Neural stem cell exosome carrying Arc protein as well as preparation method and application of neural stem cell exosome

Abstract

The invention belongs to the technical field of exosomes, and particularly relates to a neural stem cell exosome carrying Arc protein as well as a preparation method and application of the neural stem cell exosome. According to the method, neural stem cells overexpress Arc genes through lentivirus transfection, cell supernatant is collected, exosomes are collected through a centrifugal method, and the exosomes carry Arc proteins. The lentiviral transfection method comprises the following steps: constructing an ARC gene into a lentiviral vector to obtain a recombinant lentiviral vector; and transfecting neural stem cells by using the recombinant lentiviral vector to obtain the neural stem cells capable of overexpressing the Arc gene. After entering the brain through the nasal cavity, the exosome specifically targets neuronal cells and is combined with the neuronal cells under the action of Arc protein; after the neuronal cells are fused with the Arc exosome membrane, the protein level of the neuronal cells Arc is increased, neuronal damage repair is promoted, cognitive impairment is improved, and the neuronal cells and other components in the exosome synergistically play a therapeutic role.

Description

Technical Field

[0001] The present invention belongs to the technical field of exosomes, and specifically relates to neural stem cell exosomes carrying Arc protein, and a preparation method and application thereof. Background Art

[0002] Stem cell exosomes have shown great potential in the treatment of neurological diseases. This emerging treatment method provides new hope for traditionally difficult-to-cure diseases. Studies have shown that exosomes derived from human umbilical cord mesenchymal stem cells (hucMSC-exosomes) can effectively reduce the abnormal deposition of amyloid protein in the brain and alleviate neuroinflammatory responses in AD mouse models, thereby improving the cognitive function of mice. The research of Wang Gang's research group at Ruijin Hospital further confirmed the safety and efficacy of allogeneic human adipose mesenchymal stem cell-derived exosomes nasal spray for the treatment of Alzheimer's disease in a phase I / II clinical trial. At the same time, some researchers have also enhanced their therapeutic effects by modifying engineered stem cells or exosomes to make them targeted.

[0003] Attaching functional peptides with targeting functions to exosomes through physical or chemical binding can enhance their targeting properties, but this can damage the exosomes to some extent, affecting their function or stability. Therefore, constructing stem cells with targeting functions and overexpressing targeting proteins on their membranes has largely addressed this issue. Recombinant Activity Regulated Cytoskeleton Associated Protein (Arc) is a cytoskeletal protein expressed in neurons and plays a crucial role in controlling large signaling networks involved in learning, memory consolidation, and behavior. Increasing Arc expression can restore neuronal damage and cognition. Furthermore, Arc is expressed only in neurons, so exosomes overexpressing Arc have targeted properties and can fuse with neuronal membranes. Arc can also repair damaged neurons, thus playing a dual role. Overexpressing Arc in stem cells reduces the need for manipulations and other chemical reagents, making in vivo experiments safer. Similarly, nanoparticles coated with the membranes of cells overexpressing Arc can also have targeting and neuronal repair effects. Summary of the Invention

[0004] To address the challenges of the existing technologies, the present invention provides neural stem cell exosomes carrying Arc protein, as well as methods for their preparation and application. This invention provides a novel, stable, safe, and effective exosome modification strategy with neuronal targeting and repair capabilities. This strategy utilizes the Arc gene to construct neuronal exosomes carrying Arc protein. This approach addresses the potential challenges of exosomes' lack of targeting and low utilization in the brain, addressing future research needs for neural stem cell exosomes and neurological diseases, from basic research to clinical translational applications.

[0005] The present invention is achieved through the following technical solutions:

[0006] A method for preparing neural stem cell exosomes carrying Arc protein, comprising overexpressing the Arc gene in neural stem cells through lentiviral transfection, collecting the cell supernatant, and collecting the exosomes by centrifugation, wherein the exosomes carry the Arc protein.

[0007] Furthermore, the lentiviral transfection method includes:

[0008] The ARC gene is constructed into a lentiviral vector to obtain a recombinant lentiviral vector;

[0009] The recombinant lentiviral vector is used to transfect neural stem cells to obtain neural stem cells capable of overexpressing the Arc gene.

[0010] Furthermore, the obtained recombinant lentiviral vector is pcSLenti-EF1α-EGFP-P2A-Puro-CMV-Arc-3xFLAG-WPRE.

[0011] Furthermore, during the transfection process, the titer of the lentivirus used was 1.5-3.0x10 8 TU / ml.

[0012] A neural stem cell exosome carrying Arc protein, wherein the neural stem cell exosome is prepared by the preparation method, and the neural stem cell exosome carries Arc protein.

[0013] An application of neural stem cell exosomes carrying Arc protein, wherein the neural stem cell exosomes are used in the preparation of a drug for preventing or treating ischemic stroke, Alzheimer's disease, Parkinson's disease, and cerebral infarction.

[0014] Furthermore, neural stem cell exosomes are delivered into the brain through the nasal cavity; under the action of the carried Arc protein, the neural stem cell exosomes fuse with the neuronal cell membrane, and the neurons absorb the Arc protein to promote the repair of neurons. The effective ingredients in the neural stem cell exosomes are absorbed by the neurons and then repair the damaged neurons.

[0015] Beneficial technical effects of the present invention:

[0016] The neural stem cell exosomes provided by the present invention carry Arc protein, which can be targeted and delivered to neuronal cells, promote the secretion of neural factors, reduce synaptic damage and neuronal cell inflammation levels, repair neuronal damage, and alleviate cognitive function and behavioral disorders.

[0017] The neural stem cell exosomes provided by the present invention can be used to prepare nanomedicines, which are suitable for neuronal damage diseases including ischemic stroke, Alzheimer's disease, Parkinson's disease, cerebral infarction, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a map of the recombinant lentiviral vector in the embodiment of the present invention;

[0019] Figure 2 The Western blot results in the examples of the present invention are shown below:

[0020] Figure 3 This is an electron micrograph of exosomes in an embodiment of the present invention;

[0021] Figure 4 is the particle size of exosomes in the embodiment of the present invention;

[0022] Figure 5 This is the analysis of exosome membrane potential in the embodiment of the present invention;

[0023] Figure 6 This is the flow cytometry detection of exosome uptake by HT22 cells in the embodiment of the present invention;

[0024] Figure 7 is the NGF content in the cell supernatant in the embodiment of the present invention;

[0025] Figure 8 is the BDNF content in the cell supernatant of the embodiment of the present invention;

[0026] Figure 9 is the TNF-α content in the cell supernatant of the embodiment of the present invention;

[0027] Figure 10 IL-10 content in the cell supernatant in the embodiment of the present invention;

[0028] Figure 11 is the number of times the mouse crosses the platform within 1 minute in the embodiment of the present invention;

[0029] Figure 12 is the NGF content in brain tissue in the embodiment of the present invention;

[0030] Figure 13is the BDNF content in brain tissue in the embodiment of the present invention;

[0031] Figure 14 The content of TNF-α and IL-10 in brain tissue in the embodiment of the present invention;

[0032] Figure 15 The content of TNF-α and IL-10 in brain tissue in the embodiment of the present invention;

[0033] Figure 16 This is the in vivo imaging of small animals to observe the residence time and distribution of exosomes in the brain in an embodiment of the present invention;

[0034] Figure 17 This is the enrichment of the Arc-exo protein pathway in the embodiment of the present invention. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0036] On the contrary, the present invention covers any alternatives, modifications, equivalents, and solutions that fall within the spirit and scope of the present invention as defined by the claims. Furthermore, to facilitate a better understanding of the present invention, certain specific details are described in detail below in the detailed description of the present invention. Those skilled in the art will be able to fully understand the present invention without these details.

[0037] Example 1: A method for preparing neural stem cell exosomes carrying Arc protein, wherein the method comprises overexpressing the Arc gene in neural stem cells through lentiviral transfection, collecting the cell supernatant, and collecting the exosomes by centrifugation, wherein the exosomes carry Arc protein.

[0038] In the present invention, the neural stem cells include any one of mouse neural stem cells and human neural stem cells;

[0039] Among them, collecting exosomes by centrifugation is a conventional method, which specifically includes: collecting cell supernatant, centrifuging to remove floating cells, dead cells, and cell debris, centrifuging again to collect the precipitate, washing impurities with PBS and resuspending to obtain exosomes.

[0040] In this embodiment, the lentiviral transfection method includes:

[0041] The ARC gene is constructed into a lentiviral vector to obtain a recombinant lentiviral vector;

[0042] The recombinant lentiviral vector is used to infect neural stem cells to obtain neural stem cells capable of overexpressing the Arc gene.

[0043] In this embodiment, it is characterized in that the obtained recombinant lentiviral vector is pcSLenti-EF1α-EGFP-P2A-Puro-CMV-Arc-3xFLAG-WPRE.

[0044] The Arc genes used include mouse Arc genes and human Arc genes; when mouse neural stem cells are used, a recombinant lentiviral vector containing the mouse ARC gene sequence is constructed, and when human neural stem cells are used, a recombinant lentiviral vector containing the human ARC gene sequence is constructed; the difference between the construction methods of the two lentiviral vectors lies only in the difference in the ARC gene sequences used.

[0045] In this embodiment, a recombinant lentiviral vector containing a mouse ARC gene sequence is constructed as an example. The construction method includes: obtaining a mouse ARC gene sequence through database screening, and constructing an ARC effective gene based on the ARC gene sequence. The sequence of the constructed ARC effective gene is shown in SEQ ID NO. 1.

[0046] The ARC gene (i.e., the effective ARC gene) was constructed into a lentiviral vector to obtain a recombinant lentiviral vector pcSLenti-EF1α-EGFP-P2A-Puro-CMV-Arc-3xFLAG-WPRE (e.g., Figure 1 shown).

[0047] The Arc gene-containing recombinant lentiviral vector was constructed using the empty vector pcSLenti-EF1α-EGFP-P2A-Puro-CMV-Arc-3xFLAG-WPRE. The Arc gene was inserted at the EcoRI site, and the effective fragment was sequenced to verify the recombinant plasmid vector. The forward sequencing primer used for sequencing verification was CMV-F: CGCAAATGGGCGGTAGGCGTG (shown in SEQ ID NO. 2); the reverse sequencing primer was WPRE-R: CATAGCGTAAAAGGAGCAACA (shown in SEQ ID NO. 3).

[0048] In this example, the titer of the lentivirus used in the transfection process was 1.5-3.0x10 8 TU / ml. The titration of the lentivirus is specifically determined by a lentivirus titration experiment.

[0049] The constructed recombinant lentiviral vector is used to transfect mouse neural stem cells, and the specific mouse neural stem cells used are C17.2 (NSC).

[0050] The culture method of the mouse neural stem cells is as follows: a complete culture medium (DMEM+10% fetal bovine serum (FBS)+1% penicillin and streptomycin (100 IU / mL)).

[0051] The specific steps of using the constructed recombinant lentiviral vector to transfect mouse neural stem cells are as follows:

[0052] Mouse neural stem cells C17.2 were selected for lentiviral transfection of Arc gene, and C17.2 cells were divided into 2.5×10 5 cells / mL cell suspension was inoculated into 6-well plates at a confluence of 30%, with 2 mL per well, i.e., 5×10 5 cells / well in a 6-well plate. Add 10 μL of 1 mg / mL polybrene to each well, for a final polybrene concentration of 5 μg / mL in the cell sample. Change the medium 12-20 hours after transfection: discard the medium and add 2 mL of fresh medium to each well. After 72 hours, add puromycin to a final concentration of 2 μg / mL. Change the medium every 2-3 days to fresh puromycin at a final concentration of 2 μg / mL. After approximately two weeks of drug screening, neural stem cells overexpressing Arc were successfully constructed.

[0053] In this example, the serum-free culture medium of neural stem cells overexpressing Arc protein was centrifuged to remove cell debris, and the supernatant was ultracentrifuged to obtain neural stem cell exosomes carrying Arc protein. The collection process is as follows:

[0054] Arc-overexpressing neural stem cells were cultured in complete medium in T225 cell culture flasks, and supernatants were collected every three days. (B) Removal of cell debris. The collected supernatant was aliquoted into 50 mL centrifuge tubes, balanced, and centrifuged at 300 g / min for 10 min. The supernatant was removed and transferred to a new 50 mL centrifuge tube, balanced, and centrifuged at 2000 g / min for 10 min. The supernatant was removed and transferred to a new 50 mL centrifuge tube, balanced, and centrifuged at 10,000 g / min for 10 min. (C) Ultracentrifugation. The supernatant was removed and transferred to a new 29 mL ultracentrifuge tube, balanced (to within 0.001 mg), and centrifuged at 100,000 g / min for 70 min. (D) Washing the pellet. The supernatant was discarded, and the pellet (exosomes) was resuspended in PBS and collected into a new 29 mL ultracentrifuge tube, balanced, and centrifuged at 100,000 g / min for 70 min. The supernatant was discarded, and the exosomes were resuspended in 200 μL PBS and stored in a -80°C refrigerator.

[0055] In the embodiment of the present invention, a control lentiviral vector pcSLenti-EF1-EGFP-P2A-Puro-CMV-MCS-3xFLAG-WPRE was provided; and the control lentiviral vector was used to transfect stem cells under the same conditions.

[0056] Detection of Arc expression in cells, such as Figure 2 The following are Western blot images. NSC represents normal neural stem cells, the negative control represents neural stem cells transfected with a control lentiviral vector, and Arc-NSC represents neural stem cells transfected with the recombinant lentiviral vector of the present invention. As can be seen, both normal neural stem cells and neural stem cells transfected with the control lentiviral vector do not express the target protein, while neural stem cells transfected with the recombinant lentiviral vector of the present invention (Arc-NSC group) express Arc protein. The Arc protein is predicted to be approximately 60 kDa, and a protein band was detected between 50 and 70 kDa of the marker. Therefore, mouse neural stem cells overexpressing Arc were successfully constructed.

[0057] Figure 3 Electron micrograph of exosomes. Figure 4-Figure 5 For analysis of exosome size and membrane potential; Figure 3 and Figure 4-Figure 5 It can be seen that after overexpression of Arc, there is no obvious change in the morphology of exosomes, and there is no significant difference in their particle size and membrane potential.

[0058] Example 2: Functional verification of an in vitro model of neural stem cell exosomes carrying Arc protein.

[0059] Figure 6 NC represents untreated normal cells, NSC-exo represents exosomes secreted by neural stem cells after transfection with the control lentiviral vector, and Arc-exo represents exosomes secreted by neural stem cells after transfection with the recombinant lentiviral vector of the present invention (with Arc protein on the surface); Figure 6 It can be seen that the Arc-exo group bound more to HT22 cells, indicating that Arc can target and bind to neuronal cells.

[0060] Figure 7-10 Here, "Control" represents HT22 cells, "Model" represents Aβ-treated HT22 cells, "NSC-exo" represents exosomes secreted by neural stem cells after transfection with a control lentiviral vector and treated with Aβ-treated HT22 cells, and "Arc-exo" represents exosomes secreted by neural stem cells after transfection with the recombinant lentiviral vector of the present invention and treated with Aβ-treated HT22 cells. ELISA results show that exosomes carrying Arc protein on their surface promote the expression of the neurotrophic factors NGF and BDNF in HT22 cells. They also reduce the expression of the inflammatory factor TNF-α and promote the expression of IL-10 in HT22 cells.

[0061] Example 3: Application of neural stem cell exosomes carrying Arc protein, wherein the neural stem cell exosomes are used in the preparation of drugs for preventing or treating ischemic stroke, Alzheimer's disease, Parkinson's disease, and cerebral infarction.

[0062] In this example, neural stem cell exosomes were delivered to the brain via the nasal cavity. Under the action of the Arc protein carried by the exosomes, the neural stem cell exosomes fused with the neuronal cell membrane. After the neurons took up the Arc protein, they promoted neuronal repair. The active ingredients in the neural stem cell exosomes were also taken up by the neurons and then repaired the damaged neurons. Specifically, Arc proteomics showed that Arc-exo can promote cellular autophagy and reduce neuronal damage. The active ingredients in the neural stem cell exosomes include NGF and BDNF neurotrophic factors.

[0063] Specifically, the exosome concentration delivered through the nasal cavity is: the exosome concentration is 0.5-4 mg / ml (preferably 1 mg / ml), and the nasal drops are treated twice a week for 4 consecutive weeks;

[0064] The total amount of exosomes used in each nasal drop treatment was 10-30 μl, which was completed in two doses with an interval of 5-10 minutes (5-15 μl each time).

[0065] Figure 11 Here, "Control" represents C57 mice, "Model" represents 5xFAD mice, "NSC-exo" represents 5xFAD mice treated with exosomes secreted by neural stem cells after transfection with a control lentiviral vector, and "Arc-exo" represents 5xFAD mice treated with exosomes secreted by neural stem cells after transfection with the recombinant lentiviral vector of the present invention. Mouse water maze results showed that compared with normal exosomes, treatment with Arc-overexpressing neural stem cell exosomes significantly increased the number of platform crossings per minute in mice, indicating that Arc-exo is more effective in improving cognitive dysfunction in mice.

[0066] Figure 12-13 Here, "Control" represents C57 mice, "Model" represents 5xFAD mice, "NSC-exo" represents 5xFAD mice treated with exosomes secreted by neural stem cells after transfection with a control lentiviral vector, and "Arc-exo" represents 5xFAD mice treated with exosomes secreted by neural stem cells after transfection with the recombinant lentiviral vector of the present invention. ELISA results showed that compared with the control group, the levels of the neurotrophic factors NGF and BDNF in the brains of 5xFAD mice were significantly decreased. However, after treatment with exo and Arc-exo, the levels of these neurotrophic factors increased significantly. Furthermore, compared with the exo group, the Arc-exo group showed a more pronounced increase in neurotrophic factor levels, indicating a better therapeutic effect, indicating that Arc-exo has a more potent neuronal repair effect.

[0067] Figure 14-15 In the middle, Control represents C57 mice, Model represents 5xFAD mice, NSC-exo represents 5xFAD mice treated with exosomes secreted by neural stem cells after transfection with the control lentiviral vector, and Arc-exo represents 5xFAD mice treated with exosomes secreted by neural stem cells after transfection with the recombinant lentiviral vector of the present invention. The results of ELISA showed that compared with the control group, the content of the pro-inflammatory factor TNF-α in the brain of 5xFAD mice was significantly increased, and the content of the anti-inflammatory factor IL-10 was significantly decreased. After treatment with exo and Arc-exo, the level of neuroinflammation was significantly reduced. At the same time, compared with the exo group, the IL-10 content in the Arc-exo group increased more significantly, and the TNF-α decreased more significantly, and the therapeutic effect was better. Compared with the exo group, the Arc-exo group has enhanced its ability to regulate neuroinflammation,

[0068] Figure 16 NSC-exo represents the exosomes secreted by neural stem cells after transfection with the control lentiviral vector and treated with 5xFAD mice, and Arc-exo represents the exosomes secreted by neural stem cells after transfection with the recombinant lentiviral vector of the present invention and treated with 5xFAD mice. The results of in vivo imaging of small animals showed that both exo and Arc-exo were able to enter the brain at the 1-hour time point and reached peak values ​​at the 3- and 6-hour time points, but within the 12-48-hour time point, the residence time of exo in the brain was significantly reduced and disappeared at the 48-hour time point. Compared with the exo group, the residence time of exosomes in the Arc-exo group in the brain was significantly prolonged, and fluorescent signals could still be observed at the 48-hour time point; this indicates that Arc-exo binds to neuronal cells and the number of resident exosomes increases. Compared with the exo group, the amount of exosomes in the Arc-exo group retained in the brain increased significantly at 1, 3, and 6 hours, and the degradation rate slowed down at subsequent time points, resulting in a longer retention time in the brain. This is because the action of Arc enables Arc-exo to bind more to neuronal cells and be cleared less.

[0069] Figure 17 Quantitative analysis and functional enrichment of proteins in Arc-exo were performed, and the functions of the proteins mainly include regulating autophagy levels, neurodegeneration, Alzheimer's disease, oxidative stress, etc. This suggests that Arc-exo may improve Alzheimer's disease through the above pathways.

[0070] It can be seen that after the exosomes provided in the present invention enter the brain through the nasal cavity, they specifically target and bind to neuronal cells under the action of Arc protein; after the neuronal cells fuse with the exosome membrane carrying Arc protein, the level of Arc protein in the neuronal cells is increased (Arc protein is a skeletal protein of nerve cells and has the function of neuronal repair itself), promoting the repair of neuronal damage and improving cognitive dysfunction, and synergizing with other components in the exosomes (including NGF and BDNF neural factors) to exert a therapeutic effect.

[0071] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing neural stem cell exosomes carrying Arc protein, characterized in that: The method involves overexpressing the Arc gene in neural stem cells through lentiviral transfection, collecting the cell supernatant, and collecting exosomes by centrifugation, wherein the exosomes carry the Arc protein.

2. The method for preparing neural stem cell exosomes carrying Arc protein according to claim 1, characterized in that: The lentiviral transfection method comprises: The ARC gene is constructed into a lentiviral vector to obtain a recombinant lentiviral vector; The recombinant lentiviral vector is used to transfect neural stem cells to obtain neural stem cells capable of overexpressing the Arc gene.

3. The method for preparing neural stem cell exosomes carrying Arc protein according to claim 1, characterized in that: The obtained recombinant lentiviral vector is pcSLenti-EF1α-EGFP-P2A-Puro-CMV-Arc-3xFLAG-WPRE.

4. The method for preparing neural stem cell exosomes carrying Arc protein according to claim 1, characterized in that: During the transfection process, the titer of the lentivirus used was 1.5-3.0x10 8 TU / ml.

5. A neural stem cell exosome carrying Arc protein, characterized in that: The neural stem cell exosomes are prepared by the preparation method according to any one of claims 1 to 4, and the neural stem cell exosomes carry Arc protein.

6. The use of neural stem cell exosomes carrying Arc protein according to claim 4, characterized in that: The neural stem cell exosomes are used in the preparation of drugs for preventing or treating ischemic stroke, Alzheimer's disease, Parkinson's disease, and cerebral infarction.

7. The use according to claim 6, characterized in that Neural stem cell exosomes are delivered into the brain through the nasal cavity; under the action of the Arc protein they carry, the neural stem cell exosomes fuse with the neuronal cell membrane. After the neuronal cells absorb the Arc protein, it promotes the repair of neurons, and the effective ingredients in the neural stem cell exosomes are absorbed by the neuronal cells to repair damaged neurons.

Images