% to 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) to the polynucleotides, nucleic acid constructs or expression cassettes encoding the polypeptides, fusion proteins and complexes of the present invention.

[0149] In some embodiments, cells are provided that comprise one or more polynucleotides, guide nucleic acids, nucleic acid constructs, expression cassettes, or vectors of the invention.

[0150] The polypeptides, fusion proteins, guide RNAs, complexes and compositions of the present invention, and the polynucleotides / nucleic acid constructs / expression cassettes / vectors encoding the same, can be used to modify a target nucleic acid and / or its expression.

[0151] In some embodiments, the fusion protein of the present invention is a cytosine base editor (ABE) for use in base editing a target nucleic acid, wherein the fusion protein comprises a Cas12a domain connected to a cytosine deaminase domain.

[0152] In some embodiments, a method of modifying a target nucleic acid is provided, comprising contacting the target nucleic acid with: (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA); (b) a complex comprising a fusion protein of the invention and a guide nucleic acid; (c) a composition comprising a fusion protein of the invention and a guide nucleic acid; and / or (d) a system of the invention, thereby modifying the target nucleic acid. The target nucleic acid can be contacted with the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0153] In some embodiments, a method for modifying a target nucleic acid is provided, comprising contacting the target nucleic acid with a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 and a guide nucleic acid. The target nucleic acid can be contacted with a fusion protein of the invention before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0154] In some embodiments, a method of modifying a target nucleic acid is provided, the method comprising contacting a cell or cell-free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a polypeptide of the invention or a fusion protein of the invention, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, and / or an expression cassette or vector comprising the same; and / or (b) a nucleic acid construct encoding a complex comprising a fusion protein of the invention and a guide nucleic acid, and / or an expression cassette or vector comprising the same, under conditions wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, wherein the complex hybridizes to the target nucleic acid. When provided on separate constructs, the target nucleic acid may be contacted with the polynucleotide, nucleic acid construct, expression cassette or vector encoding the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0155] In some embodiments, a method of modifying a target nucleic acid is provided, the method comprising contacting a cell or cell-free system comprising the target nucleic acid with: a polynucleotide encoding a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 50-78, or an expression cassette or vector comprising the same; and a guide nucleic acid, or an expression cassette or vector comprising the same, under conditions wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing to the target nucleic acid. When provided on separate constructs, the target nucleic acid can be contacted with the polynucleotide, nucleic acid construct, expression cassette or vector encoding the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0156] In some embodiments, the invention provides a method of editing a target nucleic acid, comprising contacting the target nucleic acid with: (a) (i) a fusion protein of the invention, and (a) (ii) a guide nucleic acid; (b) a complex comprising a fusion protein of the invention and a guide nucleic acid; (c) a composition comprising (i) a fusion protein of the invention and (ii) a guide nucleic acid; and / or (d) (i) a CRISPR-Cas system of the invention, wherein the cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a (point) mutation. The target nucleic acid can be contacted with the fusion protein of the invention before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0157] In some embodiments, a method for editing a target nucleic acid is provided, comprising contacting the target nucleic acid with a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 and a guide nucleic acid, thereby editing the target nucleic acid. The target nucleic acid can be contacted with a fusion protein of the invention before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0158] In some embodiments, a method of editing a target nucleic acid is provided, the method comprising contacting a cell or cell-free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a fusion protein of the invention, and / or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, and / or an expression cassette or vector comprising (a)(i) and / or (a)(ii); and / or (b) a nucleic acid construct encoding a complex comprising a fusion protein of the invention and a guide nucleic acid, or an expression cassette or vector comprising the same, under conditions wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing to the target nucleic acid, wherein the cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a (point) mutation. When provided on separate constructs, the target nucleic acid may be contacted with the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0159] In some embodiments, a method for editing a target nucleic acid is provided, the method comprising contacting a cell or cell-free system comprising the target nucleic acid with the following items under certain conditions: a polynucleotide encoding a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72, or an expression cassette or vector comprising the same; and a guide nucleic acid, or an expression cassette or vector comprising the same, thereby editing the target nucleic acid, the conditions being conditions wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing with the target nucleic acid. The polynucleotide encoding the fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 may be present on the same expression cassette or vector comprising the guide nucleic acid. When the polynucleotide encoding the fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 is on an expression cassette or vector separate from the polynucleotide comprising the guide nucleic acid, the target nucleic acid may be contacted with the expression cassette / vector comprising the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the expression cassette / vector comprising the guide nucleic acid.

[0160] In some embodiments, the present invention provides methods for editing target domains / polypeptides useful for base editing that can be used with the present invention. As used herein, "cytosine deaminase" and "cytidine deaminase" refer to a polypeptide or its domain that catalyzes or can catalyze the deamination of cytosine, because the polypeptide or domain catalyzes or can catalyze the removal of amino groups from cytosine bases. Therefore, cytosine deaminase can cause cytosine to be converted into thymidine (via uracil intermediates), thereby causing C to T conversion in the genome, or G to A conversion (in complementary chains). Therefore, in some embodiments, the cytosine deaminase encoded by the polynucleotides of the present invention generates C→T conversion in the sense (e.g., "+"; template) chain of the target nucleic acid, or generates G→A conversion in the antisense (e.g., "-", complementary) chain of the target nucleic acid. In some embodiments, the cytosine deaminase encoded by the polynucleotides of the present invention generates C to T or G to A conversion (in complementary chains) in the genome.

[0161] The cytosine deaminase useful for the present invention can be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Patent No. 10,167,457; and Thuronyi et al., Nat. Biotechnol. 37:1070-1079 (2019), each of which is incorporated herein by reference for its disclosure of cytosine deaminases. A cytosine deaminase can catalyze the hydrolytic deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. Thus, in some embodiments, a deaminase or deaminase domain useful for the present invention can be a cytidine deaminase domain that catalyzes the hydrolytic deamination of cytosine to uracil. In some embodiments, a cytosine deaminase can be a naturally occurring cytosine deaminase. Variants of pyrimidine deaminases include, but are not limited to, primates (e.g., humans, monkeys, chimpanzees, gorillas), dogs, cows, rats, or mice. Thus, in some embodiments, a cytosine deaminase useful for the present invention can be about 70% to about 100% identical to a wild-type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a naturally occurring cytosine deaminase, and any range or value therein).

[0162] In some embodiments, the cytosine deaminase useful in the present invention can be an apolipoprotein B mRNA editing complex (APOBEC) family deaminase. In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, an APOBEC4 deaminase, a human activation-induced deaminase (hAID), rAPOBEC1, FERNY and / or CDA1, optionally pmCDA1, atCDA1 (e.g., At2g19570), and an evolved version thereof. In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase, which optionally has the amino acid sequence of SEQ ID NO: 46 or SEQ ID NO: 79. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase, which optionally has the amino acid sequence of SEQ ID NO: 47. In some embodiments, the cytosine deaminase may be a CDA1 deaminase, optionally a CDA1 having the amino acid sequence of SEQ ID NO: 76. In some embodiments, the cytosine deaminase may be a FERNY deaminase, optionally a FERNY having the amino acid sequence of SEQ ID NO: 77 or SEQ ID NO: 80. In some embodiments, the cytosine deaminase may be an hAID deaminase, optionally a hAID having the amino acid sequence of SEQ ID NO: 81 or SEQ ID NO: 82. In some embodiments, a cytosine deaminase useful for the present invention can be about 70% to about 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., an "evolved deaminase") (see, e.g., SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82).In some embodiments, a cytosine deaminase useful for the present invention can be about 70% to about 99.5% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, or SEQ ID NO:82 (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical). NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, or SEQ ID NO:82. In some embodiments, the polynucleotide encoding the cytosine deaminase may be codon-optimized for expression in plants, and the codon-optimized polypeptide may be about 70% to 99.5% identical to the reference polynucleotide.

[0163] The fusion proteins of the present invention and the polynucleotides and nucleic acid constructs encoding the same can be used in combination with guide nucleic acids to modify target nucleic acids, including but not limited to generating C→T or G→A mutations in target nucleic acids (including but not limited to plasmid sequences); generating C→T or G→A mutations in coding sequences to change amino acid identity; generating C→T or G→A mutations in coding sequences to generate stop codons; generating C→T or G→A mutations in coding sequences to disrupt start codons; generating point mutations in genomic DNA to disrupt transcription factor binding; generating point mutations in genomic DNA to disrupt splice junctions; and / or other nucleic acid modifications generated by fusion proteins comprising a Cas12a domain fused to other domains (polypeptides of interest) via any one of the amino acid sequences SEQ ID NOs: 1-24 (e.g., peptide linkers).

[0164] The fusion proteins of the present invention and the polynucleotides and nucleic acid constructs encoding the same can be useful for modifying target nucleic acids of any organism, including but not limited to animals, plants, fungi, archaea or bacteria. Animals can include but are not limited to mammals, insects, fish, birds, etc.

[0165] Exemplary mammals for which the present invention may be useful include, but are not limited to, primates (human and non-human (e.g., chimpanzee, baboon, monkey, gorilla, etc.)), cats, dogs, mice, rats, ferrets, gerbils, hamsters, cows, pigs, horses, goats, donkeys, or sheep.

[0166] Fusion proteins of the present invention and the polynucleotides and nucleic acid constructs encoding them can be used to modify the target nucleic acid of any plant or plant part. In implementing the present invention, any plant (or plant groups grouped into, for example, genus or higher order categories) can be adopted, including angiosperms, gymnosperms, monocots, dicots, C3, C4, CAM plants, bryophytes, ferns and / or pseudoferns, microalgae, and / or macroalgae. Plants and / or plant parts useful for the present invention can be plants or plant parts of any plant species / variant / cultivar. As used in this article, the term "plant part" includes but is not limited to embryos, pollen, ovules, seeds, leaves, stems, seedlings, flowers, branches, fruits, grains, ears, cobs, shells, stalks, roots, root tips, anthers, plant cells (including complete plant cells in plants and / or plant parts), plant protoplasts, plant tissues, plant cell tissue cultures, plant callus, plant masses, etc. As used in this article, "seedling" refers to the above-ground parts including leaves and stems. Further, as used herein, "plant cell" refers to the structural and physiological unit of a plant, which includes a cell wall and may also refer to a protoplast. A plant cell may be in the form of an isolated single cell, or may be a cultured cell, or may be part of a higher organized unit (e.g., a plant tissue or plant organ).

[0167] The fusion proteins of the present invention and the polynucleotides and nucleic acid constructs encoding the same can be used to modify (eg, base edit, cleave, create gaps, etc.) target nucleic acids in any plant or plant part.Non-limiting examples of plants useful for the present invention include: lawn grasses (e.g., bluegrass, bentgrass, ryegrass, fescue), feather reed grass, hairgrass, miscanthus, reed, switchgrass, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), yellow taro, melons (e.g., cantaloupe, watermelon, Cranberry, honeydew melon, cantaloupe), brassica crops (e.g., Brussels sprouts, , cabbage, cauliflower, Brussels sprouts, kale, collard greens, Chinese cabbage, bok choy), cardoons, carrots, Chinese cabbage (napa), okra, onions, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, summer squash, winter squash, pumpkin, honeydew melon, watermelon, cantaloupe), radish, bulb onions, rutabagas, eggplant, salsify, endive, shallots, escarole, Garlic, spinach, green onions, winter squash, leafy greens, beets (sugar beets and fodder beets), sweet potatoes, chard, horseradish, tomatoes, turnips, and spices; fruit crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quinces, figs, nuts (e.g., chestnuts, pecans, pistachios, hazelnuts, pistachios, peanuts, walnuts, macadamia nuts, almonds, etc.), citrus fruits (e.g., clementines, clementines, kumquats, oranges, grapefruits, tangerines, mandarins, lemons, limes, etc.), blueberries, black raspberries, boysenberries, cranberries, currants, gooseberries, loganberries, raspberries, strawberries, blackberries, grapes (wine and table), avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pomegranates, melons, mangoes, papayas, and lychees, field crops such as clover, alfalfa, timothy, evening primrose, meadow grass, foam), corn / maize (field corn, sweet corn, popcorn), hops, jojoba, buckwheat, safflower, quinoa, wheat, rice, barley, rye, millet, sorghum, oats, triticale, sorghum, tobacco, kapok, legumes (legumes (e.g., common and dry beans), lentils, peas, soybeans), oilseed plants (rape, canola, mustard, opium, olives, sunflower, coconut, castor oil plant, cocoa beans, peanuts, oil palm), duckweed, Arabidopsis psis), fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or plants such as coffee, sugar cane, tea and natural rubber plants; and / or bedding plants such as flowering plants, cacti, succulents and / or ornamental plants (e.g., roses, tulips, violets), as well as trees such as forest trees (broadleaf trees and evergreen trees, such as conifers; for example, elm, ash, oak, maple, fir, spruce, cedar, pine, birch, cypress, eucalyptus, willow), as well as shrubs and other nursery trees.In some embodiments, the fusion proteins of the invention and polynucleotides and nucleic acid constructs encoding the same can be used to modify maize, soybean, wheat, canola, rice, tomato, pepper, sunflower, raspberry, blackberry, black raspberry, and / or cherry.

[0168] The present invention further includes kits for practicing the methods of the present invention. The kits of the present invention may contain reagents, buffers, and apparatus for mixing, measuring, sorting, labeling, etc., as well as instructions, etc., as will be suitable for modifying target nucleic acids.

[0169] In some embodiments, the present invention provides a kit comprising one or more polypeptides of the present invention, one or more fusion proteins of the present invention, one or more polynucleotides encoding one or more fusion proteins of the present invention, the CRISPR-Cas system of the present invention and / or an expression cassette or vector comprising the same, and optional instructions for use thereof. In some embodiments, the kit may further comprise: Cas12a guide nucleic acid and / or an expression cassette or vector comprising the same. In some embodiments, the guide nucleic acid can be provided on an expression cassette or vector identical to the polynucleotide encoding the fusion protein of the present invention.

[0170] Thus, in some embodiments, a kit is provided comprising a nucleic acid construct comprising: (a) a polynucleotide encoding a fusion protein as provided herein; and (b) a promoter driving expression of the polynucleotide of (a). In some embodiments, the kit may further comprise a nucleic acid construct encoding a guide nucleic acid, wherein the construct comprises a cloning site for cloning a nucleic acid sequence identical or complementary to a target nucleic acid sequence into the backbone of the guide nucleic acid.

[0171] In some embodiments, the polypeptide of the kit may further comprise one or more nuclear localization signals fused to the fusion protein, or a polynucleotide encoding the same. In some embodiments, the polynucleotide of the kit may further encode one or more selectable markers useful for identifying transformants (e.g., nucleic acids encoding antibiotic resistance genes, herbicide resistance genes, etc.). In some embodiments, the polynucleotide may be mRNA, which may encode one or more introns within the encoded fusion protein.

[0172] The present invention will now be described with reference to the following examples. It should be appreciated that these examples are not intended to limit the scope of the claims of the present invention, but are intended to serve as illustrations of certain embodiments. Any variations in the illustrated methods that may occur to a skilled artisan are intended to fall within the scope of the present invention. Example

[0173] Example 1

[0174] Although some variations of Cas12a-based cytosine base editors have been tested, they have lower activity than Cas9-based versions. All tested variants use the same set of linkers (GS linker, XTEN linker, and GS-XTEN-GS linker) used in Cas9-based cytosine base editors, and none of them have been rationally or computationally optimized using structure-based techniques. Therefore, we sought to develop optimized Cas12a-based cytosine base editors by designing optimal linker lengths and sequences for various domain configurations based on the ideal arrangement of rAPOBEC1 and UGI domains.

[0175] Initial fusion protein designs used Lachnospiraceae ND2006 Cas12a (LbCas12a) (e.g., SEQ ID NO: 29) due to its lower temperature sensitivity and demonstrated activity in plant cells; however, due to the high level of structural similarity between different Cas12a endonucleases, these designs should be extended to Cas12a enzymes from other species (e.g., Acidaminococcus sp. Cpf1 (AsCpf1), Francisella novicida Cpf1 (FnCpf1), and others, see, e.g., SEQ ID NOs: 30-45).

[0176] Using a structure-based approach, we developed several linker sequences designed to enable the optimal placement of the cytosine deaminase domain relative to Cas12a so that they would be able to access the single-stranded portion of the non-target chain for base editing. We also designed the linker sequence to ensure that the UGI domain is positioned so that it can bind uracil-DNA glycosylase without interfering with other components of the base editor. Due to the arrangement of the ends of Cas12a and the orientation of its guide RNA, the ideal linkers for these arrangements are significantly different from the prior art linkers used in Cas9 CBE and published versions of Cas12a-based CBE. These linkers are designed to accommodate several possible base editor domain configurations, in which the deaminase domain is connected to either end of Cas12a. Exemplary designed linkers are provided in Table 1.

[0177] Table 1. Exemplary linkers

[0178]

[0179]

[0180] To test the effectiveness of each designed linker sequence (including length, flexibility, and susceptibility to proteases), constructs were generated containing each linker sequence in a specific configuration in a vector for expression in mammalian cells. Figure 1 The domain arrangements of the Cas12a-based cytosine base editors selected for experimental screening are provided in AC, and exemplary sequences generated for testing include SEQ ID NOs: 49-72.

[0181] In having Figure 1 A and Figure 1 In the case of the constructs with the domain arrangement illustrated in C, the linkers to APOBEC1 and UGI are independent of each other with respect to Cas12a; therefore, they are placed in separate constructs and paired with length-matched control linkers (8-residue GS, XTEN, or GS-XTEN-GS). Figure 1 Since both linkers potentially affect the position of the deaminase, all combinations of designed linkers were tested. Two previously tested Cas12a cytosine base editor designs were used as controls ( Figure 2 ).

[0182] Following screening in mammalian cells, the most efficient linkers for each construct were selected for testing in stable plant transformation (eg, soybean).

[0183] Example 2

[0184] HEK293T cell testing

[0185] HEK293T cells (human cell line) were seeded into collagen-coated 48-well plates (Corning) in the absence of antibiotics and using DMEM (Dulbecco's modified Eagle's medium) culture medium. At 70-80% confluence, cells were transfected with 1.5 μL of Lipofectamine 3000 (ThermoFisher Scientific) using 750 ng of base editor plasmid and 250 ng of guide RNA plasmid according to the manufacturer's experimental protocol. After 3 days, the cells were lysed and transfected using MagMax TM DNA was extracted using a DNA extraction kit (Applied Biosystems).

[0186] All constructs listed in Table 1 were tested in a total of four experiments in HEK293T cells as described above. Figure 3-20The results for each of the four experiments are provided in . The percentages in Tables 2-5 indicate the maximum amount of C->T editing observed at any one base in the indicated spacer.

[0187] exist Figure 3-20 In the table, constructs are listed on the X-axis, where each bar for a given construct represents editing at a single cytosine within the editing window, as described in the legend. The Y-axis indicates the editing level observed for each cytosine within the window. The error bars represent the standard deviation between multiple experiments for the same construct and guidance. When error bars are not present, only one set of measurements was obtained. For some constructs and spacers (as indicated in the table as "ND = No Data"), editing efficiency was not determined.

[0188] The designed linkers, particularly in the ACU configuration, showed improved editing efficiency relative to the control construct.

[0189] The spacer sequence is as follows:

[0190] EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83)

[0191] RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84)

[0192] RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85)

[0193] DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86)

[0194] DNMT1 spacer 2: GCTCAGCAGGCACCTGCCTCAGC (SEQ ID NO: 87)

[0195] AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88)

[0196] Table 2: Initial editing results for Cas12a CBE constructs as Apobec1 fusions

[0197]

[0198] Table 3: Initial editing results for the remaining Cas12a CBE constructs as Apobec1 fusions

[0199]

[0200]

[0201] Table 4: Repeated editing results for Cas12a CBE constructs

[0202]

[0203] Table 5: Repeated editing results for the remaining Cas12a CBE constructs

[0204]

[0205]

[0206] *This construct was tested as a fusion to A3A (not Apobec1).

[0207] Example 3

[0208] Additionally, a subset of designs, along with three control constructs, were tested as fusions to human A3A, a highly active deaminase previously shown to enable efficient cytosine base editing. To stabilize these constructs, introns were included in the sequence of A3A. Two additional constructs, UCA_L2_2R and UCA_L2_4, were too unstable to be purified as Apobec1 fusions without introns and are therefore shown here as fusions to Apobec1 containing introns in the coding region. Figure 21-25 , the Y-axis indicates the C to T editing efficiency achieved at each of the cytosines indicated by the legend, and the constructs are listed on the X-axis, where each cytosine within the spacer is depicted by a different bar. When "ND" is indicated, it means that no data were collected for the specified sample and spacer.

[0209] In Table 6 below and in Figure 21-25 Results for this example are provided in Table 6. The percentages in Table 6 indicate the maximum amount of C->T editing observed at any one base in the indicated spacer.

[0210] Table 6

[0211]

[0212] *A3A=APOBEC3A

[0213] Example editor constructACU_L1_5R A3A (HCF version): SEQ ID NOs: 91, 93 ACU_L1_5RA3A (soybean version): SEQ ID NOs: 92, 94 ACU_L1_2A3A (HCF version): SEQ ID NOs: 95, 96 ACU_L1_3RA3A (HCF version): SEQ ID NOs: 97, 98 UCA_L2_1A3A (HCF version): SEQ ID NOs: 99, 100 CUA control: SEQ ID NO: 101 ACU control: SEQ ID NO: 102

[0214] Shanghai Tech control: SEQ ID NO: 103

[0215] ACU control A3A (HCF version): SEQ ID NO: 104, 105 UCA_L2_2R (Apobec1+intron): SEQ ID NO: 106 UCA_L2_4 (Apobec1+intron): SEQ ID NO: 107 Example 4

[0216] R-SODA Experimental Protocol

[0217] For the rapid stable soybean assay (R-SODA), rehydrated dried soybean explants were infiltrated with Agrobacterium tumefaciens containing a plasmid encoding the appropriate construct and guide cassette in its T-DNA using ultrasonic treatment. The explants were co-cultured with Agrobacterium tumefaciens for four days and transferred to selective medium. They were then cultured on selective medium for four weeks and the seedlings were collected for screening. The editing in each sampled seedling was assessed using next generation sequencing.

[0218] Using the editor constructs of the present invention (ACU_L1_5R(A3A), ACU_L1_5R, ACU_L1_2), three different nucleic acid targets in soybean (locus 1, locus 2, locus 3) were edited. The results are shown in Figure 26 middle.

[0219] The above description illustrates the present invention and should not be construed as limiting the present invention. The present invention is defined by the following claims, with equivalents of the claims to be included therein.

[0220] Some embodiments of the present invention are as follows:

[0221] 1. A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0222] 2. The polypeptide of embodiment 1, further comprising a polypeptide of interest and any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0223] 3. A polypeptide comprising a Cas12a domain and any one of the amino acid sequences of SEQ ID NO: 1-24.

[0224] 4. A fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0225] 5. The polypeptide of embodiment 3 or the fusion protein of embodiment 4, wherein the Cas12a domain comprises a mutation in the nuclease active site.

[0226] 6. The fusion protein of embodiment 4 or embodiment 5, wherein the Cas12a domain is connected to any one of the amino acid sequences of SEQ ID NO: 1-24 at its C-terminus and / or its N-terminus.

[0227] 7. The fusion protein of any one of embodiments 4 to 6, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of any one of the amino acid sequences of SEQ ID NO: 1-24, and the C-terminus of any one of the amino acid sequences of SEQ ID NO: 1-24 is connected to the N-terminus of the polypeptide of interest.

[0228] 8. The fusion protein of any one of embodiments 4 to 6, wherein the N-terminus of the Cas12a domain is connected to the C-terminus of any one of the amino acid sequences of SEQ ID NO: 1-24, and the N-terminus of any one of the amino acid sequences of SEQ ID NO: 1-24 is connected to the C-terminus of the polypeptide of interest.

[0229] 9. The polypeptide of embodiment 2 or the fusion protein of any one of embodiments 4 to 8, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having the following activities: deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity and / or photolyase activity.

[0230] 10. The polypeptide of embodiment 2 or embodiment 3 or the fusion protein of any one of embodiments 4 to 8, wherein the polypeptide of interest comprises a cytosine deaminase domain.

[0231] 11. The polypeptide of any one of embodiments 2, 3 or 10, or the fusion protein of any one of embodiments 4 to 10, wherein the polypeptide of interest comprises a uracil-DNA glycosylase inhibitor (UGI).

[0232] 12. The polypeptide of embodiment 10 or embodiment 11, or the fusion protein of embodiment 10 or embodiment 11, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

[0233] 13. A polynucleotide encoding the polypeptide of any one of embodiments 1 to 3, 5 or 9 to 12 or the fusion protein of any one of embodiments 4 to 12.

[0234] 14. The polynucleotide of embodiment 13, wherein the polynucleotide is codon-optimized for expression in an organism.

[0235] 15. The polynucleotide of embodiment 14, wherein the organism is a mammal, a plant, a fungus, an archaea or a bacterium.

[0236] 16. A complex comprising the fusion protein of any one of embodiments 4 to 9, and a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA).

[0237] 17. A complex comprising the fusion protein of any one of embodiments 10 to 12, and a guide nucleic acid.

[0238] 18. A nucleic acid construct encoding the complex of embodiment 16 or embodiment 17.

[0239] 19. A composition comprising the polypeptide of any one of embodiments 1 to 3, 5, or 9-12, or the fusion protein of any one of embodiments 4 to 12, and a guide nucleic acid.

[0240] 20. An expression cassette or vector comprising the polynucleotide of any one of embodiments 13 to 15 or the nucleic acid construct of embodiment 18.

[0241] 21. A V-type clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system comprising:

[0242] (a) a fusion protein comprising a Cas12a domain, a linker comprising an amino acid sequence of any one of SEQ ID NOs: 1-24, and a polypeptide of interest, wherein the Cas12a domain is connected to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24; or a nucleic acid encoding the fusion protein; and

[0243] (b) a guide nucleic acid comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein, and the spacer sequence is capable of hybridizing with a target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, whereby the system is capable of modifying (e.g., cutting or editing) or regulating (e.g., regulating transcription) the target nucleic acid.

[0244] 22. The system of embodiment 21, wherein the Cas12a domain comprises a mutation in the nuclease active site.

[0245] 23. The system of embodiment 21 or embodiment 22, wherein the Cas12a domain is linked to any one of the amino acid sequences of SEQ ID NOs: 1-24 at its C-terminus and / or its N-terminus.

[0246] 24. The system of any one of embodiments 21 to 23, wherein the Cas12a domain is connected to the N-terminus of the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24 through its C-terminus.

[0247] 25. The system of any one of embodiments 21 to 23, wherein the Cas12a domain is connected to the C-terminus of the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24 through its N-terminus.

[0248] 26. The system of any one of embodiments 21 to 25, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or photolyase activity.

[0249] 27. The system of any one of embodiments 21 to 26, wherein the polypeptide of interest comprises a cytosine deaminase domain.

[0250] 28. The system of any one of embodiments 21 to 27, further comprising a second polypeptide of interest, wherein the second polypeptide of interest is a uracil-DNA glycosylase inhibitor (UGI).

[0251] 29. The system of embodiment 27 or embodiment 28, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

[0252] 30. The system of any one of embodiments 21 to 29, wherein (a) and (b) are comprised in one or more expression cassettes and / or vectors.

[0253] 31. A cell comprising the polynucleotide of any one of embodiments 13 to 15, the nucleic acid construct of embodiment 16, the expression cassette or vector of embodiment 20, or the system of any one of embodiments 21 to 30.

[0254] 32. A method for modifying a target nucleic acid, comprising contacting the target nucleic acid with:

[0255] (a)(i) the fusion protein of any one of embodiments 4 to 12, and (a)(ii) a guide nucleic acid;

[0256] (b) the complex of embodiment 16 or 17, and a guide nucleic acid;

[0257] (c) a complex comprising the fusion protein of any one of embodiments 4 to 12 and a guide nucleic acid; and / or

[0258] (d) the system of any one of embodiments 21 to 29,

[0259] The target nucleic acid is thereby modified.

[0260] 33. A method for modifying a target nucleic acid, comprising contacting a cell or a cell-free system comprising the target nucleic acid with:

[0261] (a)(i) a polynucleotide encoding the polypeptide of embodiment 3 or embodiment 5 or the fusion protein of any one of embodiments 4 to 12, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and / or

[0262] (b) a nucleic acid construct encoding the complex of embodiment 16 or embodiment 17, or an expression cassette or vector comprising the same,

[0263] thereby modifying the target nucleic acid,

[0264] The conditions are those wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, and the complex hybridizes to the target nucleic acid.

[0265] 34. A method of editing a target nucleic acid comprising contacting the target nucleic acid with:

[0266] (a)(i) the fusion protein of any one of embodiments 10 to 12, and (a)(ii) a guide nucleic acid;

[0267] (b) The composite of embodiment 17;

[0268] (c) a composition comprising the fusion protein of any one of embodiments 10 to 12 and a guide nucleic acid; and / or

[0269] (d) The system of any one of embodiments 27 to 29,

[0270] The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a mutation (eg, a point mutation).

[0271] 35. A method for editing a target nucleic acid, comprising contacting a cell or cell-free system comprising the target nucleic acid with:

[0272] (a)(i) a polynucleotide encoding the fusion protein of any one of embodiments 10 to 12, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same;

[0273] (b) a nucleic acid construct encoding the complex of embodiment 17, or an expression cassette or vector comprising the same; and / or

[0274] (c) a system according to embodiment 30,

[0275] The conditions are those wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing to the target nucleic acid,

[0276] The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid.

[0277] 36. The method of embodiment 34 or 35, wherein the point mutation is a C→T transition in the sense (e.g., "+"; template) strand of the target nucleic acid, or a G→A transition in the antisense (e.g., "-", complementary) strand of the target nucleic acid.

[0278] 37. A fusion protein comprising:

[0279] (a) a Cas12a domain, wherein the Cas12a domain specifically binds to a target nucleic acid sequence when associated with a bound guide nucleic acid (e.g., gRNA);

[0280] (b) a cytidine deaminase domain, wherein when associated with the Cas12a domain and the gRNA, the cytidine deaminase domain deaminates cytosine bases in the single-stranded portion of the target nucleic acid sequence; and

[0281] (c) a uracil glycosylase inhibitor (UGI) domain, wherein the UGI domain inhibits uracil-DNA glycosylase,

[0282] Wherein the Cas12a domain is connected to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NO: 1-24.

[0283] 38. The fusion protein of embodiment 37, wherein the N-terminus of the Cas12a domain is connected to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-12, the N-terminus of the cytosine deaminase domain is connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, the N-terminus of the Cas12a domain is connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and / or the N-terminus of the cytosine deaminase domain is connected to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 20-24.

[0284] 39. A fusion protein comprising:

[0285] (a) Cytosine deaminase domain;

[0286] (b) a Cas12a domain; and

[0287] (c) uracil-DNA glycosylase inhibitor (UGI) domain,

[0288] wherein the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, and the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain, or

[0289] The C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-9, and the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain.

[0290] 40. A fusion protein comprising:

[0291] (a) Cas12a (Cpf1) domain;

[0292] (b) a uracil-DNA glycosylase inhibitor (UGI) domain; and

[0293] (c) cytosine deaminase domain,

[0294] wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 10-12, and the C-terminus of the UGI domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 13-16.

[0295] 41. A fusion protein comprising:

[0296] (a) Uracil-DNA glycosylase inhibitor (UGI) domain;

[0297] (b) a Cas12a (Cpf1) domain, wherein the Cas12a domain comprises a mutation in the nuclease active site; and

[0298] (c) cytosine deaminase domain,

[0299] wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain, or

[0300] wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20-24.

[0301] 42. The fusion protein of any one of embodiments 37 to 41, wherein the Cas12a domain comprises a mutation in the nuclease active site.

[0302] 43. The fusion protein of any one of embodiments 37 to 42, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

[0303] 44. The fusion protein of embodiment 43, wherein the APOBEC domain is a rat or human APOBEC domain, optionally wherein the rat APOBEC domain is the amino acid sequence of SEQ ID NO: 46, and / or the APOBEC domain is the amino acid sequence of SEQ ID NO: 47.

[0304] 45. The fusion protein of any one of embodiments 39 or 42 to 44, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via a GS linker, and / or the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via a GS linker.

[0305] 46. ​​The fusion protein of any one of embodiments 41 to 44, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via a GS linker, and / or the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via a GS linker.

[0306] 47. The fusion protein of embodiment 45 or embodiment 46, wherein the GS linker is (GSS)n, S(GGS)n (SEQ ID NO: 25), SGGS (SEQ ID NO: 25), SGGSGGSGGS (SEQ ID NO: 26), SGSETPGTSESATPES (SEQ ID NO: 27) and / or SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO: 28).

[0307] 48. The fusion protein of any one of embodiments 39, 42 to 44 or 47, wherein the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via the amino acid sequence of SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO: 28).

[0308] 49. The fusion protein of any one of embodiments 41 to 44 or 47, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via the amino acid sequence of SGSETPGTSESATPES (SEQ ID NO: 27).

[0309] 50. A polynucleotide encoding the fusion protein of any one of embodiments 37 to 49.

[0310] 51. The polynucleotide of embodiment 50, wherein the polynucleotide is codon-optimized for expression in an organism.

[0311] 52. A complex comprising the fusion protein of any one of embodiments 37 to 49, and a guide nucleic acid.

[0312] 53. A nucleic acid construct encoding the complex of embodiment 52.

[0313] 54. An expression cassette or vector comprising the polynucleotide of embodiment 48 or embodiment 49, or the nucleic acid construct of embodiment 31.

[0314] 55. A cell comprising the polynucleotide of embodiment 50 or embodiment 51, or the nucleic acid construct of embodiment 53, or the expression cassette or vector of embodiment 54.

[0315] 56. A composition comprising the fusion protein of any one of embodiments 37 to 49, and a guide RNA.

[0316] 57. A method of editing a target nucleic acid, comprising contacting the target nucleic acid with:

[0317] (a)(i) the fusion protein of any one of embodiments 37 to 49, and (a)(ii) a guide nucleic acid;

[0318] (b) the composite of embodiment 2; and / or

[0319] (c) the composition of embodiment 56,

[0320] The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a (point) mutation.

[0321] 58. A method for editing a target nucleic acid, comprising contacting a cell or cell-free system comprising the target nucleic acid with:

[0322] (a)(i) the polynucleotide of embodiment 50 or embodiment 51 and (a)(ii) the guide nucleic acid, and / or an expression cassette or vector comprising (a)(i) and / or (a)(ii); and / or

[0323] (b) the nucleic acid construct of embodiment 53, or an expression cassette or vector comprising the same,

[0324] The conditions are those wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing to the target nucleic acid,

[0325] The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a (point) mutation.

[0326] 59. The method of embodiment 57 or 58, wherein the point mutation is a C→T transition in the sense (e.g., "+"; template) strand of the target nucleic acid, or a G→A transition in the antisense (e.g., "-", complementary) strand of the target nucleic acid.

[0327] 60. The method of embodiment 58 or embodiment 59, wherein the guide nucleic acid comprises a repeat sequence and a spacer sequence from 5' to 3', and the spacer sequence is 70% to 100% complementary to the target nucleic acid (protospacer).

[0328] 61. The method of embodiments 58 to 60, wherein the target nucleic acid is adjacent to a protospacer adjacent motif (PAM).

[0329] 62. The method of embodiment 61, wherein the PAM comprises a nucleotide sequence of 5'-TTN, 5'-TTTV or 5'-TTTN.

[0330] 63. A kit comprising the polynucleotide of any one of embodiments 1 to 3 or the fusion protein of any one of embodiments 4 to 12 or 37 to 49, optionally with instructions for its use.

[0331] 64. A kit comprising the polynucleotide of any one of embodiments 13 to 15, 50 or 51 and / or an expression cassette or vector comprising the same, optionally with instructions for its use.

[0332] 65. The kit of embodiment 63 or embodiment 64, further comprising a Cas12a guide nucleic acid and / or an expression cassette or vector comprising the same.

[0333] 66. The kit of embodiment 65, wherein the guide nucleic acid comprises a cloning site for cloning a nucleic acid sequence identical or complementary to a target nucleic acid sequence into the backbone of the guide nucleic acid.

[0334] 67. The kit of embodiments 63 to 66, wherein the polypeptide further comprises one or more nuclear localization signals fused to the fusion protein, or a polynucleotide encoding the same.

[0335] 68. The kit of embodiments 63 to 67, wherein the polynucleotide further encodes one or more selectable markers.

[0336] 69. The kit of embodiments 63 to 68, wherein the polynucleotide is mRNA and encodes one or more introns within the encoded fusion protein.

Claims

1. A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 2-24.

2. The polypeptide of claim 1, further comprising a polypeptide of interest and any one of the amino acid sequences of SEQ ID NOs: 2-24.

3. A polypeptide comprising a Cas12a domain and any one of the amino acid sequences of SEQ ID NO: 2-24.

4. A fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 2-24.

5. the polypeptide of claim 3 or the fusion protein of claim 4, wherein the Cas12a structural domain comprises mutation in nuclease active site.

6. the fusion protein of claim 4 or claim 5, wherein the Cas12a domain is at its C-terminus and / or its N-terminus with SEQ ID NO:Any one of 2-24 amino acid sequences is connected.

7. the fusion protein any one of claim 4 to 6, the C-terminal of the wherein said Cas12a structural domain and SEQ ID NO:2-24 amino acid sequence in any one N-terminal is connected to, and SEQ ID NO:2-24 amino acid sequence in any one C-terminal is connected to the N-terminal of described target polypeptide.

8. the fusion protein of any one of claim 4 to 6, wherein the N-terminus of the Cas12a domain and SEQ ID NO:The C-terminus of any one in 2-24 amino acid sequence is connected, and SEQ ID NO:The N-terminus of any one in 2-24 amino acid sequence is connected to the C-terminus of the polypeptide of interest.

9. The polypeptide of claim 2 or the fusion protein of any one of claims 4 to 8, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having the following activities: deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity and / or photolyase activity.

10. The polypeptide of claim 2 or claim 3 or the fusion protein of any one of claims 4 to 8, wherein the polypeptide of interest comprises a cytosine deaminase domain.

11. The polypeptide of any one of claims 2, 3 or 10, or the fusion protein of any one of claims 4 to 10, wherein the polypeptide of interest comprises a uracil-DNA glycosylase inhibitor (UGI).

12. The polypeptide of claim 10 or claim 11 or the fusion protein of claim 10 or claim 11, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

13. A polynucleotide encoding the polypeptide of any one of claims 1 to 3, 5 or 9 to 12 or the fusion protein of any one of claims 4 to 12.

14. The polynucleotide of claim 13, wherein the polynucleotide is codon-optimized for expression in an organism.

15. The polynucleotide of claim 14, wherein the organism is a mammal, a plant, a fungus, an archaeon, or a bacterium.

16. A complex comprising the fusion protein of any one of claims 4 to 9, and a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA).

17. A complex comprising the fusion protein of any one of claims 10 to 12, and a guide nucleic acid.

18. A nucleic acid construct encoding the complex of claim 16 or claim 17.

19. A composition comprising the polypeptide of any one of claims 1 to 3, 5, or 9-12, or the fusion protein of any one of claims 4 to 12, and a guide nucleic acid.

20. An expression cassette or vector comprising the polynucleotide of any one of claims 13 to 15 or the nucleic acid construct of claim 18.

21. A V-type clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system comprising: (a) a fusion protein comprising a Cas12a domain, a linker comprising an amino acid sequence of any one of SEQ ID NOs: 2-24, and a polypeptide of interest, wherein the Cas12a domain is connected to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 2-24; or a nucleic acid encoding the fusion protein; and (b) a guide nucleic acid comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein, and the spacer sequence is capable of hybridizing with a target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, whereby the system is capable of modifying (e.g., cutting or editing) or regulating (e.g., regulating transcription) the target nucleic acid.

22. The system of claim 21, wherein the Cas12a domain comprises a mutation in a nuclease active site.

23. The system of claim 21 or claim 22, wherein the Cas12a domain is connected to any one of the amino acid sequences of SEQ ID NO:2-24 at its C-terminus and / or its N-terminus.

24. The system of any one of claims 21 to 23, wherein the Cas12a domain is connected to the N-terminus of the polypeptide of interest via any one of the amino acid sequences of SEQ ID NO: 2-24 via its C-terminus.

25. The system of any one of claims 21 to 23, wherein the Cas12a domain is connected to the C-terminus of the polypeptide of interest via any one of the amino acid sequences of SEQ ID NO: 2-24 via its N-terminus.

26. The system of any one of claims 21 to 25, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or photolyase activity.

27. The system of any one of claims 21 to 26, wherein the polypeptide of interest comprises a cytosine deaminase domain.

28. The system of any one of claims 21 to 27, further comprising a second polypeptide of interest, wherein the second polypeptide of interest is a uracil-DNA glycosylase inhibitor (UGI).

29. The system of claim 27 or claim 28, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

30. The system of any one of claims 21 to 29, wherein (a) and (b) are contained in one or more expression cassettes and / or vectors.

31. A cell comprising the polynucleotide of any one of claims 13 to 15, the nucleic acid construct of claim 16, the expression cassette or vector of claim 20, or the system of any one of claims 21 to 30.

32. A method for modifying a target nucleic acid, comprising contacting the target nucleic acid with: (a)(i) the fusion protein of any one of claims 4 to 12, and (a)(ii) a guide nucleic acid; (b) the complex of claim 16 or 17, and a guide nucleic acid; (c) a complex comprising the fusion protein of any one of claims 4 to 12 and a guide nucleic acid; and / or (d) The system of any one of claims 21 to 29, The target nucleic acid is thereby modified.

33. A method for modifying a target nucleic acid, comprising contacting a cell or a cell-free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding the polypeptide of claim 3 or claim 5 or the fusion protein of any one of claims 4 to 12, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and / or (b) a nucleic acid construct encoding the complex of claim 16 or claim 17, or an expression cassette or vector comprising the same, thereby modifying the target nucleic acid, The conditions are those wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, and the complex hybridizes to the target nucleic acid.

34. A method of editing a target nucleic acid comprising contacting the target nucleic acid with: (a)(i) the fusion protein of any one of claims 10 to 12, and (a)(ii) a guide nucleic acid; (b) the complex of claim 17; (c) a composition comprising the fusion protein of any one of claims 10 to 12 and a guide nucleic acid; and / or (d) The system of any one of claims 27 to 29, The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a mutation (eg, a point mutation).

35. A method for editing a target nucleic acid, comprising contacting a cell or cell-free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding the fusion protein of any one of claims 10 to 12, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; (b) a nucleic acid construct encoding the complex of claim 17, or an expression cassette or vector comprising the same; and / or (c) the system of claim 30, The conditions are those wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing to the target nucleic acid, The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid.

36. The method of claim 34 or 35, wherein the point mutation is a C→T transition in the sense (e.g., "+"; template) strand of the target nucleic acid, or a G→A transition in the antisense (e.g., "-", complementary) strand of the target nucleic acid.

37. A fusion protein comprising: (a) a Cas12a domain, wherein the Cas12a domain specifically binds to a target nucleic acid sequence when associated with a bound guide nucleic acid (e.g., gRNA); (b) a cytidine deaminase domain, wherein when associated with the Cas12a domain and the gRNA, the cytidine deaminase domain deaminates cytosine bases in the single-stranded portion of the target nucleic acid sequence; and (c) a uracil glycosylase inhibitor (UGI) domain, wherein the UGI domain inhibits uracil-DNA glycosylase, Wherein the Cas12a domain is connected to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NO: 2-24.

38. The fusion protein of claim 37, wherein the N-terminus of the Cas12a domain is connected to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 2-5, the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-12, the N-terminus of the cytosine deaminase domain is connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, the N-terminus of the Cas12a domain is connected to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and / or the N-terminus of the cytosine deaminase domain is connected to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 20-24.

39. A fusion protein comprising: (a) Cytosine deaminase domain; (b) a Cas12a domain; and (c) uracil-DNA glycosylase inhibitor (UGI) domain, wherein the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 2-5, and the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain, or The C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-9, and the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain.

40. A fusion protein comprising: (a) Cas12a (Cpf1) domain; (b) a uracil-DNA glycosylase inhibitor (UGI) domain; and (c) cytosine deaminase domain, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 10-12, and the C-terminus of the UGI domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 13-16.

41. A fusion protein comprising: (a) Uracil-DNA glycosylase inhibitor (UGI) domain; (b) a Cas12a (Cpf1) domain, wherein the Cas12a domain comprises a mutation in the nuclease active site; and (c) cytosine deaminase domain, wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain, or wherein the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain, and the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20-24.

42. The fusion protein of any one of claims 37 to 41, wherein the Cas12a domain comprises a mutation in a nuclease active site.

43. The fusion protein of any one of claims 37 to 42, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

44. The fusion protein of claim 43, wherein the APOBEC domain is a rat or human APOBEC domain, optionally wherein the rat APOBEC domain has the amino acid sequence of SEQ ID NO: 46, and / or the APOBEC domain has the amino acid sequence of SEQ ID NO:

47.

45. The fusion protein of any one of claims 39 or 42 to 44, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the UGI domain via a GS connector, and / or the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via a GS connector.

46. ​​The fusion protein of any one of claims 41 to 44, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via a GS connector, and / or the C-terminus of the UGI domain is connected to the N-terminus of the Cas12a domain via a GS connector.

47. The fusion protein of claim 45 or claim 46, wherein the GS linker is (GSS)n, S(GGS)n (SEQ ID NO: 25), SGGS (SEQ ID NO: 25), SGGSGGSGGS (SEQ ID NO: 26), SGSETPGTSESATPES (SEQ ID NO: 27) and / or SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO: 28).

48. The fusion protein of any one of claims 39, 42 to 44 or 47, wherein the C-terminus of the cytosine deaminase domain is connected to the N-terminus of the Cas12a domain via an amino acid sequence of SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO:28).

49. The fusion protein of any one of claims 41 to 44 or 47, wherein the C-terminus of the Cas12a domain is connected to the N-terminus of the cytosine deaminase domain via the amino acid sequence of SGSETPGTSESATPES (SEQ ID NO:27).

50. A polynucleotide encoding the fusion protein of any one of claims 37 to 49.

51. The polynucleotide of claim 50, wherein the polynucleotide is codon-optimized for expression in an organism.

52. A complex comprising the fusion protein of any one of claims 37 to 49, and a guide nucleic acid.

53. A nucleic acid construct encoding the complex of claim 52.

54. An expression cassette or vector comprising the polynucleotide of claim 48 or claim 49, or the nucleic acid construct of claim 31.

55. A cell comprising the polynucleotide of claim 50 or claim 51, or the nucleic acid construct of claim 53, or the expression cassette or vector of claim 54.

56. A composition comprising the fusion protein of any one of claims 37 to 49, and a guide RNA.

57. A method of editing a target nucleic acid, comprising contacting the target nucleic acid with: (a)(i) the fusion protein of any one of claims 37 to 49, and (a)(ii) a guide nucleic acid; (b) the complex of claim 2; and / or (c) the composition of claim 56, The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a (point) mutation.

58. A method for editing a target nucleic acid, comprising contacting a cell or cell-free system comprising the target nucleic acid with: (a)(i) the polynucleotide of claim 50 or claim 51 and (a)(ii) the guide nucleic acid, and / or an expression cassette or vector comprising (a)(i) and / or (a)(ii); and / or (b) the nucleic acid construct of claim 53, or an expression cassette or vector comprising the same, The conditions are those wherein the fusion protein is expressed and forms a complex with the guide nucleic acid, the complex hybridizing to the target nucleic acid, The cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thymine (T), thereby editing the target nucleic acid to generate a (point) mutation.

59. The method of claim 57 or 58, wherein the point mutation is a C→T transition in the sense (e.g., "+"; template) strand of the target nucleic acid, or a G→A transition in the antisense (e.g., "-", complementary) strand of the target nucleic acid.

60. The method of claim 58 or claim 59, wherein the guide nucleic acid comprises a repeat sequence and a spacer sequence from 5' to 3', and the spacer sequence is 70% to 100% complementary to the target nucleic acid (protospacer).

61. The method of claims 58 to 60, wherein the target nucleic acid is adjacent to a protospacer adjacent motif (PAM).

62. The method of claim 61, wherein the PAM comprises a nucleotide sequence of 5'-TTN, 5'-TTTV, or 5'-TTTN.

63. A kit comprising the polynucleotide of any one of claims 1 to 3 or the fusion protein of any one of claims 4 to 12 or 37 to 49, optionally with instructions for its use.

64. A kit comprising the polynucleotide of any one of claims 13 to 15, 50 or 51 and / or an expression cassette or vector comprising the same, optionally with instructions for its use.

65. The kit of claim 63 or claim 64, further comprising a Cas12a guide nucleic acid and / or an expression cassette or vector comprising the same.

66. The kit of claim 65, wherein the guide nucleic acid comprises a cloning site for cloning a nucleic acid sequence identical or complementary to a target nucleic acid sequence into the backbone of the guide nucleic acid.

67. The kit of claims 63 to 66, wherein the polypeptide further comprises one or more nuclear localization signals fused to the fusion protein, or a polynucleotide encoding the same.

68. The kit of claims 63 to 67, wherein the polynucleotide further encodes one or more selectable markers.

69. The kit of claims 63 to 68, wherein the polynucleotide is mRNA and encodes one or more introns within the encoded fusion protein.

Images