Preparation methods and applications of COL3A1 protein

By using the FBLN1 protein signal peptide to express COL3A1 protein in HEK-293T cells, the problem of low expression efficiency in mammalian cells was solved, and high-yield and highly bioactive COL3A1 protein was prepared, which promoted fibroblast function and expanded its application in multiple biomedical fields.

CN120591344BActive Publication Date: 2026-04-03广州景旸生物科技有限公司
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing technologies for expressing COL3A1 protein using mammalian cells are inefficient, costly, and suffer from low expression levels and complex purification procedures.

Method used

COL3A1 protein was expressed in HEK-293T cells, and the FBLN1 protein signal peptide was used to replace the traditional signal peptide to improve the secretion and expression efficiency of COL3A1 protein.

Benefits of technology

We have achieved high-yield, high-bioactivity preparation of COL3A1 protein, which can promote the proliferation, adhesion, and migration of fibroblasts and has broad application potential in tissue regeneration, wound healing, regenerative medicine products, gene therapy products, biomaterials, and cosmetic products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591344B_ABST
    Figure CN120591344B_ABST
Patent Text Reader

Abstract

This invention provides a method for preparing COL3A1 protein and its applications, relating to the field of biotechnology. The preparation method involves expressing COL3A1 protein using HEK-293T cells, with the FBLN1 protein signal peptide serving as the signal peptide for COL3A1. This method enables HEK-293T cells to secrete and express COL3A1 protein in high quantities and with high biological activity, facilitating the application of COL3A1 protein in tissue regeneration, wound healing, and other areas.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing COL3A1 protein and its application. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] COL3A1 protein, or type III collagen α1 peptide chain (CoL3A1), is encoded by the COL3A1 gene. Type III collagen is a fibrous collagen composed of three type III collagen α1 peptide chains forming a triple helix structure. Type III collagen has a stable Gly-XY (glycine-proline-hydroxyproline) triple helix conformation and is widely distributed in soft connective tissues such as skin, blood vessels, and internal organs. Together with type I collagen, it maintains tissue elasticity and mechanical strength, playing a crucial role in maintaining tissue structure and function. As a major component of collagen in the extracellular matrix, type III collagen possesses various biological functions, including maintaining tissue elasticity and flexibility, promoting cell migration and adhesion, and regulating wound repair. It has wide applications in regenerative medicine, gene therapy, biomaterials, and cosmetic skincare.

[0004] In recent years, expression systems using E. coli, yeast, plants, and mammalian cells have all been used to express recombinant collagen. However, recombinant expression systems still face numerous technical challenges. While recombinant expression of COL3A1 protein using E. coli or Pichia pastoris is low-cost and yields high output, it suffers from insufficient hydroxylation modification, requiring exogenous P4H or chemical modification; the lack of a triple-helix structure makes it susceptible to enzymatic degradation; and the potential for endotoxins. Therefore, recombinant expression of COL3A1 protein using E. coli or Pichia pastoris is limited to scientific research and in vitro experiments. Using plant cells to express collagen results in limited expression levels and presents significant challenges in extraction and purification.

[0005] Recombinant human COL3A1 protein was expressed using mammalian cells such as HEK-293T and CHO. It is closest to natural human type III collagen, with complete hydroxylation modification, no risk of animal-derived pathogens, and higher biological activity, making it suitable for therapeutic research. However, its expression level is low, and purification steps such as affinity chromatography and ion exchange are required, which greatly increases the production cost.

[0006] Therefore, developing an efficient, highly active, low-immunogenic, and low-cost method for preparing recombinant human type III collagen COL3A1 and expanding its application in the biomedical field has significant market potential.

[0007] In view of this, the present invention is hereby proposed. Summary of the Invention

[0008] The purpose of this invention is to provide a method for preparing COL3A1 protein, so as to alleviate the problem of low efficiency in expressing COL3A1 protein using mammalian cells in the prior art.

[0009] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0010] In a first aspect, a method for preparing COL3A1 protein is provided, the method comprising expressing COL3A1 protein using HEK-293T cells and using FBLN1 protein signal peptide as the signal peptide of COL3A1 protein.

[0011] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the FBLN1 protein signal peptide and a sequence encoding the COL3A1 protein, respectively.

[0012] Thirdly, a carrier is provided that carries the polynucleotide described in the second aspect.

[0013] Fourthly, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide of the second aspect, or contains the vector described in the third aspect.

[0014] Fifthly, a method for preparing the COL3A1 protein described in the first aspect, or the COL3A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the application of the recombinant HEK-293T cells described in the fourth aspect in any one of (i) to (iii):

[0015] (i) Uses for promoting fibroblast adhesion, proliferation and / or migration for purposes other than diagnosis and treatment;

[0016] (ii) Use in the preparation of products for promoting fibroblast adhesion, proliferation and / or migration;

[0017] (iii) Application in the preparation of products for tissue regeneration or wound healing.

[0018] In a sixth aspect, a method for preparing the COL3A1 protein described in the first aspect, or the COL3A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, are provided for use in the preparation of regenerative medicine products, gene therapy products, biomaterials, or cosmetic products.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention utilizes HEK-293T cells to express COL3A1 protein and replaces the traditional signal peptide with the FBLN1 protein signal peptide, thus successfully achieving the preparation of high-yield, highly bioactive COL3A1 protein. Experiments have confirmed a synergistic effect between the FBLN1 protein signal peptide and HEK-293T cells, significantly enhancing the secretory expression efficiency of COL3A1 protein in this cell line. However, the FBLN1 protein signal peptide does not exhibit the aforementioned promoting effect in CHO cells, indicating a synergistic effect between the host cell and the signal peptide. Furthermore, the COL3A1 protein prepared by this invention possesses excellent biological activity, demonstrating its effective promotion of fibroblast proliferation, adhesion, and migration. Based on these superior properties, this preparation method has enormous application potential and a broad market prospect in multiple fields, including tissue regeneration, wound healing, regenerative medicine product development, gene therapy product development, biomaterial preparation, and cosmetic product manufacturing. Attached Figure Description

[0021] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0022] Figure 1 The plasmid map of the expression plasmid constructed in Example 1;

[0023] Figure 2 The results of Western blot analysis in Example 3 show the expression of COL3A1 linked to signal peptides A, B, and C, respectively.

[0024] Figure 3 The results of immunoblotting in Example 4 show the expression of COL3A1, which links the signal peptide A, in CHO cells and HEK-293T cells.

[0025] Figure 4 The relative adhesion rates of fibroblasts in the negative control and after the well plate was coated with COL3A1 protein in Example 5;

[0026] Figure 5 The relative proliferation rate of fibroblasts treated with different concentrations of COL3A1 protein in Example 6;

[0027] Figure 6 These are photographs of fibroblasts at 0h, 6h, and 24h in the cell scratch experiment of Example 7. Detailed Implementation

[0028] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] In this document, “and / or” is used to indicate that one or both of the situations described may occur, for example, A and / or B includes (A and B) and (A or B).

[0030] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order, or importance between these entities or behaviors, such as numbering first, second, etc.

[0031] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0032] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0033] In this article, the term "COL3A1 protein" refers to the type III collagen α1 peptide chain (CoL3A1), encoded by the COL3A1 gene. In this article, COL3A1 protein can also refer to a multimer composed of COL3A1 protein; for example, when COL3A1 protein forms a trimer, it is type III collagen.

[0034] In this article, peptides, polypeptides, and proteins are not strictly distinguished and can be used interchangeably in some cases. Generally, peptides refer to polymers composed of amino acids linked by peptide bonds, whether naturally occurring or synthetic.

[0035] In this document, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, it optionally encodes either the sense or antisense strand. Polynucleotides can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably. In an optional embodiment, the polynucleotide is DNA.

[0036] In this document, the term "vector" refers to a delivery system that can operatively insert a genetic element (such as the aforementioned polynucleotide) into itself and enable the expression of that genetic element, for example, to produce a protein, RNA, or DNA encoded by that genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling the expression of the genetic element they carry within the host cells. Examples of vectors include: plasmids, episome plasmids, microcircular DNA, phage particles, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC), bacteriophages such as λ phage or M13 phage, and animal viruses. Vectors may contain various elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may also include components that facilitate their entry into the cell, including but not limited to viral particles, liposomes, or protein coats. Vectors can be expression vectors or cloning vectors. The vector may also include selection markers, such as, but not limited to, resistance genes and / or fluorescent protein genes.

[0037] In a first aspect, a method for preparing COL3A1 protein is provided, the method comprising expressing COL3A1 protein using HEK-293T cells and using FBLN1 protein signal peptide as the signal peptide of COL3A1 protein.

[0038] In this article, FBLN1 protein refers to fibulin-1, an extracellular matrix protein encoded by the FBLN1 gene. FBLN1 is a secreted glycoprotein that maintains extracellular matrix stability and participates in regulating cell morphology, migration, and its interaction with the ECM. FBLN1 is mainly located in organ basement membranes, elastic fibers, and other connective tissue structures. With a molecular weight of approximately 90 kDa, it consists of a typical C-terminal "fibulin-type" module, an N-terminal anaphylatoxin domain, and a calcium-binding epidermal growth factor-like domain connecting the two, and participates in various biological processes.

[0039] HEK-293T cells (Human Embryonic Kidney 293T cells) are derived from human embryonic kidney cells and are commonly used as host cells for exogenous expression of target proteins. They possess advantages such as stable and high proliferation capacity and high transfection efficiency in vitro. This invention discovers that using the FBLN1 protein signal peptide as the signal peptide for the COL3A1 protein can significantly enhance the expression of COL3A1 protein in HEK-293T cells.

[0040] In an optional implementation, the original signal peptide of the COL3A1 protein is replaced with the FBLN1 protein signal peptide. It is understood that the FBLN1 protein signal peptide is located at the N-terminus of the COL3A1 protein.

[0041] In an optional implementation, the COL3A1 protein is secreted and expressed in HEK-293T cells.

[0042] In an optional embodiment, the preparation method further includes the formation of type III collagen from COL3A1 protein secreted and expressed in HEK-293T cells.

[0043] In an optional embodiment, the amino acid sequence of the FBLN1 protein signal peptide is shown in SEQ ID NO.1.

[0044] SEQ ID NO. 1: MERAAPSRRVPPLPLLLLGGLALLAAGVDA.

[0045] In an optional embodiment, the nucleotide sequence encoding the FBLN1 protein signal peptide is shown in SEQ ID NO.2.

[0046] SEQ ID NO.2:

[0047] atggagcgcgccgcgccgtcgcgccgggtcccgcttccgctgctgctgctcggcggccttgcgctgctggcggccggagtggacgcg.

[0048] In an optional embodiment, the preparation method includes expressing a polynucleotide in HEK-293T cells, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the FBLN1 protein signal peptide and a sequence encoding the COL3A1 protein.

[0049] The sequences encoding the FBLN1 protein signal peptide and the COL3A1 protein can be integrated or not integrated into the genome of HEK-293T cells.

[0050] In an optional embodiment, the preparation method includes: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and causing the HEK-293T cells to express COL3A1 protein.

[0051] In optional embodiments, those skilled in the art can introduce polynucleotides encoding the FBLN1 protein signal peptide and polynucleotides encoding the COL3A1 protein into HEK-293T cells in any known manner of introducing exogenous nucleic acids into cells, such as, but not limited to, liposome transfection, cationic polymer transfection, electroporation, microinjection, gene gun or viral vector-mediated transfection.

[0052] It is understood that those skilled in the art can culture the HEK-293T cells using any methods that are optional and known in the art, including optional and known culture media, culture environments, culture containers, and culture equipment.

[0053] In an optional embodiment, the preparation method further includes isolating, enriching and / or purifying recombinant HEK-293T cells expressing COL3A1 protein.

[0054] In an optional embodiment, the COL3A1 protein carries a His tag, and the preparation method further includes purifying the COL3A1 protein using a filler material modified with nickel ions.

[0055] The COL3A1 protein prepared by the method described in the first aspect includes wild-type COL3A1 protein or artificially modified COL3A1 protein. The artificial modification includes, but is not limited to, peptides or proteins mutated, truncated, or fused with other domains. The COL3A1 protein prepared by the method described in the first aspect can be a single chain or form a multimer; the present invention is not limited in this regard. For example, it can form a trimer, i.e., form type III collagen. Therefore, the preparation method provided in the first aspect of the present invention can also be a method for preparing type III collagen.

[0056] The COL3A1 protein prepared by the preparation method described in the first aspect can be a COL3A1 protein from any species in the art, such as a COL3A1 protein from mammals, including but not limited to humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, alpacas, poultry, goats, and sheep. In an optional embodiment, the COL3A1 protein prepared by the preparation method described in the first aspect is a human-derived COL3A1 protein. In an optional embodiment, the protein expressed by the preparation method is a COL3A1 protein encoded by the nucleotide sequence shown in SEQ ID NO. 7.

[0057] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the FBLN1 protein signal peptide and a sequence encoding the COL3A1 protein, respectively.

[0058] In an optional embodiment, the amino acid sequence of the FBLN1 protein signal peptide is shown in SEQ ID NO.1.

[0059] In an optional embodiment, the polynucleotide sequence encoding the FBLN1 protein signal peptide is shown in SEQ ID NO.2.

[0060] In an optional embodiment, the nucleotide sequence encoding the COL3A1 protein is shown in SEQ ID NO.7.

[0061] Thirdly, a carrier is provided that carries the polynucleotide described in the second aspect.

[0062] In an optional embodiment, the vector is a plasmid.

[0063] In an optional embodiment, the vector is an expression plasmid.

[0064] Fourthly, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T carries the polynucleotide described in the second aspect, or contains the vector described in the third aspect.

[0065] In an optional embodiment, the polynucleotide described in the second aspect may or may not be integrated into the genome of the recombinant HEK-293T cells.

[0066] In an optional embodiment, the recombinant HEK-293T cells contain a plasmid carrying the polynucleotides described in the second aspect.

[0067] Fifthly, a method for preparing the COL3A1 protein described in the first aspect, or the COL3A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the application of the recombinant HEK-293T cells described in the fourth aspect in any one of (i) to (iii):

[0068] (i) Uses for promoting fibroblast adhesion, proliferation and / or migration for purposes other than diagnosis and treatment;

[0069] (ii) Use in the preparation of products for promoting fibroblast adhesion, proliferation and / or migration;

[0070] (iii) Application in the preparation of products for tissue regeneration or wound healing.

[0071] In an optional embodiment, (i) is used in the in vitro promotion of fibroblast adhesion, proliferation and / or migration.

[0072] In a sixth aspect, a method for preparing the COL3A1 protein described in the first aspect, or the COL3A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, are provided for use in the preparation of regenerative medicine products, gene therapy products, biomaterials, or cosmetic products.

[0073] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0074] Example 1

[0075] 1. The target gene was constructed into the pCDNA3.1 gene expression vector using seamless cloning, and different signal peptide-linked COL3A1 gene expression plasmids were obtained. The plasmid map is shown below. Figure 1 As shown, the nucleotide sequence encoding the signal peptide is linked to the 5' end of the COL3A1 gene, and the nucleotide sequence of the COL3A1 gene is shown in SEQ ID NO.7. COL3A1 is linked with a 6×His tag. The sequences of the signal peptide are as follows:

[0076] Signal peptide A (FBLN1 protein signal peptide):

[0077] Amino acid sequence, SEQ ID NO.1:

[0078] MERAAPSRRVPLPLLLLGGLALLAAGVDA

[0079] Nucleotide sequence, SEQ ID NO.2:

[0080] atggagcgcgccgcgccgtcgcgccgggtcccgcttccgctgctgctgctcggcggccttgcgctgctggcggccggagtggacgcg.

[0081] Signal peptide B (SULF1 (sulfatase 1) protein signal peptide):

[0082] Amino acid sequence, SEQ ID NO.3:

[0083] MKYSCCALVLAVLGTELLGSLC.

[0084] Nucleotide sequence, SEQ ID NO.4:

[0085] atgaagtattcttgctgtgctctggttttggctgtcctgggcacagaattgctgggaagcctctgt.

[0086] Signal peptide C (COL3A1 signal peptide):

[0087] Amino acid sequence, SEQ ID NO.5:

[0088] MMSFVQKGSWLLLALLHPTIILA.

[0089] Nucleotide sequence, SEQ ID NO.6:

[0090] atgatgagctttgtgcaaaaggggagctggctacttctcgctctgcttcatcccactattattttggca.

[0091] Three expression plasmids, each integrating a signal peptide and a COL3A1 protein, were obtained and named pA-COL3A1, pB-COL3A1, and pC-COL3A1, respectively. The plasmid maps are shown below. Figure 1 As shown.

[0092] Example 2

[0093] Production and preparation of human type III collagen COL3A1 efficiently secreted and expressed by HEK-293T cells:

[0094] HEK-293T cells were seeded and plated one day in advance to ensure 80% confluence before transfection. For transfection, 20 μg of pA-COL3A1, pB-COL3A1, and pC-COL3A1 prepared in Example 1 were incubated with PEI transfection reagent to form transfection complexes. After incubation, the transfection complexes were added to the supernatant of the HEK-293T cell culture medium. After secretion by HEK-293T cells, the propeptide was cleaved to form mature single chains, and the three single chains formed a triple helix structure with a molecular weight of 390 kDa. The supernatant of the transfected HEK-293T cell culture medium was collected, and the COL3A1 protein corresponding to the elution peak was eluted and collected using a nickel ion affinity chromatography column to obtain recombinant human type III collagen COL3A1.

[0095] Example 3

[0096] Comparison of COL3A1 protein expression levels linked by different signal peptides:

[0097] Following the method described in Example 2, pA-COL3A1, pB-COL3A1, and pC-COL3A1 were transfected into HEK-293T cells, respectively. Cell culture supernatant was collected 72 hours after transfection, and the expression level of COL3A1 was compared using Western blotting. The results are as follows: Figure 2 As shown, when the total protein loading amount per well was consistent, among the COL3A1 proteins linked by signal peptide A, signal peptide B, and signal peptide C, the COL3A1 protein linked by signal peptide A had the highest expression level. Therefore, when expressing COL3A1 using HEK-293T cells, using COL3A1 linked by signal peptide A can achieve the maximum expression level of COL3A1.

[0098] Example 4

[0099] Comparison of the expression capacity of signal peptide A linking COL3A1 protein in different mammalian cells:

[0100] pA-COL3A1 was transfected into HEK-293T and CHO cells, respectively, using the same transfection method as in Example 2, and its expression differences in different mammalian cells were compared. One day before transfection, HEK-293T and CHO cells were seeded into 6-well plates to achieve 80% confluence before transfection. For transfection, 2 μg of pA-COL3A1 was incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added to the culture supernatant of HEK-293T and CHO cells, respectively, using the same amount of plasmid for both transfections. After transfection, the culture supernatant of HEK-293T and CHO cells was collected after 72 h, and the expression level of COL3A1 was compared using Western blotting. The results are as follows: Figure 3As shown, when the total protein loading amount per well was consistent, the expression level of the recombinant expression plasmid linking signal peptide A to COL3A1 in HEK 293T cells was significantly better than that in CHO cells. Therefore, using the recombinant plasmid linking signal peptide A to COL3A1 expressed in HEK-293T cells can efficiently secrete and express human type III collagen COL3A1.

[0101] Example 5

[0102] COL3A1 promotes fibroblast adhesion:

[0103] In Example 2, the COL3A1 protein was dissolved in PBS to a concentration of 1 mg / ml. For the cell adhesion assay, 100 μl of COL3A1 protein solution was added to each well of the experimental group, and PBS solution was used for the negative control group. The plates were coated overnight at 4°C, then incubated with 2% denatured BSA for 1 hour. The plates were then washed three times with serum-free medium to remove excess gel. Fibroblasts were digested, and 5000 cells were seeded in each well. A blank control (medium-only culture medium) was also included. The plates were incubated at 37°C for 2 hours. After 2 hours, the culture medium was removed from each well, and the cells were gently washed three times with PBS to remove non-adhered cells. 100 μl of medium containing 10% CCK-8 was added, and the plates were incubated at 37°C for another 2 hours. The absorbance at 450 nm was measured using a microplate reader, and the cell adhesion rate was calculated. Results are as follows: Figure 4 As shown, the cell adhesion rate of COL3A1 protein-coated well plates was significantly higher than that of PBS-coated well plates.

[0104] Example 6

[0105] COL3A1 promotes fibroblast proliferation:

[0106] The COL3A1 protein obtained in Example 2 was diluted with DMEM basal medium to the following concentrations: 4 μg / ml, 2 μg / ml, 1 μg / ml, 0.5 μg / ml, 0.25 μg / ml, 0.125 μg / ml, 0.0625 μg / ml, and 0 μg / ml (i.e., without COL3A1 protein). The sample group consisted of the above-mentioned diluted COL3A1, while the blank control group used DMEM basal medium, with three replicates per group. One day prior to the test, fibroblasts were seeded into 96-well plates at 2000 cells per well, with no cells seeded in the outer wells. PBS was added to prevent the inner medium from drying out. Cells were incubated overnight at 37°C. Each cell group was then incubated with a series of diluted COL3A1 protein concentrations and DMEM basal medium, and cultured for another 48 hours. After 48 hours, the culture medium in each well was removed, the cells were washed three times with PBS, and culture medium containing 10% CCK-8 was added. The cells were then incubated at 37°C for another 2 hours, and the absorbance at 450 nm was measured using a microplate reader. Results are as follows: Figure 5As shown, fibroblast proliferation activity gradually increases with increasing COL3A1 protein concentration.

[0107] Example 7

[0108] COL3A1 promotes fibroblast migration:

[0109] COL3A1 protein was dissolved in DMEM to a concentration of 1 mg / ml. In 12-well plates, the experimental group was coated with 500 μl of COL3A1 protein solution for 2 hours, while the negative control group was coated with DMEM without COL3A1. After coating each well, horizontal lines were evenly drawn on the back of the 12-well plate using a marker and a ruler. Fibroblasts in the logarithmic growth phase were then digested and counted. 3 x 10⁻⁶ cells were seeded in each well. 5 After cell adhesion was achieved, the confluence reached 100%. On the second day after plating, a 200µl pipette tip was used to make vertical scratches along the bottom line of the plate. The cells were then rinsed three times with PBS, and 1ml of complete culture medium was added before incubation at 37°C. Cells were observed and photographed at 0h, 6h, and 24h. Results are as follows: Figure 6 As shown, the area of ​​the scratch in the well plate coated with COL3A1 protein decreased significantly over time, and the wound healing rate was greater than that of fibroblasts without COL3A1 coated plate.

[0110] The nucleotide sequence of SEQ ID NO.7 is as follows:

[0111]

[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing COL3A1 protein, characterized in that, This includes using HEK-293T cells to express COL3A1 protein, with the FBLN1 protein signal peptide as the signal peptide for COL3A1 protein; The amino acid sequence of the FBLN1 protein signal peptide is shown in SEQ ID NO.1; HEK-293T cells were made to express a polynucleotide, wherein the polynucleotide contained, from the 5' end to the 3' end, a sequence encoding the FBLN1 protein signal peptide and a sequence encoding the COL3A1 protein, respectively; The nucleotide sequence encoding the FBLN1 protein signal peptide is shown in SEQ ID NO.2; The nucleotide sequence encoding the COL3A1 protein is shown in SEQ ID NO.

7.

2. The preparation method according to claim 1, characterized in that, The preparation method includes: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and causing the HEK-293T cells to express COL3A1 protein.

3. The preparation method according to claim 1, characterized in that, The preparation method also includes the formation of type III collagen from COL3A1 protein secreted and expressed in HEK-293T cells.

4. A polynucleotide, characterized in that, The polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the FBLN1 protein signal peptide and a sequence encoding the COL3A1 protein, respectively. The amino acid sequence of the FBLN1 protein signal peptide is shown in SEQ ID NO.1; The polynucleotide sequence encoding the FBLN1 protein signal peptide is shown in SEQ ID NO.2; The nucleotide sequence encoding the COL3A1 protein is shown in SEQ ID NO.

7.

5. A carrier, characterized in that, The vector carries the polynucleotide of claim 4.

6. Recombinant HEK-293T cells, characterized in that, The recombinant HEK-293T cells carry the polynucleotide of claim 4, or contain the vector of claim 5.

7. The use of the polynucleotide of claim 4, or the vector of claim 5, or the recombinant HEK-293T cells of claim 6 in the preparation of products for tissue regeneration or wound healing.

Citation Information

Patent Citations

  • Albumin fusion proteins

    CN102816241A

  • Recombinant human-derived III-type collagen as well as preparation method and application thereof

    CN119431608A