Application of molecular markers related to pig 30kg-120kg stage daily gain trait
By detecting the SNP site at position 161610871 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, TT genotype pigs were identified and selected as parents, solving the breeding problem of daily weight gain traits in pigs in the 30kg-120kg stage and achieving efficient and accurate breeding results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2026-03-24
AI Technical Summary
Existing technologies make it difficult to efficiently and accurately measure and select for the daily weight gain trait of pigs in the 30kg-120kg stage, resulting in high breeding costs and difficulties.
By detecting the SNP site (C/T) at position 161610871 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, specific primers were designed for PCR amplification and sequencing to identify the pig genotype, and pigs with the TT genotype were selected as parents for breeding.
It significantly improves breeding efficiency, shortens the breeding cycle, reduces breeding costs, and increases the daily weight gain of pigs in the 30kg-120kg stage by approximately 0.12kg/day.
Smart Images

Figure CN120591418B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of molecular markers related to the daily weight gain traits of pigs in the 30kg-120kg stage. Background Technology
[0002] Statistics from the Food and Agriculture Organization of the United Nations (FAO) show that pork consumption accounts for one-third of all human meat consumption, and pork production is closely related to human protein intake. Daily weight gain refers to the average daily weight gain of pigs during the fattening stage, which is generally selected by companies as the 30kg-120kg stage. Daily weight gain during this stage directly represents the production value of pigs and can directly affect the profits of pig farms. Major domestic and international companies include daily weight gain or similar traits in their breeding goals, such as reaching 120kg in age. In my country's new round of genetic improvement program (2021-2035), daily weight gain during the 30kg-120kg stage has become one of the main performance indicators for lean-type pigs.
[0003] Measuring daily weight gain requires specialized equipment and spans the entire fattening stage, increasing breeding costs and posing significant challenges. However, the rapid advancements in molecular biotechnology and porcine genome association studies have provided methods for identifying and developing molecular markers for daily weight gain, enabling more accurate and rapid selection of quantitative traits such as daily weight gain. Currently, some studies have explored genes related to daily weight gain. For example, Zhou et al. (2021, Reference: Zhou S, Ding R, Meng F, Wang X, Zhuang Z, Quan J, Geng Q, Wu J, Zheng E, Wu Z, Yang J, Yang JA meta-analysis of genome-wide association studies for average daily gain and lean meat percentage in two Duroc pig populations. BMC Genomics. 2021 Jan 6; 22(1):12..) conducted a meta-analysis of daily weight gain in Duroc pigs and found 10 significantly associated polymorphic markers on chromosomes 1, 3, 7 and 14 of the pig. Liao et al. (2022, Reference: Liao W, Wang Y, Qiao X, Zhang X, Deng H, Zhang C, Li J, Yuan X, Zhang H. APoly(dA:dT)Tract in the IGF1 Gene Is a Genetic Marker for Growth Traits in Pigs. Animals (Basel). 2022 Nov 27; 12(23):3316..) have shown that two mutations in the IGF1 gene can be used as candidate genes for growth rate, such as daily weight gain. Since daily weight gain is a trait controlled by multiple genes, its breeding-related molecular markers need further development. Summary of the Invention
[0004] The purpose of this invention is to provide molecular marker applications related to daily weight gain in pigs during the 30kg-120kg stage;
[0005] Another object of the present invention is to provide a method for identifying or assisting in identifying the daily weight gain of pigs in the 30kg-120kg stage;
[0006] Another object of the present invention is to provide a breeding method for selecting pigs with high daily weight gain in the 30kg-120kg range.
[0007] This invention is implemented as follows:
[0008] The application of molecular markers related to daily weight gain in pigs during the 30kg-120kg period is any one of the following A1) to A8):
[0009] A1) Testing or auxiliary testing of daily weight gain in pigs during the 30kg-120kg stage;
[0010] A2) Identification and auxiliary identification of daily weight gain in pigs during the 30kg-120kg stage;
[0011] A3) Pig breeding;
[0012] A4) Detection or auxiliary detection of SNP polymorphisms or genotypes;
[0013] A5) Prepare products for detecting or assisting in the detection of daily weight gain in pigs during the 30kg-120kg stage;
[0014] A6) Prepare and identify products for the daily weight gain of pigs in the 30kg-120kg stage;
[0015] A7) Preparation of pig breeding products;
[0016] A8) Prepare products for detecting or assisting in the detection of SNP polymorphisms or genotypes;
[0017] The molecular marker corresponds to the SNP site at position 161610871 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, as shown in sequence SEQ ID NO:1, which is the nucleotide at position 155 bp of the DNA molecule, and its nucleotide type is C or T.
[0018] Methods for identifying or assisting in the identification of average daily weight gain in pigs during the 30kg-120kg stage include the following steps:
[0019] S1 extracts genomic DNA from the pigs to be tested as a template;
[0020] S2 designed primers targeting the 155bp site of the DNA molecule shown in SEQ ID NO.1 for PCR amplification;
[0021] S3 detects the genotype at the 155bp site of the sequence of SEQ ID NO.1 of the pig to be tested;
[0022] S4 uses the genotype obtained in step S3 to identify or assist in identifying the daily weight gain of the pigs in the 30kg-120kg stage. Pigs with the TT genotype are larger than those with the CT genotype, and pigs with the CT genotype are larger than those with the CC genotype.
[0023] Preferably, the primer sequences described in step S2 are as shown in SEQ ID NO.2 and SEQ ID NO.3.
[0024] A breeding method for selecting pigs with high daily weight gain in the 30kg-120kg range involves identifying the genotype of the pigs to be tested using the aforementioned method, and selecting the TT genotype pigs as parents for breeding. The TT genotype is a homozygous type where the 155th bp of the SEQ ID NO.1 sequence is T.
[0025] Preferably, the product used in the aforementioned application of molecular markers related to daily weight gain in pigs during the 30kg-120kg stage is a reagent kit.
[0026] The daily weight gain (ADG) of pigs in the 30kg-120kg range described in this invention is a method of representing pig growth rate, referring to the weight gain of a pig each day. Specifically, this invention focuses on the daily weight gain of the pigs in the 30kg-120kg range. The purpose of this pig breeding method is to select breeding pigs with a larger daily weight gain in the 30kg-120kg range. The SNP mentioned is located at position 161610871 on chromosome 1 in the reference genome Sus_scrofa.Sscrofa11.1, and is named the C161610871T locus. Those skilled in the art will understand that SEQ ID NO:1 is composed of the 155th nucleotide of the SNP site SEQ ID NO:1 and its surrounding nucleotide sequence. The amount of nucleotides surrounding the SNP site should not be considered a limiting factor in the scope of protection of this invention. It can be 25bp, 35bp, 45bp, 65bp, 85bp, 100bp, 150bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, or 1000bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the SNP on chromosome 1 of the pig reference genome. The "before" or "after" in this invention should be defined in a direction generally accepted by those skilled in the art, such as the 5'-3' direction. The identification, assistance in identification, or improvement of pig growth rate traits described in this invention includes, but is not limited to, identifying or assisting in identifying test pigs with the aforementioned SNP genotype TT for feeding or breeding. In the above method, a portion of the pig genome containing the aforementioned SNP can be amplified by PCR. If the PCR product containing SEQ ID NO:1 is sequenced, the type of deoxyribonucleotide at position 155 of SEQ ID NO:1 can be detected to determine the genotype of the SNP site described in the pig genome to be tested.
[0027] This invention uses gene sequencing to detect C161610871T. Only a PCR reaction is required; sequencing alone can determine the genotype of an individual. Genotyping is highly accurate, and the testing cost is low, making it highly valuable for breeding practice. Using this method to select for the daily weight gain trait in pigs, TT genotype pigs can achieve approximately 0.12 kg / day more daily weight gain than CC genotype pigs. Applying the method provided by this invention to pig breeding allows for early screening of potential pigs, effectively alleviating the problem of long selection times for superior breeding stock in actual production, reducing breeding costs, and effectively improving the growth rate of pigs in actual production. The detection method of this invention is simple to operate, inexpensive, highly accurate, and can achieve automated direct detection. This invention will play a significant role in pig breeding.
[0028] The beneficial effects of this invention are as follows: This invention discovers the C / T locus at position 161610871 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, which has a significant impact on the daily weight gain of pigs in the 30kg-120kg stage. Based on this SNP locus, a method for identifying or assisting in the identification of daily weight gain in pigs in the 30kg-120kg stage is provided. This provides a new molecular breeding marker for marker-assisted breeding of the daily weight gain trait in pigs in the 30kg-120kg stage, which is beneficial to improving breeding efficiency, effectively shortening the breeding cycle, and is of great significance for selecting superior pig breeds. Attached Figure Description
[0029] Figure 1 This is a QQ diagram representing the data structure of genome-wide association analysis in this invention embodiment;
[0030] Figure 2 This is a Manhattan diagram of genome-wide association analysis in an embodiment of the present invention. Detailed Implementation
[0031] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0033] The data in the following examples were processed using SAS 9.0 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference.
[0034] All animals in the following examples were sourced from Henan Yifa Animal Husbandry Co., Ltd.
[0035] In the following examples, the daily weight gain of pigs from 30kg to 120kg refers to the daily weight gain from when the pig reaches a weight of 30kg to when the pig reaches a weight of 120kg.
[0036] Example 1: Determination of SNP sites on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1
[0037] The inventors previously conducted whole-genome sequencing on 300 pigs and a genome-wide association study (GWAS) of the 30kg-120kg daily weight gain trait. The model used was: Y = μ + G + B + P + e, where Y is the trait value; μ is the population mean; G is the genotype effect; B is the batch effect; and P is the farm-year-season effect. The results identified 20 SNP loci significantly associated with daily weight gain of 30kg-120kg, such as... Figure 1 and Figure 2 As shown, the inventors designed primers for amplification within a 200bp range upstream and downstream of the five most prominent sites, and found that only the sequence containing one site on stain 1 could be amplified well.
[0038] After amplification, alignment was performed using Seqman software, revealing a differentially expressed site (SNP) named C161610871T. This site is located at nucleotide 161610871 on chromosome 1 of the porcine reference genome Sus_scrofa.Sscrofa11.1, which is nucleotide 155 of sequence SEQ ID NO:1. The nucleotide type of C161610871T is either T or C, and the genotype is TT, CC, or CT. The TT genotype at C161610871T is homozygous for T. The CC genotype at C161610871T is homozygous for C. The CT genotype at C161610871T is heterozygous for both T and C.
[0039] Example 2: Correlation analysis of the C161610871T locus on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 with the daily weight gain of pigs in the 30kg-120kg stage.
[0040] To determine whether the C161610871T locus on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 is related to the daily weight gain of pigs in the 30kg-120kg range, 1173 Large White pigs were used as experimental materials. The genotype of the SNP locus in Example 1 and the daily weight gain of each individual in the 30kg-120kg range were measured, and correlation analysis was performed.
[0041] I. Genotype Identification
[0042] 1. PCR amplification
[0043] Based on the SNP information on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, a pair of primers was designed as follows:
[0044] Upstream primer F: 5'-GTCTCTTGATTCCTAGTGGTATGT-3' (SEQ ID NO:2);
[0045] Downstream primer R: 5'-AAGTTCCATGTTGACAGTCTCA-3' (SEQ ID NO:3).
[0046] Using the genomic DNA of each Large White pig as a template, PCR amplification was performed using the primers described above to obtain PCR products.
[0047] 2. Cloning, sequencing, and sequence analysis
[0048] The PCR products from each individual were purified using an agarose gel extraction kit (Tiangen Biotech Co., Ltd.). The recovered DNA fragments were ligated into the pGEM-T vector (Promega), and the ligation product was transformed into *E. coli* DH5α competent cells (Mingri Biotech (Beijing) Co., Ltd.). Positive clones were screened based on the carbenicillin resistance marker on the vector to obtain recombinant plasmids containing the recovered fragments. The nucleotide sequence of this recombinant plasmid vector was determined using the T7 and SP6 promoter sequences as primers (Invitrogen (Shanghai) Trading Co., Ltd.).
[0049] The genotypes of the pigs to be tested are as follows:
[0050] TT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains only a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide T at position 155 of SEQ ID NO:1, and does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide C at position 155 of SEQ ID NO:1, then the genotype of the C161610871T site on chromosome 1 of the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the pig to be tested is TT.
[0051] CC genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide 155 of SEQ ID NO:1 being T, and only contains a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide 155 of SEQ ID NO:1 being C, then the genotype of the C161610871T site on chromosome 1 of the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is CC.
[0052] CT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains both a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide C at position 155 of SEQ ID NO:1 and a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide T at position 155 of SEQ ID NO:1, then the genotype of the C161610871T site on chromosome 1 of the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is CT.
[0053] The results are shown in Table 2. Genotyping of the C161610871T locus in 1173 Large White pigs showed that 304 pigs had the TT genotype, 520 had the CC genotype, and 349 had the CT genotype. The genotype and allele frequencies of the C161610871T locus in the tested pig population are shown in Table 1. As can be seen from Table 1, this locus has a high heterozygosity and great potential for breeding.
[0054] Table 1. Genotype and allele frequencies of the C161610871T locus in the tested pig population.
[0055]
[0056] II. Association Analysis between Pig Genotype and Daily Weight Gain in Pigs (30kg-120kg)
[0057] Daily weight gain in pigs during the 30kg-120kg period was measured using an Osborn automated measurement device. SAS software was used for genotype-phenotype association analysis, and Duncan's multiple test was used for significance testing (P<0.05). Data are expressed as mean ± standard error, and P<0.05 was considered statistically significant.
[0058] The results are shown in Table 2. The SNP (C161610871T) locus significantly affected the daily weight gain of pigs in the 30kg-120kg range. Pigs with the TT genotype had a greater daily weight gain in the 30kg-120kg range than those with the CT genotype, and pigs with the CT genotype had a greater daily weight gain in the 30kg-120kg range than those with the CC genotype. Furthermore, the daily weight gain of pigs with the TT genotype in the 30kg-120kg range was significantly greater than that of pigs with the CC genotype (P<0.05). In practical pig breeding, the daily weight gain in the 30kg-120kg range can be used as an auxiliary selection method based on the SNP161610871T locus genotyping results.
[0059] Table 2. Association analysis of single nucleotide polymorphisms on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) with daily weight gain between 30kg and 120kg.
[0060] genotype Sample size Daily weight gain of 30kg-120kg TT 304 1051.40±117.69a CT 520 1012.62±108.63b CC 349 978.97±102.61b
[0061] Note: Different lowercase letters in the table indicate significant differences (P<0.05), and the same letter indicates no significant differences (P>0.05). Values are expressed as mean ± standard error.
[0062] In summary, determining the genotype of the C161610871T locus on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) can help identify the daily weight gain of pigs in the 30kg-120kg range.
[0063] Pigs with the TT genotype have a greater daily weight gain of 30kg-120kg than pigs with the CT genotype, and pigs with the CT genotype have a greater daily weight gain of 30kg-120kg than pigs with the CC genotype. (See S4 of claim 2) In actual breeding work, pigs with the TT genotype at the SNP (C161610871T) locus can be selected as parents for breeding.
[0064] SEQ ID NO:1
[0065] 5'-GTCTCTTGATTCCTAGTGGTATGTTCTTTTCACACTGTTCAAGCTTTCTAACATTTGTAAACTAGTAAAAATACATGACAGTTTTTAAAAAGAAAATATGCAAATCTTAGAGGTATTTGAAAAAGAACATTATGAGAATCAAAAAGTTGATTTGW CTTTTAAGCTGTAATCTCCTTGCTCCTGCCCCTTGAATTTCTAGTGTTGGTGGCAGCTTTAATTTTTTTGGCAGAGCTATTTCATCTTCAAAAGCTAAGGGGGGTATTAGAAGCCCCTAAAATTTAAAAGTTGAGACTGTCAACATGGAACTT-3'.
[0066] Wherein, W is C or T.
[0067] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The application of molecular markers related to daily weight gain in pigs during the 30kg-120kg stage, characterized in that, The application is any one of the following A1 to A4: A1. To detect or assist in detecting the daily weight gain of pigs in the 30kg-120kg stage; A2. Identification and auxiliary identification of daily weight gain in pigs during the 30kg-120kg stage; A3. Prepare products for detecting or assisting in the detection of daily weight gain in pigs during the 30kg-120kg stage; A4. Products for the preparation, identification, and auxiliary identification of daily weight gain in pigs during the 30kg-120kg stage; The molecular marker corresponds to the SNP site at position 161610871 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, as shown in sequence SEQ ID NO:1, which is the nucleotide at position 155 bp of the DNA molecule, and its nucleotide type is C or T.
2. A method for identifying or assisting in identifying the average daily weight gain of pigs in the 30kg-120kg stage, characterized in that, Includes the following steps: S1. Extract genomic DNA from the pig to be tested as a template; S2. Design primers targeting the 155bp site of the DNA molecule shown in SEQ ID NO.1 for PCR amplification; S3. Detect the genotype at the 155bp site of the pig sequence SEQ ID NO.1 to be tested; S4. Identify or assist in identifying the genotypes obtained in step S3. The daily weight gain of the pigs in the 30kg-120kg stage is greater than that of the TT genotype pigs, and the CT genotype pigs are greater than those of the CC genotype pigs.
3. The method according to claim 2, characterized in that, The sequences of the primers described in step S2 are shown in SEQ ID NO.2 and SEQ ID NO.
3.
4. A breeding method for selecting pigs with high daily weight gain in the 30kg-120kg range, characterized in that, The genotype of the pig to be tested is identified according to the method of claim 2 or 3, and the pig to be tested with the TT genotype is selected as the parent for breeding, wherein the TT genotype is a homozygous type where the 155th bp of the SEQ ID NO.1 sequence is T.
5. The application of the molecular markers related to daily weight gain in pigs during the 30kg-120kg stage according to claim 1, characterized in that, The product in question is a reagent kit.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker combination for pig genotyping and application of SNP molecular marker combination
CN118600012A