Function and application of lasp1 gene in fish antiviral immune regulation

By targeting and regulating the LASP1 gene through gene editing technology, the problem of unstable effect of crucian carp herpes virus infection in traditional breeding methods was solved, efficient breeding of disease-resistant fish was achieved, and new varieties with strong disease resistance were bred.

CN120608104AActive Publication Date: 2025-09-09INST OF AQUATIC LIFE ACAD SINICA
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511120885.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-09-09
Estimated Expiration
2045-08-12

AI Technical Summary

Technical Problem

Existing technologies are unstable in preventing and treating herpesvirus infection in fish. Traditional breeding methods are difficult to achieve broad-spectrum resistance, and the reliance on dominant phenotypic selection leads to a long breeding cycle, making it difficult to meet the efficient breeding needs of modern aquaculture.

Method used

Through gene editing technology, the LASP1 gene is targeted and regulated, LASP1 protein is overexpressed to inhibit interferon production, and the lasp1 gene is knocked down to enhance interferon expression. The lasp1 gene is used as a target for preventing and treating crucian carp herpes virus infection, to prepare preventive or therapeutic preparations, and to cultivate new disease-resistant varieties.

Benefits of technology

It breaks through the traditional breeding paradigm, achieves precise regulation of the interferon signaling pathway, significantly enhances the ability of fish to resist crucian carp herpes virus infection, and provides an efficient disease-resistant breeding path.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608104A_ABST
    Figure CN120608104A_ABST
Patent Text Reader

Abstract

The invention discloses a function and an application of a fish LIM and SH3 structural domain protein 1 (LASP1) gene in fish antiviral immune regulation, and particularly discloses a molecular mechanism and an application value of the LASP1 as an immune negative regulation factor in carassius auratus herpesvirus (CaHV) infection. Experiments prove that fish LASP1 has the function of remarkably inhibiting immune regulation generated by host interferon and can promote CaHV proliferation for the first time, and knock-down of the gene can effectively enhance host antiviral response and inhibit CaHV infection. Therefore, the lasp1 gene can be used as a new target for preventing and treating CaHV infection, is used for preparing a preparation for preventing or treating CaHV infection, or is used for gene editing of a cell model for preventing CaHV infection or a new crucian carp variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of fish disease resistance, specifically relates to lasp1 The function of the gene in the regulation of antiviral immunity in fish and its application in the prevention and control of crucian carp herpes virus. Background Art

[0002] Viral diseases in fish, particularly hematopoietic necrosis of the crucian carp caused by Carassius auratus herpesvirus (CaHV), cause severe economic losses to the aquaculture industry. Current prevention and control measures for these viral diseases, including vaccines and antiviral drugs, suffer from inconsistent efficacy and limited protection. In this context, the development of precise prevention and control technologies has become a key requirement for industrial transformation and upgrading, and genetic improvement to cultivate new aquaculture strains with innate disease resistance is widely recognized as the most promising fundamental solution. Traditional breeding techniques for disease resistance, which primarily rely on phenotypic screening and family selection, have made some progress. However, due to inherent limitations such as reliance on dominant phenotypic selection, long breeding cycles, and difficulty achieving broad-spectrum resistance, they are no longer able to meet the efficient breeding needs of modern aquaculture. With the rapid development of molecular biology techniques in recent years, particularly the mature application of gene editing, the creation of new disease-resistant strains through precise modification of host immune-related genes has become a promising research direction in aquaculture breeding. This novel molecular design breeding strategy has the potential to overcome the bottlenecks of traditional methods and provide new technical support for the sustainable development of aquaculture.

[0003] In recent years, domestic scholars have made significant progress in the fields of fish genomics, virus-host interaction mechanisms, and innate immune signaling pathway regulation, laying an important foundation for antiviral breeding. Studies have shown that during pathogen infection, negative regulatory factors of innate immunity often become "accomplices" of viral pathogenicity, and functional loss or mutation of these factors can significantly enhance the host's antiviral ability. By using gene editing technology to target the knockout or modification of natural immune negative regulatory factors, new strains with strong disease resistance can be precisely bred. This strategy is highly efficient and targeted, and represents an important development direction for current aquatic disease-resistant breeding. It will provide strong support for the sustainable development of my country's crucian carp farming industry.

[0004] LIM and SH3 domain protein 1 (LASP1) is an F-actin binding protein that was first discovered to be highly expressed in malignant tumor tissues in 1995. As a multifunctional protein, although the role of LASP1 in tumorigenesis and embryonic development has been widely studied, its function in fish antiviral immunity remains a blank area. Through systematic research on the negative regulatory mechanism of LASP1 during crucian carp herpesvirus infection, we found that it may participate in the viral replication cycle as a key host factor. Based on this discovery, the present invention innovatively proposes a strategy for targeted regulation of LASP1 expression using gene editing technology, providing a theoretical basis and technical path for breeding new crucian carp varieties with resistance to crucian herpesvirus infection. Summary of the Invention

[0005] The first object of the present invention is to provide lasp1 The application of genes or their encoded proteins as negative regulatory factors in inhibiting the interferon immune response of fish. Specifically, overexpression of LASP1 protein significantly inhibited the production of interferon in fish, while knockdown lasp1 The gene significantly enhanced interferon expression.

[0006] The second object of the present invention is to provide lasp1 Application of a gene or its encoded protein inhibitor in the preparation of a preparation for preventing or treating herpesvirus infection against crucian carp, wherein the inhibitor targets and reduces lasp1 The expression level of the gene or LASP1 protein was reduced, and the host interferon expression was enhanced, thereby inhibiting the proliferation of crucian herpes virus.

[0007] The third object of the present invention is to provide a cell model or crucian carp breeding method for resistance to crucian carp herpes virus infection, by targeted knockdown of crucian carp lasp1 Gene expression, enhance host interferon expression, and inhibit the proliferation of crucian carp herpes virus.

[0008] In order to achieve the above objectives, the present invention adopts the following technical solutions: First, under CaHV infection conditions, LASP1 was found to bind to STING, an adaptor molecule in the interferon signaling pathway, by mass spectrometry screening, and immunoprecipitation confirmed the formation of the LASP1-STING complex. lasp1 The expression of the gene is closely related to the production of interferon. Specifically, overexpression of LASP1 protein triggers the degradation of STING mediated by the autophagy receptor p62, thereby inhibiting the expression of interferon. lasp1 After gene expression, interferon expression increased significantly. Therefore, LASP1 negatively regulates the interferon signaling pathway in fish through autophagy.

[0009] In the second aspect, the present invention found lasp1 The gene is correlated with CaHV replication and proliferation. lasp1 Gene overexpression promoted the replication and proliferation of CaHV, and the cytopathic effect caused by the virus was significantly enhanced, while knockdown lasp1 Gene expression does not affect the proliferation of cells themselves, but can significantly inhibit the replication and proliferation of CaHV and enhance the ability of fish to resist CaHV infection. lasp1 The gene can be used as a new target for preventing and treating CaHV infection, for preparing preparations for preventing or treating anti-carp herpesvirus infection, or for gene editing of cell models or new crucian carp breeds that are resistant to crucian herpesvirus infection.

[0010] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides lasp1 The new function of the gene in the antiviral immune response of fish and its application in the prevention and control of CaHV, the negative regulator of the fish interferon signaling pathway was selected as the target, and the knockdown was confirmed for the first time. lasp1 Fish cells expressing the gene have a significant anti-CaHV effect, breaking through the existing breeding paradigm that only focuses on positive regulatory factors. lasp1 Target genes have stronger targeting compared with traditional hybrid breeding, group breeding and mutagenesis breeding methods, and can accurately regulate the hub factors of the interferon signaling pathway, providing an innovative technical path for using gene editing technology to cultivate new disease-resistant crucian carp strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is a volcano plot of LASP1 screened by mass spectrometry in Example 1. The blue marker is the bait protein STING, and the green marker is the target protein LASP1.

[0012] Figure 2 This is the immunoprecipitation assay for the binding of LASP1 and STING in Example 1.

[0013] Figure 3 For the knockdown in Example 2 lasp1 Evaluation of gene effects. sh-NC represents the negative control group, sh- lasp1 -1 means sh- lasp1 -1 targeted knockdown in CiCB cells lasp1 The experimental group of genes, sh- lasp1 -2 means sh- lasp1 -2 targeted knockdown of EPC cells lasp1 The experimental groups of genes are the same as follows.

[0014] Figure 4 For example 3, quantitative PCR was used to evaluate overexpression or knockdown lasp1 Interferon gene ifn and its downstream genes vig1 A and B show the effects of overexpression of LASP1 protein on interferon ifn and its downstream genes vig1 Expression, vector represents the control group transfected with empty vector (pCMV-Myc), LASP1-Myc-2 represents the experimental group overexpressing LASP1 protein, Myc represents the group transfected with pCMV-Myc plasmid, STING-Myc-2 represents the group transfected with STING-Myc-2 plasmid (the same below). C and D are knockdown lasp1 Interferon gene ifn and its downstream vig1 The impact of expression.

[0015] Figure 5 The effect of LASP on STING protein expression was detected by immunoblotting in Example 4. A is the result of immunoblotting of STING protein in cells overexpressing LASP1; B is the result of knockdown lasp1 The results of immunoblotting of STING protein in cells expressing the gene; C is an autophagy receptor p62 Immunoblotting results of the effect of overexpression of LASP1 protein on STING protein expression in gene knockdown cells; D is when autophagy receptor p62 After gene knockdown, LASP1 inhibits STING-induced interferon ifn The results of quantitative PCR of the expression of sh- p62 Indicates targeted knockdown of EPC cells p62 For the experimental groups of genes, Vector+STING indicated transfection with the empty vector pCMV-Myc+STING-Flag-2 plasmid, and LASP1+STING indicated simultaneous transfection with STING-Flag-2 and LASP1-Myc-2 plasmids.

[0016] Figure 6 The effect of overexpression of LASP1 protein on CaHV proliferation in Example 5. A is the degree of pathological changes in GiCB cells with LASP1 overexpression after CaHV infection; B is the statistical results of viral titer in GiCB cells with LASP1 overexpression after CaHV infection; C is the statistical results of viral gene expression in GiCB cells with LASP1 overexpression after CaHV infection. orf72 mRNA levels.

[0017] Figure 7 For the knockdown in Example 6 lasp1 The degree of pathological changes of GiCB cells after CaHV infection.

[0018] Figure 8 For the knockdown in Example 6 lasp1Statistical results of viral titer in GiCB cells infected with CaHV.

[0019] Figure 9 For the knockdown in Example 6 lasp1 Viral genes in GiCB cells after CaHV infection orf72 mRNA levels.

[0020] Figure 10 For the knockdown in Example 7 lasp1 Effects of genes on cell proliferation. GiCB cells were transiently transfected with sh-NC and sh- lasp1 -1 plasmid, and the cell proliferation was detected using CCK-8 kit at different time points (24, 30, 36, 48, and 72 h) after transfection. DETAILED DESCRIPTION

[0021] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the invention. The experimental methods used in the following examples are conventional methods well known to those skilled in the art unless otherwise specified. All materials, reagents, etc. in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0022] Plasmid sources and construction instructions: The vectors pCMV-Myc, pCMV-Tag2C, and PLKO.1 used in this example are all commercial vectors. GiCB cells were obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). lasp1 gene (XM_052552823.1) and sting The open reading frame sequence of the gene (XM_052614353.1) was amplified by PCR and digested with endonucleases, and then ligated into the pCMV-Myc and pCMV-Tag2C vectors, respectively, to construct the LASP1-Myc-1 and STING-Flag-1 plasmids used in GiCB cells. EPC cells were obtained from the ZFIN (https: / / zfin.org / ) website. lasp1 The open reading frame sequence of the gene (ZDB-GENE-030131-1936) and sting The open reading frame sequence of the gene (ZDB-GENE-120921-1) was amplified by PCR and digested with endonucleases. asp1 Connected to the pCMV-Myc vector to construct the LASP1-Myc-2 plasmid used in EPC cells. stingThe STING-Myc-2 and STING-Flag-2 plasmids were constructed by connecting them to pCMV-Myc and pCMV-Tag2C vectors respectively for use in EPC cells. p62 (ZDBGENE-040426-2204) coding region shRNA sequence, primers were annealed to form double-stranded DNA, and then ligated to the PLKO.1 vector by double enzyme digestion to construct sh- p62 plasmid.

[0023] Example 1 Mass spectrometry screening and verification of the binding of LASP1 to STING by co-immunoprecipitation 1.1 Mass spectrometry screening of target proteins Well-growing GiCB cells were subcultured and inoculated into 10 cm culture dishes. After being cultured at 28°C overnight, they were transiently transfected with an empty vector (pCMV-Myc) and STING-Myc-1 plasmids, respectively. 24 hours after transfection, CaHV was inoculated (MOI = 100). 24 hours after infection, the cells were lysed using freshly prepared RIPA lysis buffer (containing PMSF, Na3VO4, and protease inhibitor cocktail), and the supernatant was collected and incubated with anti-Myc tag agarose gel beads overnight. After washing three times with PBS, mass spectrometry analysis was performed.

[0024] The results show that ( Figure 1 ), under CaHV infection conditions, LASP1 can bind to STING, a key molecule in the interferon signaling pathway, indicating that LASP1 is involved in regulating the interferon signaling pathway.

[0025] 1.2 Validation of LASP1-STING Binding by Co-immunoprecipitation Well-growing GiCB cells were subcultured and inoculated into 10 cm culture dishes. After culturing at 28°C overnight, the control group was transfected with an empty vector (pCMV-Tag2C) + LASP1-Myc-1 plasmid, and the experimental group was transfected with STING-Flag-1 + LASP1-Myc-1 plasmid. CaHV (MOI = 100) was inoculated 24 hours after transfection. After 24 hours of infection, the cells were lysed and the supernatant was collected. After incubation with anti-Flag tag agarose beads overnight, the cells were washed three times with RIPA lysis buffer, and the binding of LASP1 to STING was detected by immunoblotting. The results showed that LASP1 can form a LASP1-STING complex with STING ( Figure 2 ), further confirming the combination between the two.

[0026] Example 2 Construction and knockdown of shRNA plasmids lasp1 Evaluation of gene effects 2.1 Construction of shRNA plasmids Targeting of CiCB cells and EPC cells by software design lasp1 Two shRNA sequences in the gene coding region, sh- lasp1 -1 targets CiCB cells lasp1 Gene, sh- lasp1 -2 targets EPC cells lasp1 Gene. The sequence is as follows: sh- lasp1 -1-F: 5'-CCGGGTGCTCTACAAGGAGGAATTTCTCGAGAAATTCCTCCTTGTAGAGCACTTTTTG-3',sh- lasp1 -1-R:5'-AATTCAAAAAGTGCTCTACAAGGAGGAATTTCTCGAGAAATTCCTCCTTGTAGAGCAC-3';sh- lasp1 -2-F: 5'-CCGGGCACACTATCCGAAGACGTCACTCGAGTGACGTCTTCGGATAGTGTGCTTTTTG-3',sh- lasp1 -2-R: 5'-AATTCAAAAAGCACACTATCCGAAGACGTCACTCGAGTGACGTCTTCGGATAGTGTGC-3'. Will sh- lasp1 -1 and sh- lasp1 The forward and reverse primers for -2 were annealed separately to form double-stranded DNA. The PLKO.1 vector was then digested with Age I and EcoR I. The digested vector was purified from a gel and ligated to the PLKO.1 vector using a ligase. The next day, the plasmid was transformed into E. coli, and a single clone was selected and sequenced to confirm the correct ligated plasmid.

[0027] 2.2 Knockdown lasp1 Evaluation of gene effects The GiCB / EPC cells with good growth status were subcultured into 6-well plates and cultured at 28°C overnight. lasp1 -1 into CiCB cells, transfected with sh-NC (control), sh- lasp1 -2 was added to EPC cells, and the cells were collected after 24 h. Total RNA was extracted by TRIzol method and reverse transcribed into cDNA, and then detected by fluorescence quantitative PCR. lasp1To express the mRNA level of gicb-lasp1, the primers were as follows: gicb-lasp1-F: 5'-CATCTCATAACTATCACTATG-3', gicb-lasp1-R: 5'-ACGACACCTCGTCCTCATCAG-3', epc-lasp1-F: 5'-CTATCACTATGAGCCTGAGCCCG-3', epc-lasp1-R: 5'- CCCCTGCTGGCCAGTGCGCT -3'.

[0028] The results are as follows Figure 3 As shown, compared with the sh-NC control group, sh- lasp1 -1 (CiCB cells) and sh- lasp1 -2 (EPC cells) can significantly reduce lasp1 The transcriptional levels of genes showed that both shRNAs could effectively knock down the expression of β-actin in CiCB cells / EPC cells. lasp1 Gene expression.

[0029] Example 3 Evaluation of overexpression or knockdown lasp1 Interferon gene ifn and its downstream genes vig1 The impact of expression 3.1 Effect of LASP1 overexpression on interferon ifn and its stimulatory genes vig1 The impact of expression EPC cells with good growth status were subcultured and seeded into 6-well plates and cultured overnight at 28°C. A total of 4 groups of experiments were set up, and the cells were transfected with pCMV-Myc + pCMV-Myc plasmid, pCMV-Myc + LASP1-Myc-2 plasmid, STING-Myc-2 + pCMV-Myc plasmid, and STING-Myc-2 + LASP1-Myc-2 plasmid, respectively. Cells were collected 24 hours after transfection, and total RNA was extracted by TRIzol method. After reverse transcription into cDNA, the results were detected by fluorescence quantitative PCR. ifn as well as vig1 The mRNA levels of epc-ifn were detected using primers epc-ifn-F: 5'-ATGAAAACTCAAATGTGGACGTA-3', epc-ifn-R: 5'-GATAGTTTCCACCCTTTCCTTAA-3'; epc-vig1-F: 5'-AGCGAGGCTTACGACTTCTG-3', epc-vig1-R: 5'-GCACCAACTCTCCCAGAAAA-3'.

[0030] 3.2 Knockdown lasp1 Interferon gene ifn and its stimulatory genes vig1 The impact of expression EPC cells with good growth status were subcultured and seeded into 6-well plates and cultured at 28 °C overnight. Four groups of experiments were set up, transfected with pCMV-Myc+sh-NC plasmid, pCMV-Myc+sh- lasp1 -2 plasmid, STING-Myc-2+sh-NC plasmid and STING-Myc-2+sh- lasp1 After 24 h of transfection, cells were collected and total RNA was extracted by TRIzol method. After reverse transcription into cDNA, the expression of cDNA was detected by fluorescence quantitative PCR. ifn as well as vig1 Transcription level.

[0031] The above results are as follows Figure 4 As shown in Figure 2, overexpression of LASP1 protein can significantly inhibit STING-induced ifn and vig1 The mRNA level of the gene ( Figure 4 A and B), while knockdown lasp1 Genes significantly enhance STING-induced ifn and vig1 Gene expression ( Figure 4 (C and D) These results indicate that LASP1 is an immune negative regulator of the interferon signaling pathway.

[0032] Example 4 Immunoblotting assay to detect the effect of LASP1 on STING protein expression 4.1 Effect of LASP1 overexpression on STING protein expression EPCs with good growth were subcultured into 6-well plates and cultured overnight at 28°C. The cells were transfected with the pCMV-Myc and LASP1-Myc-2 plasmids, respectively. Cells were harvested 24 hours after transfection and lysed with RIPA buffer. Endogenous STING expression was then detected by immunoblotting.

[0033] 4.2 Knockdown lasp1 Effects of genes on STING protein expression levels EPC cells with good growth status were subcultured and seeded into 6-well plates and cultured at 28°C overnight. lasp1 -2 (targeted knockdown) plasmid, and changes in endogenous STING expression were detected by immunoblotting.

[0034] 4.3 Role of the autophagy receptor p62 in LASP1-mediated STING degradation EPC cells with good growth status were subcultured and seeded into 6-well plates and cultured overnight at 28°C. A total of 4 groups of experiments were set up, including 2 groups in the control group and 2 groups in the experimental group: p62 group, the control group was transfected with sh-NC+ STING-Flag-2+ pCMV-Myc plasmid, and the experimental group was transfected with sh-NC+STING-Flag-2+LASP1-Myc-2 plasmid; knockdown p62 group, and the control group was transfected with sh- p62 +STING-Flag-2+ pCMV-Myc plasmid, the experimental group was transfected with sh- p62 +STING-Flag-2+LASP1-Myc-2 plasmid, and 24 h after transfection, STING expression was detected by immunoblotting. p62 The primer sequences for shRNA are as follows: sh- p62 -F:5'-CCGGGGACTCACCTGAGCTCTAAAGCTCGAGCTTTAGAGCTCAGGTGAGTCCTTTTTG-3',sh- p62 -R: 5'-AATTCAAAAAGGACTCACCTGAGCTCTAAAGCTCGAGCTTTAGAGCTCAGGTGAGTCC-3'.

[0035] Effect of the autophagy receptor p62 on LASP1 inhibition of STING-induced interferon expression Cell culture and transfection were performed according to the method in 4.3. After 24 h, cells were collected and total RNA was extracted by TRIzol method. After reverse transcription into cDNA, the RNA was detected by fluorescence quantitative PCR. ifn mRNA levels.

[0036] like Figure 5 As shown in A and B, overexpression of LASP1 protein significantly reduced the level of endogenous STING protein, while knockdown lasp1 After gene expression, STING protein expression increased significantly; Figure 5 As shown in C and D, knockdown p62 The gene can inhibit the degradation of STING by LASP1 and rescue the STING-mediated ifn These results indicate that LASP1 regulates STING through the autophagy pathway, and this degradation depends on the autophagy receptor p62, thereby affecting the production of interferon.

[0037] Example 5 Effect of Overexpression of LASP1 Protein on CaHV Proliferation 5.1 Observation of Cytopathic Effect (CPE) GiCB cells with good growth status were subcultured and inoculated into 24-well plates and cultured at 28°C overnight. pCMV-Myc and LASP1-Myc-1 plasmids were transiently transfected, and CaHV (MOI = 100) was inoculated 24 hours later. After 48 hours of infection, the supernatant was aspirated and stored at -20°C and the TCID 50 The virus titer was calculated by the virus titer method; the cells in the 24-well plate were fixed with 4% paraformaldehyde, stained with crystal violet and photographed.

[0038] 5.2 Determination of virus titer (TCID 50 ) GiCB cells were seeded into 96-well plates and cultured at 28°C for 24 h until the cells filled the wells. The CaHV infection supernatant collected in 5.1 was diluted 3-fold or 10-fold using M199 medium. The medium in the 96-well plate was aspirated and 100 μL of CaHV dilution was added to each well. The plates were then cultured in a 28°C incubator. After 2-3 days, when CPE no longer changed, the medium was discarded. The cells were fixed with 4% paraformaldehyde and stained with crystal violet. The viral titer (TCID) was calculated using the Reed-Muench method. 50。

[0039] 5.3 Detection of viral gene mRNA Cell culture and transfection were performed according to the method in 5.1. Cells were collected 24 h after inoculation with CaHV (MOI = 100). Total RNA was extracted by TRIzol method and reverse transcribed into cDNA. The results were detected by fluorescence quantitative PCR. orf72 (CaHV) mRNA levels, the primer sequences were as follows: orf72-F: 5′-ATCGGTGGAGGCTTCAAAGG-3′, orf72-R: 5′-TCGGGCCATAACGTGTTTCA-3′.

[0040] After cell transfection, the cells in the non-CaHV infected group were intact and showed no cytopathic CPE. However, in the CaHV infected group, the LASP1 protein overexpression group showed more CPE compared with the control group ( Figure 6 A in the middle) indicates that LASP significantly promotes the proliferation of CaHV. The supernatant of the CaHV infection group was collected and serially diluted in a 96-well plate to infect healthy cells. The TCID 50 The virus titer in the cell culture medium was determined. The results showed that the virus titer in the LASP1 protein overexpression group was significantly higher than that in the control group, TCID 50 This is consistent with the results of CPE, which showed that LASP1 promoted CaHV proliferation ( Figure 6 In addition, orf72The mRNA level of LASP1 was significantly increased in the LASP1 overexpression group ( Figure 6 CPE observation, virus titer determination, and viral gene mRNA detection confirmed that overexpression of LASP1 protein promoted the replication and proliferation of CaHV.

[0041] Example 6 Knockdown lasp1 Effects of genes on CaHV proliferation 6.1 Observation of cytopathic effects As in 5.1, transfect sh-NC and sh- lasp1 -1 plasmid, and observed cytopathic effects after inoculation of CaHV virus.

[0042] 6.2 Determination of virus titer As in 5.2, knockdown was determined lasp1 Effect of genes on CaHV viral titer.

[0043] 6.3 Detection of viral gene transcripts Cell culture and transfection were performed according to the method in 6.1. Cells were collected 24 h after inoculation with CaHV (MOI = 100). Total RNA was extracted by TRIzol method and reverse transcribed into cDNA. The cDNA was amplified and detected by fluorescence quantitative PCR. orf72 (CaHV) mRNA levels.

[0044] like Figure 7 As shown, after infection with CaHV, the knockdown lasp1 The genome showed less CPE, indicating knockdown lasp1 The gene significantly inhibited the proliferation of CaHV. The supernatant of the CaHV infection group was collected and analyzed by TCID 50 The virus titer in the cell culture medium was measured and the results showed that the knockdown lasp1 The CaHV titer after gene was significantly lower than that in the control group, TCID 50 Reduced by about 1479 times ( Figure 8 ).also, orf72 The mRNA level was knocked down lasp1 The genome was significantly reduced ( Figure 9 ). The above results all confirmed that knockdown lasp1 The gene significantly inhibited the replication and proliferation of CaHV.

[0045] Example 7 Knockdown lasp1 Effects of genes on cell proliferation The GiCB cells with good growth status were subcultured and inoculated into 24-well plates and cultured at 28°C overnight. lasp1-1 plasmid, and the cell activity was detected using CCK-8 kit at different time points (24, 30, 36, 48, and 72 h) after transfection.

[0046] like Figure 10 As shown, sh- lasp1 There was no significant difference in cell activity between the -1 group and the sh-NC group at each time point, indicating that the knockdown lasp1 After the addition of the gene, the proliferation ability of GiCB cells was not affected.

Claims

1. lasp1 Application of genes or their encoded proteins as negative regulatory factors in inhibiting fish interferon immune response.

2. lasp1 The use of a gene or its encoded protein inhibitor in the preparation of a preparation for preventing or treating herpes simplex virus infection in crucian carp, characterized in that: The inhibitor reduces the lasp1 gene or LASP1 protein expression levels.

3. The use according to claim 2, characterized in that The inhibitor enhances host interferon expression and inhibits the proliferation of herpes simplex virus.

4. The use according to claim 2 or 3, characterized in that The inhibitor is targeted to knock down crucian carp lasp1 Gene expression by shRNA.

5. A method for breeding crucian carp resistant to crucian herpes virus infection, characterized in that: Including targeted knockdown of crucian carp lasp1 Gene expression.

6. The method according to claim 5, characterized in that Targeted knockdown of crucian carp by RNA interference lasp1 Gene expression.

7. A cell model for resistance to herpes simplex virus infection, characterized in that: Targeted knockdown of CiCB or EPC cells lasp1 Gene expression.

8. The cell model according to claim 7, characterized in that Targeted knockdown of CiCB or EPC cells by RNA interference lasp1 Gene expression.

9. The cell model according to claim 8, characterized in that Targeted knockdown of CiCB cells lasp1 The shRNA sequences expressed by the genes are shown in SEQ ID. 1 and 2.

10. The cell model according to claim 8, characterized in that Targeted knockdown of EPC cells lasp1 The shRNA sequences expressed by the genes are shown in SEQ ID. 3 and 4.

Citation Information

Patent Citations

  • Use of interfering RNA in production of transgenic animals

    CN103397019A

  • Application of LASP1 protein in preparation of drugs for spinal cord injury repair

    CN116870139A

  • Method for improving crucian carp herpesvirus resistance of crucian carp

    CN119410716A

  • Application of binding molecule of actin binding protein LASP1 in prevention and treatment of acute respiratory distress syndrome

    CN119454905A

  • AU2015204349A1