Gene for improving nitrogen use efficiency of wheat under nitrogen deficiency and application thereof
By screening and validating the ERF gene and using gene editing technology to suppress its expression, the problem of low nitrogen utilization in wheat under nitrogen-deficient conditions was solved, achieving efficient growth and nitrogen accumulation in wheat under nitrogen-deficient conditions, and promoting the breeding and detection of nitrogen-tolerant varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2026-05-29
Smart Images

Figure CN120591288B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bio-agricultural technology, specifically relating to a gene that improves nitrogen use efficiency in wheat under nitrogen-deficient conditions and its application. Background Technology
[0002] Wheat (Triticum aestivum L.) plays a vital role in global food supply as an important staple crop. High wheat yields depend on fertilizer inputs. Among fertilizers, nitrogen is a major nutrient limiting productivity in many ecosystems because wheat grains (number, size, and protein content) are the primary driver of high nitrogen demand. The widespread use of nitrogen fertilizers in wheat production easily leads to an imbalance between nitrogen supply and demand. However, wheat plants grown under high nitrogen conditions exhibit relatively low nitrogen use efficiency, suggesting that wheat can utilize available nitrogen more efficiently, and the potential to reduce nitrogen demand while maintaining high yields remains unrealized. Summary of the Invention
[0003] In view of this, the purpose of this invention is to provide an ERF gene that improves nitrogen use efficiency in wheat under nitrogen deficiency conditions, thereby improving nitrogen use efficiency in wheat plants under nitrogen deficiency conditions through negative regulation.
[0004] This invention provides an erf gene associated with nitrogen deficiency tolerance in wheat, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0005] This invention provides the application of the erf gene in regulating wheat growth and / or nitrogen accumulation under nitrogen-deficient conditions.
[0006] Preferably, the erf gene promotes wheat growth and nitrogen accumulation under nitrogen-deficient conditions through negative regulation.
[0007] This invention provides the application of detecting the expression level of the erf gene in distinguishing between nitrogen-tolerant and nitrogen-sensitive wheat varieties.
[0008] Preferably, the reagent for detecting the expression level of the erf gene includes qPCR primers;
[0009] The qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3.
[0010] This invention provides the application of the erf gene as a target in the breeding or construction of nitrogen-deficiency tolerant wheat varieties.
[0011] This invention provides the application of inhibiting the expression level of the erf gene in increasing nitrogen accumulation in wheat under nitrogen-deficient conditions.
[0012] Preferably, the inhibition of the erf gene expression level includes mutations in at least one of the following ways: frameshift mutations of the erf gene caused by insertion or deletion, nonsense mutations of the erf gene caused by insertion or deletion, promoter mutations of the erf gene, and enhancer inactivation mutations.
[0013] Preferably, the reagents for inhibiting erf gene expression include siRNA, sgRNA, shRNA, and gene-derived products containing any one of the above that interfere with erf gene expression.
[0014] Preferably, the nitrogen deficiency includes conditions where the nitrogen content in the wheat growing environment is below 0.4 mM.
[0015] This invention provides an erf gene associated with nitrogen deficiency tolerance in wheat, the nucleotide sequence of which is shown in SEQ ID NO:1. This invention screened for the erf gene associated with nitrogen deficiency tolerance in natural wheat varieties from around the world under normal nitrogen and nitrogen deficiency stress conditions, combined with genome-wide association analysis (GWAS). qPCR verification showed that the expression level of the erf gene differed significantly between extremely tolerant and susceptible wheat lines, and that it was significantly upregulated in the susceptible lines. This invention further validated the findings using erf gene mutant plants, demonstrating that the mutation of the erf gene promotes wheat growth and nitrogen accumulation under nitrogen deficiency conditions. This indicates that the erf gene not only upregulates expression in response to nitrogen deficiency stress in wheat, but also promotes wheat growth and nitrogen accumulation under nitrogen deficiency conditions through negative adjustment, thereby improving the nitrogen use efficiency of wheat. Therefore, the erf gene provided by this invention can effectively regulate wheat growth and nitrogen use under nitrogen deficiency conditions, providing a new strategy for the construction and breeding of nitrogen-deficient wheat varieties, and also providing an effective site for the detection and variety identification of nitrogen-deficient wheat environments. Attached Figure Description
[0016] Figure 1 The statistical analysis results of wheat seedling traits under different nitrogen levels in a greenhouse are shown below. a) Plant phenotypes under normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days) are shown, with a scale bar of 10 cm. b) Correlation matrices of six phenotypes related to nitrogen tolerance under normal and nitrogen deficiency conditions are shown. Note: All Pearson correlation coefficients shown in the matrix are significant at different levels; blank blocks indicate no significant correlation between corresponding pairs. c–h show the measurement results of six phenotypes in 284 wheat varieties under two different conditions, including stem dry weight (c), root dry weight (d), root-to-shoot ratio (e), stem nitrogen accumulation (f), root nitrogen accumulation (g), and total nitrogen accumulation (h).
[0017] Figure 2The results of correlation analysis of wheat under nitrogen deficiency conditions are as follows: (a) frequency distribution of relative stem dry weight; (b) frequency distribution of relative root dry weight; (c) frequency distribution of relative root-to-shoot ratio; (d) frequency distribution of relative stem nitrogen accumulation; (e) frequency distribution of relative root nitrogen accumulation; (f) frequency distribution of relative total nitrogen accumulation. Note: Correlation analysis between wheat relative aboveground traits includes relative aboveground dry weight (RSDW), relative root-to-shoot ratio (RRS), relative aboveground nitrogen accumulation (RSN), and relative total nitrogen accumulation (RTN) (g); correlation analysis between wheat relative root dry weight (RRDW), relative root-to-shoot ratio, relative root nitrogen accumulation (RRN), and relative total nitrogen accumulation (RTN) and root traits (h).
[0018] Figure 3 The results of the genome-wide association analysis are shown in Figure 1. (a)–(c) are the QQ plot and Manhattan plot of the three relative traits associated with nitrogen deficiency, where RSDW(a), RRDW(b), and RRS(c) are the most significant traits. The dashed lines represent the significance threshold (p > 1 × 10⁻⁶). 3 );
[0019] Figure 4 The results of the genome-wide association analysis are shown in Figure 1. (a)–(c) are QQ plots and Manhattan plots of the three relative traits associated with nitrogen deficiency, where RSN(a), RRN(b), and RTN(c) are represented. The dashed lines indicate the significance threshold (p > 1 × 10⁻⁶). 3 );
[0020] Figure 5 The results of Venn diagram analysis of wheat root nitrogen tolerance genes identified by GWAS;
[0021] Figure 6 Morphological characteristics of the extremely sensitive strain W101 and the extremely tolerant strain W199 after nitrogen deficiency treatment;
[0022] Figure 7 Results of gene expression in wheat varieties that are extremely nitrogen-deficient and susceptible;
[0023] Figure 8 The results show the identification and verification of nonsense mutations in candidate genes induced by EMS; (a) Genotypic verification results of mutation sites by reverse PCR, blue: wild-type alleles; yellow: erf mutant alleles; (b) Phenotypic images of wild-type plants and mutants; (c) Changes in nitrogen deficiency physiological indicators (including RSDW, RRDW, RRS, RSNC, RRNC and RTNC) of plants with erf mutant alleles and wild-type (WT) plants under normal and limited nitrogen conditions; n=3 for each sample; error bars represent... Detailed Implementation
[0024]
[0025] In this invention, the nitrogen deficiency preferably includes a nitrogen content in the wheat growing environment below 0.4 mM. In this embodiment of the invention, a culture medium with a nitrogen content of 0.4 mM in the growing environment is used as a nitrogen deficiency stress treatment. Simultaneously, a culture medium with a nitrogen content of 4 mM is used as a normal growth condition.
[0026] In this embodiment of the invention, 284 natural wheat varieties were subjected to normal nitrogen and nitrogen deficiency stress treatments. The results showed that nitrogen deficiency stress significantly inhibited aboveground growth and nitrogen accumulation in wheat plants, but promoted root growth. A gene related to improving nitrogen use efficiency in wheat under nitrogen deficiency conditions, namely the erf gene (TraesCS4A03G0812600, Chinese_Spring1.0_chr4A:613543124-613544389), was screened using genome-wide association analysis (GWAS). The expression levels of the erf gene in extremely sensitive and extremely tolerant lines under nitrogen deficiency stress were verified using RT-qPCR. The results showed that the erf gene was relatively upregulated in the extremely sensitive lines and relatively downregulated in the extremely tolerant lines, consistent with the GWAS results. This indicates that the erf gene responds to nitrogen deficiency stress treatment in wheat by upregulating its expression.
[0027] In this invention, to further verify the biological function of the erf gene, wheat mutant plants with homozygous erf gene mutations induced by ethyl methanesulfonate (EMS) were selected from the Jing 411TILLING database as experimental subjects and subjected to nitrogen deficiency stress treatment. The results showed that, compared with wild-type wheat plants, the mutant plants exhibited significantly reduced RSDW (stem dry weight under nitrogen deficiency), RSN (aerial nitrogen accumulation under nitrogen deficiency), RRN (root nitrogen accumulation under nitrogen deficiency), and RTN (total nitrogen accumulation under nitrogen deficiency). Simultaneously, the reduction in RRDW (root dry weight under nitrogen deficiency) was less severe than in wild-type wheat plants, while the reduction in RRS (root-to-shoot ratio under nitrogen deficiency) was more severe. This indicates that mutation or downregulation of the erf gene is beneficial for increasing total nitrogen accumulation, root nitrogen accumulation, and aerial nitrogen accumulation under nitrogen deficiency conditions, as well as increasing stem dry weight. Furthermore, mutation or downregulation of the erf gene is beneficial for reversing the increase in root-to-shoot ratio caused by nitrogen deficiency and mitigating the increase in root dry weight caused by nitrogen deficiency. It is evident that the erf gene is crucial for improving nitrogen use efficiency in wheat under nitrogen-deficient conditions. This can effectively promote the breeding of nutrient-efficient materials and mitigate the negative impact of nitrogen-deficient environments on wheat growth.
[0028] This invention provides the application of the erf gene in regulating wheat growth and / or nitrogen accumulation under nitrogen-deficient conditions.
[0029] In this invention, the erf gene preferably promotes wheat growth and nitrogen accumulation under nitrogen-deficient conditions through negative regulation. The promotion of wheat growth under nitrogen-deficient conditions preferably manifests as the promotion of aboveground growth, which may be stem growth. The promotion of nitrogen accumulation in wheat under nitrogen-deficient conditions preferably includes at least one of the following: increasing nitrogen accumulation in the aboveground parts of the wheat plant, root nitrogen accumulation, and total nitrogen accumulation. Since nitrogen accumulation is one of the basic parameters for assessing nitrogen use efficiency, an increase in plant biomass (NUtE) indicates improved nitrogen use efficiency when the soil nitrogen supply level remains constant.
[0030] In this embodiment of the invention, nitrogen deficiency stress treatment inhibits the aboveground growth and nitrogen accumulation of wheat, but promotes root growth. Mutation of the erf gene enables wheat plants to effectively promote aboveground (stem) growth and inhibit root growth after nitrogen deficiency stress treatment, thereby reducing the root-to-shoot ratio. At the same time, mutation of the erf gene can also increase the nitrogen accumulation in the aboveground parts, roots, and total nitrogen accumulation of wheat plants under nitrogen deficiency conditions.
[0031] This invention provides the application of detecting the expression level of the erf gene in distinguishing between nitrogen-tolerant and nitrogen-sensitive wheat varieties.
[0032] In this invention, the reagent for detecting the expression level of the erf gene preferably includes qPCR primers. The qPCR primers preferably include a forward primer with the nucleotide sequence shown in SEQ ID NO:2 (CAGCAGAACCACCACCTACCAG) and a reverse primer with the nucleotide sequence shown in SEQ ID NO:3 (CTAGTGCCACCTTGCCCTCC). The internal reference gene primers include Actin-F (CAACGAGCTCCGTGTCGCA, SEQ ID NO:4) and Actin-R (GAGGAAGCGTGTATCCCTCATAG, SEQ ID NO:5). The preferred qPCR reaction system is 20 μl: 50 ng cDNA template, 0.4 μl each of forward and reverse primers (10 μM), mix 10 μl, and add ddH2O to bring the total to 20 μl. The preferred qPCR reaction program is pre-denaturation at 94°C for 30 seconds, followed by 45 cycles, each cycle consisting of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 10 seconds, and then melting curve analysis, with fluorescence signals collected every 0.5°C from 60°C to 95°C for a duration of 5 seconds per degree Celsius.
[0033] In this invention, the method for distinguishing between nitrogen-deficiency-tolerant and nitrogen-deficiency-sensitive wheat varieties preferably includes the following steps: planting the wheat variety to be tested under nitrogen-deficiency conditions, using RT-qPCR technology to detect the relative expression level of the erf gene, and determining whether the wheat variety to be tested is a nitrogen-deficiency-tolerant or nitrogen-deficiency-sensitive wheat variety based on the relative expression level of the erf gene: when the relative expression level of the erf gene in the wheat variety to be tested is significantly higher than that in the reference sample, it indicates that the wheat variety to be tested is a nitrogen-deficiency-sensitive wheat variety; and when the relative expression level of the erf gene in the wheat variety to be tested is not significantly different from that in the reference sample, it indicates that the wheat variety to be tested is a nitrogen-deficiency-tolerant wheat variety. The reference sample is preferably a nitrogen-deficiency-tolerant wheat variety, such as Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.
[0034] This invention provides the application of the erf gene as a target in the breeding or construction of nitrogen-deficiency tolerant wheat varieties.
[0035] In this invention, the method for breeding nitrogen-deficiency-tolerant wheat varieties preferably involves screening wheat varieties that show no significant difference in the relative expression level of the erf gene under nitrogen-deficiency conditions compared to reference samples, and using these varieties as breeding parents for hybridization breeding. The method for constructing nitrogen-deficiency-tolerant wheat varieties preferably involves suppressing or knocking out the erf gene in wheat, and collecting wheat varieties that do not express or have low expression of the erf gene. The reference sample is the same as described above and will not be repeated here.
[0036] This invention provides the application of inhibiting the expression level of the erf gene in increasing nitrogen accumulation in wheat under nitrogen-deficient conditions.
[0037] In this invention, the inhibition of the erf gene expression level preferably includes mutations in at least one of the following ways: frameshift mutations of the erf gene caused by insertion or deletion, nonsense mutations of the erf gene caused by insertion or deletion, promoter mutations of the erf gene, and enhancer inactivation mutations. Frameshift mutations of the erf gene caused by insertion or deletion refer to the insertion or deletion of bases not multiples of 3, resulting in a complete error in the downstream amino acid sequence. Nonsense mutations of the erf gene caused by insertion or deletion refer to the premature introduction of a stop codon (UAA / UAG / UGA) or the triggering of the NMD degradation pathway of mRNA (nonsense-mediated mRNA decay). Promoter mutations of the erf gene are caused by disruption of the TATA box / Inr element or mutations in the transcription factor binding site. Enhancer inactivation mutations refer to base variations in the distal regulatory sequence.
[0038] In this invention, the mutation preferably includes wheat plants with erf gene mutations obtained by interfering with erf gene expression through gene editing or by inducing erf gene mutations through chemical reagents. In this invention, the reagents for inhibiting erf gene expression levels preferably include siRNA, sgRNA, shRNA, and gene-derived products containing any one of the above that interfere with erf gene expression. In an embodiment of this invention, wheat plants with erf gene mutations screened from the Jing 411TILLING database induced by ethyl methanesulfonate (EMS) were used as the research object to conduct a verification experiment on nitrogen accumulation in wheat under nitrogen-deficient conditions. The mutation sites of the screened erf gene-mutant plants were verified by sequencing the PCR products amplified by specific primers. The results showed that the mutation sites were 4A: 612401995-612403260, TraesCS4A03G0812600, and Variant position 3: 612402894G→A.The sequence of the mutated erf gene is as shown in SEQ ID NO:6 (ACTCTTGACCTGGTCAATC AGGACATGCATGTATTCCCGCTTCTGCATCGTCAGCGCCCACGCACGGAAAGCTCCATTCCACTTCACCCGTCAACCACAAAGCTAGCAACAAACAATCAATCAATCCCTTGTACTCTTTCACTTCTTTTTGGAAAAAGGAAAACAAACGGAAACCCTACACCCGGCAGAGGTATTCAAGCTTGACCCGACCATTTTGGTGAACTACTCACAGCAATTTTCACCGAGTTCAAACCCAAATTCACGCTCGTTTGCCGCTTCAAAACAATGTACACACCAGGCACGCTCATGATCACCCGTCATCGTCGCGCTCGTTGGCCTTGCCTTGCGATGTGAATTCTCCACCATCCCGGTAGATTCGTCGGCATGTGTGATTCGAGTTCATACGGACTGGTGGCTCCAGCACCATGAACTCATGGACGCCGTGTCCTCGGAGGCGCCAAGCAGCTGCTCGAGGTACTCCGCGCCGAGGTCCTCAAGCTCCATCACACACTCCGGCCGCGCCCCCCGGGTGGCGGCCTTCGCCACCCTGCCGGCCGCCGCGGCCTTCCGGCTCCGCATGCAATGCCGCCGCTTGAGCGCCAGCACGGGCGACAAGCCATGGGCACGGCCGCATGCGTCGTCAGCGGCGCCCTCGAGCGAGCGCCGGACCTGATCGGCCGGAAAGTTGAGAACGGCGGCCCCGCCGCGGATGGCGAACGCAGCCTGGTCGTACGCCAGCGCCGCAGCTTCTGGGCTGTCGAAGGTGCCCAGCCACACGCGCACGCCGTTGCGCGTCGAGTCCCGGATCTCCGCCGCGAACTTGCCCCACGGTCGCTTCCGCACTCCGCGGAACGCGCGACCCACACCTAGTGCCACCTTGCCCTCCTCGTCGGCCTCTT。 ACTTCGCCGGCGCCGTCGTCGGTGCGGCCGCGGCGTGCTGGACCTCGTGGTGCTGGGAGAGCATGTCTAGCAGGAGCATCTCGTCGGCGTCGCTGGTGTCGAACGGAAGAACAGGTGGCGGCGTGGCCGGGGCGGTGGTGCCAGGGCGCGGAGTCGGCGGAGCCGGTGGAGGAGCCCGGCGAGTGCAGCG GGAATGCTTCGGCTGCTGGTAGGTGGTGGTTTCTGCTGCGTGGTCACCGCACGACGGGCCAGAAAGTTGACGACGCCGGTGGTGAGCCGGGGCGACGTAGATGAAGAAGTCGGAGAAGAAGAGGCCGTGCTGCTGGCGCTGGGATCAGACATGGAGTTTTTCTCGTGGGATGTCGG, where the bold bases are mutation sites).
[0039] In this invention, the method for improving nitrogen accumulation in wheat under nitrogen-deficient conditions includes erf gene mutation to reduce the relative expression level of the erf gene, thereby regulating the mutant wheat plants to increase nitrogen accumulation in roots and stems and total nitrogen accumulation under nitrogen-deficient conditions. This is beneficial for the breeding of nitrogen-deficient tolerant wheat varieties and reduces the impact of nitrogen-deficient environment on wheat growth.
[0040] The following detailed description, in conjunction with embodiments, illustrates a gene for improving nitrogen use efficiency in wheat under nitrogen-deficient conditions and its application, but these should not be construed as limiting the scope of protection of this invention.
[0041] Example 1
[0042] A method for screening genes associated with nitrogen deficiency tolerance in wheat.
[0043] 1. Materials and Methods
[0044] 1.1 Plant materials and growing conditions
[0045] We collected 284 common wheat germplasm accessions from around the world (see Table 1).
[0046] Table 1 Summary of 284 wheat germplasm information
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056] Seeds of all wheat varieties were disinfected with 3% hydrogen peroxide for 30 minutes, rinsed three times with tap water, and then transferred to a sand bed. After germination, the endosperm of 7-day-old seedlings (two-leaf stage) was removed, and the seedlings were transplanted into a hydroponic solution prepared in distilled water (1 mM ammonium sulfate, 1 mM potassium nitrate, 1.5 mM calcium chloride, 1 mM magnesium sulfate, 0.5 mM potassium dihydrogen phosphate, 0.046 mM H3BO3, 9.6 μM manganese chloride·4H2O, 0.01 mM (NH4)6Mo7O). 24 The culture medium consisted of 4 mM ZnSO4·7H2O, 0.4 mM CuSO4·5H2O, and 0.095 mM Fe(III)-EDTA (pH 5.8), and the seedlings were allowed to acclimate for 7 days. Over the next 15 days, the plants were divided into two treatments: a control medium containing 4 mM nitrogen (N) and a nitrogen-deficient treatment medium containing 0.4 mM nitrogen. The culture medium was refreshed every 3 days.
[0057] In the experiment, wheat was grown in a natural light greenhouse at the Central Plains Research Institute of Zhejiang University in Zhengzhou, China, with day and night temperatures of 22 / 18℃.
[0058] 1.2 Dry weight and nutritional analysis
[0059] Each wheat plant was photographed and its stems and roots were separated. The plants were then treated at 105°C for 30 min and dried to constant weight in an oven at 80°C. The dry weight of the stems and roots was recorded. The nitrogen content in the raw material was determined by the Kjeldahl method. Approximately 0.3 g of the raw material was added to a dry 100 mL Kjeldahl flask and hydrolyzed for 2 h in 15 mL of concentrated sulfuric acid (H2SO4) solution containing 0.4 g CuSO4 and 4 g K2SO2 in a heating block at 420°C. After cooling, 20 mL of H2O was added to the hydrolysis product, followed by titration and neutralization to measure the nitrogen content in the raw material.
[0060] Root to shoot ratio (RS) = root dry weight (RDW) / stem dry weight (SDW) formula I;
[0061] Total nitrogen accumulation (TN) = Aboveground nitrogen accumulation (SN) + Root nitrogen accumulation (RN) (Formula II)
[0062] Each treatment was repeated three times, with three plants randomly selected. Correlation between traits was calculated using SPSS 21.0 (IBM, Armonk, NY, USA), and the mean phenotype of each treatment was compared using a t-test.
[0063] The nitrogen deficiency tolerance index is used to characterize the relative changes in SDW, RDW, RS, SN, RN, and TN (labeled RSDW, RRDW, RRS, RSN, RRN, and RTN, respectively) under nitrogen deficiency stress. The relative change in each trait is calculated as the value under nitrogen deficiency treatment / normal treatment, for example, RSDW = (SDW (control) - SDW (nitrogen deficiency)) / SDW (control).
[0064] 1.3 Genome-wide association analysis (GWAS)
[0065] Capital Bio genotyped all 284 accessions using a wheat 90K single nucleotide polymorphism (SNP; Illumina, 81,587 SNPs) chip. SNPs used for subsequent GWAS analysis were obtained after quality control (minor allele frequencies >0.05, missing data <20%). The physical locations of the SNPs were obtained from the International Wheat Genome Sequencing Consortium website (IWGSC, http: / / www.wheatgenome.org / IWGSC v1.1).
[0066] Population structure was analyzed using the Additives 1.3.0 program. ADMIXTURE was run from K=1 to K=20 clusters to determine the optimal K value. A phylogenetic tree was created using R-packaged monkeys to observe the genetic relationships of the samples and eliminate outliers.
[0067] Genome-wide association analysis (GLM) was performed on nitrogen deficiency tolerance indices for phenotypic traits using TASSELv5.2 software. In this embodiment, the p-value indicates whether a SNP is associated with the corresponding trait, and R... 2 This indicates the phenotypic variation explained by the marker.
[0068] Because the Bonferroni-Holm correction (Holm, 1979) for multiple detection (α = 0.05) was too conservative, and this criterion did not detect significant marker-trait associations (MTAs), markers with an adjusted -log10 (p-value) ≥ 3.0 were selected as significantly associated markers. Furthermore, the Manhattan and QQ plots were drawn using the CM plotting package implemented in R3.6.
[0069] 1.4 Candidate Gene Analysis and Annotation
[0070] Candidate genes were identified as all genes located in regions surrounding significant SNPs (±50 kb) at each important site in IWGSC3 (IWGSC v1.1). An interactive web server, wGRN (http: / / wheat.cau.edu.cn / wGRN), was then used to accurately prioritize candidate genes associated with nitrogen deficiency responsiveness in genome-wide association studies. Inputting QTLs from the GWAS results and previously identified homologous genes involved in rice nitrogen metabolism revealed genes associated with improved nitrogen use efficiency in wheat under nitrogen deficiency conditions.
[0071] 2. Results
[0072] 2.1 Phenotypic Response of Nitrogen-Responsive Traits to Different Environments
[0073] Six agronomic indices for nitrogen deficiency tolerance were observed and calculated in the experiment, including SDW, RDW, RS, SN, RN, and TN. All traits showed extensive variation across 284 wheat germplasms. Continuous variation was observed across all traits, with a distribution approximating a normal distribution. The figures show the seedlings exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days). Figure 1 (a) Compared with the control group, all traits except RRDW and RRS decreased under nitrogen deficiency. The mean values of SDW, SN, RN, and TN decreased by 35.5%, 67.5%, 32.2%, and 61.7%, respectively, under nitrogen deficiency. In contrast, the mean values of RRDW and RRS increased by 41.8% and 121.1%, respectively, under nitrogen deficiency. Figure 1 (c)-(h)). Furthermore, significant positive correlations were observed among the data for all six nitrogen deficiency-related traits under both nitrogen conditions. Figure 2 The values in (a)-(f) indicate that most phenotypic variations originate from genetic factors.
[0074] To further explore the relationships between six nitrogen deficiency-related traits under different nitrogen conditions, a correlation matrix was constructed. Figure 1 (b) The results showed a significant positive correlation between SDW and SN, with Pearson correlation coefficients (r) of 0.727 and 0.731 under normal and nitrogen-deficient conditions, respectively. Furthermore, a significant positive correlation was observed between RDW and RN data under both nitrogen conditions. These results indicate that SDW and RDW can serve as key phenotypic indicators characterizing nitrogen use efficiency in wheat. At different nitrogen levels, RS showed a significant negative correlation with SN and TN (p<0.01), suggesting that an increase in the root-to-shoot ratio may significantly reduce nitrogen use efficiency in wheat.
[0075] 2.2 Growth response of wheat varieties to nitrogen deficiency stress
[0076] To identify the response of extreme wheat lines to nitrogen deficiency, relative traits (RSDW, RRDW, RRS, RSN, RRN, RTN) were used as composite selection indicators at different nitrogen levels.
[0077] Under nitrogen deficiency stress, compared with the control group, all wheat lines showed reduced stem dry weight and nitrogen accumulation. Figure 2 (a)-(f)). However, approximately 94% of the lines showed an increased root dry weight response to nitrogen deficiency. Furthermore, compared to the control group, over 90% of the lines exhibited reduced root nitrogen accumulation.
[0078] Furthermore, by selecting the top 15% of the relative stem and root biomass indices under nitrogen deficiency treatment, W268 (CA1119), W193 (Emai W23), W101 (Afu), W94 (Aca601), and W4 (Fengchan 3) were considered extremely nitrogen-deficient lines. Meanwhile, W299 (Azulon), W187 (Chuanmai 41), W110 (Shijiazhuang 8), W53 (Shanmai 512), and W199 (Xuzhou 25) showed stronger tolerance to nitrogen deficiency because the bottom 15% of the relative stem and root biomass indices were a response to nitrogen deficiency stress. Subsequently, 10 wheat lines exhibiting extreme nitrate responsiveness were used as material for further candidate gene analysis.
[0079] Furthermore, correlation analysis was performed on the nitrogen deficiency response traits of seedlings under nitrogen deficiency stress, and the correlation coefficients of six traits were presented. Multivariate analysis showed robust covariance between stem-related parameters (RSDW, RSN) and root structure indices (RRDW, RRN) under nitrogen limitation (p<0.01). Figure 2 (g)-(h)).
[0080] 2.3 Marker-Association-of-Traits (MTAs) Analysis
[0081] Genome-wide association analysis (GLM) was performed on nitrogen deficiency tolerance indices for phenotypic traits. At a p-value of 0.001 (log10 value of 3), 70 SNPs (MTAs) significantly associated with six nitrogen deficiency tolerance-related traits (including RSDW, RRDW, RRS, RSN, RRN, and RTN) were identified. Figure 3 and Figure 4 ).
[0082] The highest number of loci were found in genome A (33) and genome B (22), while 15 loci were found in genome D. Of these loci, RSDW detected 16, RRDW detected 21, RRS detected 15, RSN detected 18, RRN detected 9, and RTN detected 5.
[0083] Notably, nine loci (BobWhite_c19327_314, BobWhite_c47740_85, BobWhite_c8037_1135, BS00106306_51, Excalibur_c3004_250, Excalibour_rep_c70996_188, IAAV8527, Kukri_c17417_291, Tdurum_contig46954_406, wsnp_CAP11_rep_c4111_1943520, and wsnp_Ra_c38873-46699852) were identified as having two or more traits, demonstrating the presence of pleiotropic regions. Furthermore, the QQ plots of all traits indicate that false positives in this GWAS were adequately controlled.
[0084] As a result, 67, 27, 39, 48, 61, and 10 genes were identified using RRDW, RRN, RRS, RSDW, RSN, and RTN, respectively. Figure 5 ).
[0085] Using QTLs identified in GWAS as input, 220 candidate genes were predicted by wGRN in combination with known homologs in rice. In this example, based on its connectivity with genes in the functional network, wGRN prioritized TraesCS4A03G0812600(ERF) as a high-confidence candidate.
[0086] Example 2
[0087] The expression level of the erf gene in extreme varieties was verified using RT-qPCR.
[0088] Ten extremely nitrogen-tolerant and susceptible wheat lines were treated for 15 days under nitrogen-deficient (0.4 mM N) or normal nitrogen levels (4 mM N). Morphological characteristics of the treated wheat plants were then observed by photography. RNA was extracted from the wheat plants for RT-qPCR analysis, with three biological replicates per sample. Total RNA was extracted from stems using a plant RNA kit (ER302; TransGen Biotech, Beijing, China), and cDNA was synthesized using a cDNA synthesis kit (AU341; TransGen Biotech, Beijing, China). Quantitative reverse transcription polymerase chain reaction (qPCR) analysis was performed using a Green qPCR kit (AQ601; TransGen Biotech, Beijing, China) to determine gene expression levels. Triple copies of the experiments were performed. The primers used for qPCR detection are as follows: ERF-F: CAGCAGAACCACCACCTACCAG; ERF-R: CTAGTGCCACCTTGCCCTCC; Actin-F: CAACGAGCTCCGTGTCGCA; Actin-R: GAGGAAGCGTGTATCCCTCATAG. The qPCR reaction mixture consisted of 20 μl: 50 ng cDNA template, 0.4 μl each of forward and reverse primers (10 μM), mix 10 μl, and bring the total volume to 20 μl with ddH2O. The qPCR reaction program was as follows: 94℃ pre-denaturation for 30 seconds, followed by 45 cycles, each cycle consisting of 94℃ denaturation for 5 seconds, 60℃ annealing for 15 seconds, and 72℃ extension for 10 seconds. Melting curve analysis was then performed, with fluorescence signals acquired every 0.5℃ from 60℃ to 95℃ for 5 seconds per degree Celsius.
[0089] See results Figure 6 and Figure 7 To validate the function of candidate genes, extremely tolerant and sensitive lines were exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions. The results showed that nitrogen deficiency stress significantly inhibited aboveground growth and nitrogen accumulation in wheat plants, but promoted root growth. ERF expression was upregulated in all extremely nitrogen-deficient and tolerant lines, with a greater relative upregulation in extremely sensitive lines, indicating different expression and regulatory patterns among extreme lines responding to nitrogen starvation.
[0090] Ten wheat plants were cultured for 15 days under nitrogen-deficient (0.4 mM N) conditions, using W199 (Xuzhou 25) as a reference sample. The RT-qPCR detection method described above was used for analysis. The determination method was that if the relative expression level of the erf gene in the test sample was upregulated compared to the reference sample, the test sample was considered a nitrogen-deficient wheat variety; if there was no significant difference, the test sample was considered a nitrogen-tolerant wheat variety. The results showed that 7 wheat plants were nitrogen-deficient wheat varieties, and the remaining 3 were nitrogen-tolerant wheat varieties, achieving a 100% concordance rate with the nitrogen-deficient phenotype.
[0091] Example 3
[0092] Analysis of wheat mutants of the candidate gene erf
[0093] To evaluate candidate gene erf, mutants were used to assess their function. Homozygous EMS mutants induced by ethyl methanesulfonate (EMS) in wheat were selected as candidate genes from the Jing411TILLING database (http: / / jing411.molbreeding.com / ). The mutation type was early termination. The mutation site was verified by sequencing the PCR products amplified with specific primers.
[0094] The PCR reaction system consisted of: 100 ng genomic DNA template, 0.8 μl each of forward and reverse primers (10 μM), 10 μl 2×Mix, and ddH2O to a final volume of 20 μl. The primers included erf-F: GATCGGCCGGAAAGTTGAGA (SEQ ID NO: 7); and erf-R: AGGCCGTGACGAATTCTTGT (SEQ ID NO: 8). The PCR primer reaction program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 15 seconds, for 32 cycles; and a final extension at 72℃ for 10 minutes, followed by storage at 4℃.
[0095] To further investigate the function of candidate genes, high-impact wild-type plants and mutants from the wheat Jing 411 database were utilized. Genotypic verification of the mutation sites in EMS-induced nonsense (acquisition stop) mutations was performed using qPCR. Figure 8 (a)). Differences between erf mutant plants and wild-type (WT) plants under normal and nitrogen-deficient conditions (a) Figure 8 (c) The results showed that under different nitrogen conditions, the physiological parameters of the erf mutant plants differed significantly from those of the wild-type plants (WT). The RSDW, RSN, RRN, and RTN of the mutant plants were significantly higher than those of the WT plants. This indicates that the erf gene increases nitrogen accumulation in wheat roots and aboveground parts through negative regulation, thereby increasing the total nitrogen accumulation of the plant and also increasing stem weight.
[0096] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Inhibition erf The application of gene expression levels in promoting wheat growth under nitrogen deficiency conditions, the erf The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. Inhibition erf The application of gene expression levels in breeding or constructing nitrogen-tolerant wheat varieties, the erf The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
3. Inhibition erf The application of gene expression levels in improving nitrogen accumulation in wheat under nitrogen-deficient conditions, the aforementioned erf The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
4. The application according to any one of claims 1 to 3, characterized in that, The suppression of erf Gene expression levels include mutations occurring in at least one of the following ways: insertion or deletion. erf Gene frameshift mutations, insertions, or deletions erf Nonsense mutations erf Promoter mutations and enhancer inactivation mutations in genes.
5. The application according to any one of claims 1 to 3, characterized in that, The inhibition erf Reagents for gene expression levels include interference erf Gene expression siRNA, sgRNA, shRNA, and gene-derived products containing any of the above.
6. The application according to any one of claims 1 to 3, characterized in that, The nitrogen deficiency refers to conditions where the nitrogen content in the wheat growing environment is below 0.4 mM.