Lsnaa15-16 gene, dsrna and application thereof in preventing and treating lasioderma serricorne

By targeting and silencing the LsNAA15-16 gene in the tobacco beetle, a water-soluble RNA biopesticide formulation developed using RNA interference technology has solved the problem of high efficiency in the control of the tobacco beetle, achieving a highly effective killing effect.

CN120608076BActive Publication Date: 2026-04-07SHANGHAI PLANT SCI BIOTECHNOLOGY LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Current technologies lack efficient application of RNA biopesticides developed using RNA interference technology in the control of tobacco beetle, which causes serious damage to tobacco and other stored products.

Method used

The LsNAA15-16 gene and its corresponding dsRNA were provided. The Nα-acetyl-L-ornithine transferase in tobacco beetle was silenced by RNA interference technology. The dsRNA was synthesized and a water-soluble RNA biopesticide was prepared and sprayed on tobacco leaves to kill tobacco beetle.

Benefits of technology

It achieved highly effective control of tobacco beetle, with a mortality rate of over 96% within 20 days, and significantly downregulated the mRNA expression level of tobacco beetle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608076B_ABST
    Figure CN120608076B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of LsNAA15-16 Gene, dsRNA and application in controlling tobacco beetle. LsNAA15-16 Gene, dsRNA and application in controlling tobacco beetle. LsNAA15-16 Gene. Compared with the prior art, after tobacco beetle is fed with the water-soluble RNA biological pesticide preparation of the present application, the 20-day control effect on tobacco beetle can reach more than 96%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a... LsNAA15-16 Genes, dsRNA, and their application in the prevention and control of tobacco beta-associated venom. Background Technology

[0002] RNAi (RNA interference) was discovered by Fire et al. in 1998. Their research demonstrated that double-stranded RNA (dsRNA) can silence the expression of target genes, and they were awarded the Nobel Prize in 2006. Since then, it has been widely used as a tool for gene function research, especially in plants and animals where genetic manipulation tools are not yet perfect. In addition, it can also serve as a good tool for targeted pesticide and pharmaceutical development (Perrimon N, Ni JQ, Perkins L. In vivo RNAi: today and tomorrow. Cold Spring Harb Perspect Biol. 2010 Aug;2(8):a003640. doi: 10.1101 / cshperspect.a003640.).

[0003] In the field of agricultural pest and disease control, two studies in 2002 found that silencing specific target genes can lead to abnormal insect development, malformation of the next generation of embryos, or even death (Bettencourt R, Terenius O, Faye I. Hemolin gene silencing by ds‐RNA injected into Cecropia pupae is lethal tonext generation embryos[J]. Insect Molecular Biology, 2002, 11(3): 267-271.; Bucher G, Scholten J, Klingler M. Parental RNAi in Tribolium (Coleoptera). Curr Biol. 2002 Feb 5;12(3):R85-6. doi: 10.1016 / s0960-9822(02)00666-8.). This was the starting point for the application of RNAi technology in entomological research and application. Two reports in 2007 confirmed that expressing insect dsRNA in transgenic plants could achieve insecticidal effects (Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaughn T, Roberts J. Control of coleopteran insect pests through RNA interference. Nat Biotechnol. 2007 Nov;25(11):1322-6. doi: 10.1038 / nbt1359.; Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, Wang LJ, Huang YP, Chen XY. Silencing a cottonbollworm P450 monooxygenase gene by plant-mediated RNAi impairs larvaltolerance of gossypol. Nat Biotechnol. 2007 Nov;25(11):1307-13. (doi: 10.1038 / nbt1352.) These two studies provide strong evidence for the application of RNAi technology in pest control.Pesticides developed using this technology are called RNA biopesticides, also known as nucleic acid pesticides, RNA pesticides, or RNA interference agents. They are novel biopesticides developed based on RNA interference technology. Their core component is a polynucleotide that can specifically bind to the mRNA transcribed from the target gene in the target organism. (Wang M, Jin H. Spray-Induced Gene Silencing: a Powerful Innovative Strategy for Crop Protection. Trends Microbiol. 2017 Jan;25(1):4-6. doi:10.1016 / j.tim.2016.11.011.; Wang Zhiwen, Gao Xiang, Ma Dejun, Zhong Shan, Liu Xili, Xi Zhen. Nucleic acid pesticides—a novel plant protection product with great potential, Journal of Pesticide Science, 2019,21(5-6):681-691.; Hu Shaoru, Guan Ruobing, Li Haichao, Miao Xuexia, 2019. Important progress and existing problems in the application of RNAi in pest control.) Acta Entomologica Sinica, 62(4): 506–515.RNA biopesticides can specifically silence the expression of target genes, exhibiting high efficiency and strong specificity (Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaughn T, Roberts J. Control of coleopteran insect pests through RNA interference. Nat Biotechnol. 2007 Nov;25(11):1322-6. doi: 10.1038 / nbt1359.; Mao YB, Cai WJ, Wang JW, Hong GJ, TaoXY, Wang LJ, Huang YP, Chen XY. Silencing a cotton bollworm P450monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol. 2007 Nov;25(11):1307-13. doi: 10.1038 / nbt1352. Zhang J, Khan SA, Hasse C, Ruf S, Heckel DG, Bock R. Full cropprotection from an insect pest by expression of long double-stranded RNAs inplastids. Science. 2015 Feb 27;347(6225):991-4. doi: 10.1126 / science.1261680.).The principle behind this method is to utilize specific fragments of endogenous functional genes in organisms, synthesize them in vitro, and then introduce them into the target species to inhibit gene expression, thereby hindering gene function and ultimately affecting the growth, development, and even death of the target species (Zhu KY, Palli SR. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu Rev Entomol. 2020 Jan 7;65:293-311. doi:10.1146 / annurev-ento-011019-025224.). Due to its species specificity, ease of target development, and easy degradation, it possesses most of the functions required for green pesticides, attracting the attention of numerous scientists and pesticide companies. Currently, many international pesticide companies, such as Bayer-Monsanto, Dow AgroSciences, and Syngenta, are utilizing this technology and investing significant human and material resources in the research and development of targeted insecticides. Reportedly, some products have already been launched or are about to be launched (Head GP, Carroll MW, Evans SP, Rule DM, Willse AR, Clark TL, et al. (2017). Evaluation of SmartStax and SmartStax PRO maize against western corn rootworm and northern corn rootworm: efficacy and resistance management. Pest. Manag. Sci. 73 1883–1899. 10.1002 / ps.4554).

[0004] Tobacco A [ Lasioderma serricorne [Fabricius] Belonging to the family Lymnaeidae in the order Coleoptera, the jujube beetle, also known as the jujube cricket beetle, is a global storage pest with a complex diet. Due to its wide-ranging diet, the tobacco beetle can damage tobacco, tea, cereals, beans, dried dates, oilseeds, animal and plant specimens, cocoa beans, leather, and rattan and bamboo products, with tobacco products being the most severely affected. This insect particularly favors aging tobacco leaves and can enter the interior of cigarettes along with the processed tobacco, bore into the tobacco shreds, and even perforate the cigarette paper. The insect's carcass and excrement contaminate tobacco leaves and tobacco products, seriously affecting the usability of tobacco leaves and the quality of cigarettes.

[0005] Nα-acetyl-L-ornithine (AORN) is a substrate used to identify, differentiate, and characterize N(α)-acetyl-L-ornithine deacetylases and N-acetyl-L-ornithine transcarbamoylases (AOTCases) found in plants, certain eubacteria, and some human pathogens. Its predicted function is to contribute to peptide α-N-acetyltransferase activity, participate in the acetylation of N-terminal peptidyl methionine, and is part of the NatA complex. Naa15, together with its catalytic subunit Naa10, constitutes the evolutionarily conserved NatA (Nα-acetyltransferase A) complex. After the initial methionine is cleaved by methionine aminopeptidase, this complex acetylates the α-amino group of the first amino acid residue of a protein, starting from small side chains such as serine, glycine, alanine, threonine, and cysteine. Both Naa15 and Naa16 interact with ribosomes in yeast (via ribosomal proteins uL23 and uL29), humans, and rats, thereby linking NatA / Naa10 to ribosomes and promoting co-translational acetylation as nascent polypeptide chains emerge from the exit channel. Furthermore, Naa15 may act as a scaffold for other factors, including chaperone-like proteins HYPK (huntington interacting protein K) and Naa50 (the catalytic acetyltransferase subunit of NatE). In *Saccharomyces cerevisiae*, NAA15Δ and NAA10Δ knockout cells exhibit the same phenotype, and biochemical data indicate that unreinforced Naa15 is unstable and degraded. Therefore, the function of Naa15 is closely related to the acetyltransferase activity of Naa10, which is part of the NatA complex.

[0006] NatA can also regulate co-translational protein folding and protein targeting of the endoplasmic reticulum, possibly by competing with SRP and NAC for the same ribosome binding sites, or by interfering with other ribosome-associated protein biosynthetic factors, such as MetAP, molecular chaperones Hsp70 / Hsp40, SRP, and NAC, which act on newly synthesized proteins immediately after they emerge from the ribosome exit channel. However, the exact mechanism of this action remains unclear. In addition, Naa15 is involved in many cellular processes, including maintaining a healthy retina, endothelial cell permeability, tumor progression, neuronal generation and differentiation, apoptosis, and transcriptional regulation; it is currently unclear whether these functions of Naa15 are independent of or dependent on NatA. Furthermore, it is unclear whether Naa15 and Naa16 are associated with lethality in tobacco acetylcholine (MAC). Summary of the Invention

[0007] Based on the lack of efficient RNA interference technology-developed RNA biopesticides for the control of tobacco beetle in existing technologies, this invention provides... LsNAA15-16 Genes, dsRNA, and their application in the prevention and control of tobacco beta-associated venom.

[0008] The objective of this invention can be achieved through the following technical solutions:

[0009] This invention first provides a LsNAA15-16 The gene, whose full-length ORF sequence is shown in SEQ ID NO.1.

[0010] Furthermore, LsNAA15-16 The gene, whose nucleotide sequence is shown in SEQ ID NO.2.

[0011] The present invention provides LsNAA15-16 The gene is a target gene, namely Nα-acetyl-L-ornithine (N(alpha)-acetyltransferase 15 / 16). LsNAA15-16 .

[0012] The present invention further provides the aforementioned LsNAA15-16 Application of genes in the preparation of tobacco beta prevention agents.

[0013] The present invention further provides a dsRNA, which is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO.3 and the nucleotides shown in their reverse complementary sequences. In the nucleotide sequence shown in SEQ ID NO.3, "t" represents uracil.

[0014] The dsRNA provided by this invention is used for targeted silencing. LsNAA15-16 Gene. Therefore, the dsRNA provided in this invention is also referred to as ds. LsNAA15-16 , or dsNAA15-16.

[0015] The present invention further provides a pair of primers for amplifying the dsRNA, the dsRNA F primer sequence of which is shown in SEQ ID NO.4 and the dsRNA R primer sequence of which is shown in SEQ ID NO.5.

[0016] The present invention further provides an expression vector containing the dsRNA.

[0017] The present invention also provides a host cell containing the expression vector or a DNA sequence corresponding to the dsRNA integrated into the chromosome.

[0018] The present invention also provides a composition comprising the dsRNA and an insect-feeding acceptable vector.

[0019] The present invention also provides a water-soluble RNA biopesticide formulation, comprising the dsRNA and water as a solvent for dissolving the dsRNA.

[0020] The present invention also provides a method for killing tobacco beetles, specifically by spraying a water-soluble RNA biopesticide preparation onto the object or space where tobacco beetles need to be killed.

[0021] This invention provides LsNAA15-16 The invention relates to a gene that is a lethal target gene for tobacco beetle (Beta tumefaciens). Based on this gene, and using RNA interference technology, a dsRNA and primers for synthesizing the dsRNA are provided. A composition including the dsRNA, a water-soluble RNA biopesticide formulation, and a method for killing tobacco beetle are also provided.

[0022] Compared with existing technologies, feeding tobacco beetle with the water-soluble RNA biopesticide formulation of this invention can achieve a 20-day control effect of over 96%. Attached Figure Description

[0023] Figure 1. Feeding ds LsNAA15-16 Survival rate of tobacco beetle after 26 days.

[0024] Figure 2. Feeding ds LsNAA15-16 The death phenotype of tobacco A in the last 26 days.

[0025] Figure 3 Feeding ds LsNAA15-16 The expression level of tobacco methyl mRNA was significantly downregulated. Detailed Implementation

[0026] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0027] Example 1

[0028] One of the objectives of this embodiment is to obtain the target gene sequence, and the steps include:

[0029] (1) Extraction of total RNA from tobacco A

[0030] Using tobacco acetate as material, the RNA was extracted using the conventional Trizol method, purified using conventional methods, and treated with DNase to obtain a total RNA sample with a concentration ≥300 ng / ul, a total amount ≥6 μg, and an OD260 / 280 of 1.8~2.2.

[0031] (2) Isolation of mRNA and synthesis of cDNA

[0032] mRNA containing polyA was isolated using magnetic beads with oligo-dT (catalog number: S1419S, NEB), and then the first strand of cDNA was synthesized using random hexamer primers (catalog number: SO142, Thermo Scientific) and the Superscript II reverse transcriptase kit purchased from Invitrogen.

[0033] (3) Gene amplification and sequencing

[0034] use LsNAA15-16 Gene-specific primers were used for amplification, the obtained gene fragment was purified, ligated into the PMD-18 vector (manufactured by Takara), transformed into Top10 strains, screened using blue-white screening, and sequenced for positive strains. Specifically, the target gene was amplified. LsNAA15-16 The gene-specific primers are respectively LsNAA15-16 Primer F, with a nucleotide sequence as shown in SEQ ID NO.6, specifically: ATGGGGATGGCAGCTC; LsNAA15-16 Primer R, with the nucleotide sequence shown in SEQ ID NO.7, is specifically: GAGTTACTATAAAC.

[0035] (4) dsRNA synthesis

[0036] dsRNA was synthesized using the UltraClean T7 RNA Transcription Kit (SJ001B) from Shanghai Zhisheng Yougu Biotechnology Co., Ltd. Specific methods are detailed in the kit. Amplification of dsRNA (ds...) LsNAA15-16 The primers include dsRNA F primer and dsRNA R primer, the dsRNA F primer sequence is shown in SEQ ID NO.4, and the dsRNA R primer sequence is shown in SEQ ID NO.5.

[0037] (5) Prevention and control effect test

[0038] 30 μg of the synthesized dsRNA was dissolved in water to a final concentration of 500 ng / μL, then sprayed evenly on the surface of tobacco leaves. After drying, tobacco beetle larvae were introduced and allowed to feed. Data were collected 20 days after treatment.

[0039] (6) Statistical analysis

[0040] The significance analysis of differences between data was conducted using the T. Test, and the results were obtained by calculating the mean and the standard deviation (SD) between the data.

[0041] Example 2

[0042] The effect of RNA biological pesticide aqueous solution on the control of tobacco beetle

[0043] The dsRNA (ds) synthesized in Example 1 above LsNAA15-16 The double-stranded RNA was dissolved in water at a concentration of 1.500 μg / μl, serving as the experimental group. A control group was also set up, in which dsGFP P (double-stranded green fluorescent protein, a known biological material, typically used as a positive control in control experiments) was dissolved in water and sprayed evenly onto the surface of tobacco leaves. After drying, 30 tobacco beetle larvae were inoculated onto each leaf, with each treatment repeated 5 times. The survival rate of the tobacco beetles was recorded on day 20 after treatment.

[0044] The results showed that, compared with the control dsGFP, in ds LsNAA15-16 On treated tobacco leaves, the larvae of the tobacco beetle began to show a mortality phenotype on the 5th day after feeding, and the mortality rate was 96.67±3.33% after 20 days (Figure 1), achieving a relatively effective control effect. Meanwhile, ds LsNAA15-16 The treated tobacco beetle exhibited a phenotype that prevented normal pupation (Figure 2), and its mRNA expression level was significantly downregulated (Figure 3).

[0045] The above embodiments demonstrate ds LsNAA15-16 It can effectively eliminate tobacco beetle.

[0046] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

[0047] The sequence information involved in this invention is as follows:

[0048] SEQ ID NO.1: LsNAA15-16 Full-length ORF sequence:

[0049]

[0050] SEQ ID NO.2: LsNAA15-16 The nucleotide sequence of the gene:

[0051]

[0052] SEQ ID NO.3: dsRNA nucleotide sequence:

[0053] AAGGGCTTCCTGGATAGGTTATGCGATGTCTTTTCACCTATTAGAAGACTACAAAAATGCTCTGAATATTTTAGAAACTTTTCTGGACCAACAACAAAAGGGGAGTAACTTTGATTACGAGCACAGTGAACTGCTACTTTACCAGAACATGGTTATAAGGGAATCGGGTGAACTGAAACAGGCTCTGGCCCATCTTGAAAGCTCCTCTGATCAGATCGTAGATAAGCTGACCCTCAAAGAAAACCTAGCCGAGTTGAATCTCCAGCTCAAAAATTATGATAAAGCGCAACAATACTTTAAGGAACTGATTAAGAGGAATCCCGAAAACACTATTTACTATAGAAAACTGATAGAATCAAAACGCTTAGTAGACTCTGAAGATATTGTTAAGCTTTACGCCGAATACGAGCAGCAATATCCACGTGCCATGCCTCCCCGTCGACTTCCATTGAAT

[0054] SEQ ID NO.4: dsRNA F primer sequence:

[0055] TAATACGACTCACTATAGGGAAGGGCTTCCTGGATAGGTT

[0056] SEQ ID NO.5: dsRNA R primer sequence:

[0057] TAATACGACTCACTATAGGGATTCAATGGAAGTCGACGGG

[0058] SEQ ID NO.6: LsNAA15-16 Primer F sequence:

[0059] ATGGGGATGGCAGCTC

[0060] SEQ ID NO.7: LsNAA15-16 Primer R sequence:

[0061] GAGTTACTATAAAC.

Claims

1. A kind LsNAA15-16 Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The one according to claim 1 LsNAA15-16 Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

2.

3. A dsRNA, characterized in that, It is a double-stranded RNA consisting of the sense strand shown in SEQ ID NO.3 and the antisense strand shown in its reverse complementary sequence, wherein the dsRNA is used to target and silence the RNA of claim 1 or 2. LsNAA15-16 Gene.

4. A pair of primers for amplifying the dsRNA of claim 3, characterized in that, Its forward primer is shown in SEQ ID NO.4, and its reverse primer is shown in SEQ ID NO.

5.

5. An expression carrier, characterized in that, The expression vector contains the dsRNA as described in claim 3.

6. A host cell, characterized in that, The host cell contains the expression vector as described in claim 5.

7. A composition, characterized in that, The composition comprises the dsRNA of claim 3, and an insect-feeding-acceptable vector.

8. A water-soluble RNA biopesticide formulation, characterized in that, It includes the dsRNA of claim 3, and water for dissolving the dsRNA.

9. A method for killing tobacco beetle, characterized in that, The water-soluble RNA biopesticide formulation of claim 8 is to be sprayed on objects or spaces where tobacco beetle needs to be killed.

Citation Information

Patent Citations

  • LSMPR3 gene of lasioderma serricorne and application of dsRNA of LSMPR3 gene in pest control

    CN119061021A

  • Compositions and methods for targeting multinucleated cells

    US20220249701A1