Method for detecting copy number of trophoblast residual quantity and application thereof

Abstract

The invention discloses a method for detecting copy number of trophoblast residual quantity and application of the method. The method comprises the following steps: (1) inoculating trophoblasts containing a BCR-ALB mutant genome into a culture medium for amplification; (2) extracting and detecting the concentration and the purity of the BCR-ALB mutant genome; (3) designing a primer and a probe aiming at the BCR-ALB mutant genome and the reference gene; (4) constructing a real-time fluorescent quantitative PCR reaction system to carry out a real-time fluorescent quantitative PCR reaction; (5) cloning the BCR-ALB mutant genome to a vector to obtain a plasmid standard substance, carrying out gradient dilution after linearization, and drawing a standard curve; and (6) calculating the copy number of the trophoblast residual quantity in the sample to be detected according to the Ct value of the sample to be detected and the standard curve. The detection method can quantitatively detect the copy number of residual trophoblasts, is high in sensitivity, and can distinguish fragment interference signals.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for detecting the copy number of residual trophoblast cells and an application thereof. Background Art

[0002] NK cells, as natural and highly effective tumor-killing cells, have become an excellent cytokine-induced killer cell in adoptive immunotherapy, in addition to cytotoxic T cells. Genetically modified K562 cells are natural target cells for NK cells. Due to the lack of HLA molecules, they cannot inhibit NK cell KIR signals, thus becoming natural target cells for NK cells. Genetically modified K562 cells express the costimulatory molecules CD86 and 4-1BBL, as well as the membrane-bound IL-21 cytokine. The costimulatory molecules can bind to the receptors CD28 and 4-1BB on the surface of NK cells, and the membrane-bound IL-21 can bind to the IL-21 receptor. Therefore, while NK cells kill target K562 cells, they are also stimulated by the costimulatory signals and IL-21 cytokine signals from the target cells, which can promote the proliferation of NK cells. After irradiation, K562 cells are stimulated to activate and expand NK cells. The GFP-positive cell rate is detected by flow cytometry (in order to enable mbIL-21 to be stably expressed on the cell membrane, GFP protein is fused to the cytoplasmic region to increase the stability of mbIL-21) to determine whether there are residual genetically modified K562 cells. In the final NK or CAR-NK product, GFP fluorescently labeled genetically modified K562 cells should not be detected. However, there is currently no method to quantitatively detect the copy number of residual K562 cells in NK cells.

[0003] Traditional detection methods rely on flow cytometry to detect GFP-labeled K562 cells, but these methods have the following limitations: inability to quantify residual cell copy number, low sensitivity (only capable of detecting a positive rate ≥ 0.1%), and inability to distinguish interference signals from debris. Existing single-gene qPCR methods lack internal control and are susceptible to variations in sample DNA extraction efficiency, leading to biased quantitative results.

[0004] Therefore, there is an urgent need to provide a highly sensitive method that can quantitatively detect the copy number of residual trophoblasts. Summary of the Invention

[0005] In response to the deficiencies of the prior art and actual needs, the present invention provides a method for detecting the copy number of residual trophoblast cells and its application. The detection method of the present invention can quantitatively detect the copy number of residual trophoblast cells, has high sensitivity and strong specificity, can distinguish debris interference signals, is easy to operate, and improves detection efficiency.

[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a method for detecting the copy number of residual trophoblast cells, the method comprising the following steps:

[0008] (1) Trophoblast cells containing the BCR-ALB mutant genome were inoculated in a culture medium containing fetal bovine serum, and the cell pellets were collected after amplification to the logarithmic growth phase;

[0009] (2) Extract the BCR-ALB mutant genome and detect the concentration and purity of the BCR-ALB mutant genome;

[0010] (3) Design primers and TaqMan probes for the target gene BCR-ALB mutant genome and internal reference gene;

[0011] (4) constructing a real-time fluorescence quantitative PCR reaction system to perform real-time fluorescence quantitative PCR reaction;

[0012] (5) The target gene BCR-ALB mutant genome was cloned into a vector to obtain a plasmid standard, which was linearized and then serially diluted to draw a standard curve;

[0013] (6) Calculate the copy number of the residual trophoblast cells in the sample to be tested based on the Ct value of the sample to be tested and the standard curve.

[0014] The method of the present invention realizes the simultaneous detection of two genes, and synchronously amplifies the target gene and the internal reference gene through the FAM / CY5 dual fluorescence channels, eliminating the difference in DNA extraction efficiency. The detection method of the present invention has high sensitivity and can accurately detect the low-abundance copy number of the target gene in trophoblast cells. The detection method of the present invention has strong specificity and can specifically identify the target gene and eliminate the interference of other non-target genes.

[0015] Preferably, the trophoblast cells include K562 trophoblast cells.

[0016] Preferably, the BCR-ALB mutant genome includes the functional domain of exon 3 of the BCR gene, the translocation junction and the albumin binding domain of exon 12 of the ALB gene.

[0017] Preferably, the length of the BCR-ALB mutant genome is 100-120 bp, such as 100 bp, 110 bp or 120 bp.

[0018] Preferably, the nucleic acid sequence of the BCR-ALB mutant genome includes the sequence shown in SEQ ID NO.1.

[0019] SEQ ID NO.1:

[0020] TCCACCCAGGAAGGACTAATCGGCTGAAGGAGCTGCAGATCCTGAAG GACTTGCCCTGTCCTCACCTTCGAAGCTGATAAAACCCACTCCA.

[0021] Preferably, the mass percentage of fetal bovine serum in the culture medium is 8-12%, such as 8%, 9%, 10%, 11% or 12%.

[0022] Preferably, the culture medium further contains L-glutamine and penicillin-streptomycin dual antibodies.

[0023] Preferably, the final concentration of L-glutamine in the culture medium is 1-5 mM, such as 1 mM, 2 mM, 3 mM, 4 mM or 5 mM.

[0024] Preferably, the mass percentage of penicillin-streptomycin dual antibody in the culture medium is 0.5-2%, such as 0.5%, 1% or 2%.

[0025] Preferably, the cell proliferation activity of the fetal bovine serum is ≥95%, such as 95%, 96%, 97% or 98%.

[0026] Preferably, the nucleic acid sequence of the primer includes the sequence shown in SEQ ID NO.2 to SEQ ID NO.5.

[0027] SEQ ID NO. 2 (BCR-ALB-F): TCCACCCAGGAAGGACTAATCG.

[0028] SEQ ID NO. 3 (BCR-ALB-R): GAAGCTGATAAAACCCACTCCA.

[0029] SEQ ID NO. 4 (hALB-F5): CCAAGTTAGTGACAGATCTTAC.

[0030] SEQ ID NO. 5 (hALB-R5): CTGTCAGCTATCACCAATGATA.

[0031] Preferably, the GC content of the primer is 40-60%, such as 40%, 45%, 50%, 55% or 60%.

[0032] Preferably, the final concentration of the primer is 0.4-0.6 μM, such as 0.4 μM, 0.5 μM or 0.6 μM.

[0033] Preferably, the nucleic acid sequence of the TaqMan probe includes the sequence shown in SEQ ID NO.6-SEQ ID NO.7.

[0034] SEQ ID NO. 6 (BCR-ALB-Probe): GGCAGGGTGTGGGGAAACAGGGAGG.

[0035] SEQ ID NO. 7 (hALB-probe): CGCATCCATTCTACCAACTTGAGC.

[0036] Preferably, the 5' end of the probe contains a fluorescent group, and the 3' end contains a quencher group.

[0037] Preferably, the fluorescent group includes any one of FAM, VIC, CY5 or ROX, or a combination of at least two of them.

[0038] Preferably, the quenching group includes any one of BHQ1, BHQ2 or MGB, or a combination of at least two of them.

[0039] Preferably, the procedure of the real-time fluorescence quantitative PCR reaction includes: 1. pre-denaturation: 93-95°C (e.g., 93°C, 94°C or 95°C), 10-15 min (e.g., 10 min, 12 min or 15 min), 1-2 cycles; 2. denaturation: 93-95°C (e.g., 93°C, 94°C or 95°C), 15-20 s (e.g., 15 s, 18 s or 20 s), 35-45 cycles (e.g., 35 cycles, 40 cycles or 45 cycles); 3. annealing / extension: 58-60°C (e.g., 58°C, 59°C or 60°C), 1-2 min (e.g., 1 min, 1.5 min or 2 min).

[0040] Preferably, the standard curve uses the natural logarithm of the copy number of the standard in different gradient dilutions as the abscissa, and the average Ct value of the different copy number gradients of each standard as the ordinate.

[0041] Preferably, the calculation formula for the copy number of the residual trophoblast cells is as shown in formula (1):

[0042]

[0043] In a second aspect, the present invention provides use of the method described in the first aspect in preparing a product for diagnosing and / or treating immune diseases.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] (1) The present invention achieves dual-gene simultaneous detection, and synchronously amplifies the target gene and the internal reference gene through the FAM / CY5 dual fluorescence channel, eliminating the difference in DNA extraction efficiency;

[0046] (2) The present invention integrates the BCR-ABL mutant sequence and the human hALB gene into the same plasmid, ensuring the consistency of the standard curve;

[0047] (3) The present invention designs exon-spanning probes targeting the BCR-ABL breakpoint, thus avoiding nonspecific amplification of genomic DNA;

[0048] (4) The present invention uses SalⅠ enzyme digestion to obtain a single-stranded linear plasmid and establishes a 1×10 1 -1×10 8 7-point standard curve of copies / μL;

[0049] (5) The detection method of the present invention has high sensitivity and can accurately detect the copy number of low-abundance target genes in trophoblasts. Since trophoblasts have complex gene expression during development and the expression levels of some key target genes may be low, the highly sensitive detection method can capture these trace gene signals and will not miss important gene information. For example, when studying regulatory genes that are closely related to trophoblast function but have low expression levels, the highly sensitive detection method can accurately detect their copy number, providing reliable data for subsequent research.

[0050] (6) The detection method of the present invention has high specificity and can specifically identify the target gene while eliminating interference from other non-target genes. The genome of trophoblast cells is large and contains many similar gene sequences. The highly specific detection method can accurately distinguish the target gene from similar gene fragments, ensuring the accuracy of the test results. For example, when detecting a specific target gene in a gene family with high homology, it can accurately locate the target gene and avoid misjudgment.

[0051] (7) Compared with some traditional gene detection methods, the detection method of the present invention is relatively simple to operate. The operation steps of the K562 trophoblast cell target gene copy number detection method are relatively simple, and do not require complex experimental equipment and tedious experimental procedures. It can be easily carried out in different laboratory environments, reducing the experimental difficulty and cost, and improving the detection efficiency. Using the real-time fluorescence quantitative PCR detection method, only simple sample processing and PCR amplification operations are required to complete the detection of the target gene copy number. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 Schematic diagram of the Pre-Lenti-EF1-CARV2 WPmut vector;

[0053] Figure 2Schematic diagram of the IG210432-1Pre-Lenti-EF1-CD864-1BBL-CARV2 WPmut plasmid vector;

[0054] Figure 3 Schematic diagram of the IG210432-2Pre-Lenti-EF1-mbIL-21-CAR V2 WPmut plasmid vector;

[0055] Figure 4 Schematic diagram of the pUC57 (ZL009) plasmid prepared in Example 1 of the present invention;

[0056] Figure 5 is the standard curve of BCR-ALB gene;

[0057] Figure 6 is the standard curve of hALB gene;

[0058] Figure 7 It is the amplification curve of BCR-ALB gene in the exogenous gene standard;

[0059] Figure 8 is the amplification curve of hALB gene in the exogenous gene standard;

[0060] Figure 9 Amplification curves of the BCR-ALB gene in samples, positive controls (PCs), and negative controls (NTCs);

[0061] Figure 10 It is the amplification curve of hALB gene in sample, positive control (PC), and negative control (NTC). DETAILED DESCRIPTION

[0062] To further illustrate the technical means and effects of the present invention, the present invention is further described below with reference to the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention.

[0063] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0064] Example 1

[0065] Construct a BCR-ALB gene copy number standard (ZL009 plasmid).

[0066] In order to prepare genetically modified K562 cells that can be used for NK cell activation and expansion, CD86, 4-1BBL costimulatory molecules, and mbIL-21 membrane-bound cytokine were selected to transduce K562 cells. The genes expressing these three molecules were designed as follows:

[0067] CD86 and 4-1BBL are expressed in the same vector, and the two molecules are connected by the self-cleaving peptide T2A. After translation, the mRNA is broken into two molecules CD86 and 4-1BBL, which are expressed on the K562 cell membrane; mbIL-21 uses the signal peptide of CD8α, and the mature IL-21 molecule without the signal peptide is fused with the hinge region of IgG4 (Ser to Pro transformation), CH2, CH3 region, and the transmembrane region of the CD28 molecule. The cytoplasmic region is fused with the GFP molecule through the G4S amino acid sequence. After the above two genes were designed, they were synthesized and constructed in the vector of our company's four-plasmid system and the third-generation lentiviral system. The two genes "CD864-1BBL" and "mbIL-21" were synthesized by Guangzhou Aiji Biotechnology Co., Ltd. and cloned into the Pre-Lenti-EF1-CARV2 WPmut vector, which is kanamycin-resistant and has the kozak sequence "GCCACC" added before the start codon ATG. The plasmid vector is shown in the figure below. Figure 1 shown.

[0068] The two vectors carrying cloned genes delivered by Guangzhou Aiji Biotechnology Co., Ltd. are named: IG210432-1Pre-Lenti-EF1-CD864-1BBL-CAR V2 WPmut and IG210432-2Pre-Lenti-EF1-mbIL-21-CARV2WPmut. The plasmid vectors are shown in the figure below. Figure 2 、 Figure 3 shown.

[0069] In addition, in order to make the plasmid standard better for quantitative detection of BCR-ABL gene, CD86, 4-1BBL, mbIL-21, GFP and BCR-ALB mutant sequence (SEQ ID NO.1) were constructed on the PUC57 plasmid vector and named ZL009 (size 4452bp), as follows Figure 4 The plasmid standard was used to establish a bacterial strain library and produce plasmids. DNA concentration and purity measurements, as well as Sanger sequence analysis, were performed on batch P009-PF22052401. All results met the quality standards for plasmid standards for quantitative use (Quality Inspection Report No.: COA-ZL09-22003) and can be used for subsequent preparation of quantitative PCR standards.

[0070] Example 2

[0071] This embodiment provides a method for detecting the copy number of residual trophoblast cells.

[0072] 1. Place the BCR-ALB gene copy number standard (ZL009 plasmid), SuperFastProbe Mixture, BCR-ALB-F / BCR-ALB-R, hALB-F5 / hALB-R5, BCR-ALB-probe, hALB-probe, and sample DNA extracts on ice.

[0073] 2. Use DNase / RNase-free deionized water to dissolve the plasmid standard (4.91×10 8 copies / μL) was diluted to 1.0×10 8 The number of copies / μL is marked as M, and then M is serially diluted in a 10-fold gradient, marked as STD1 to STD7, and a no-template control NTC and a positive control PC are also set. The standard sample gradient dilution process is shown in Table 1 below:

[0074] Table 1

[0075]

[0076]

[0077] 3. Preparation of reaction system;

[0078] (1) Preparation of a single PCR reaction system: Prepare a 20 μL PCR reaction system in a clean bench using SuperFast Probe Mixture, BCR-ALB-F / BCR-ALB-R, hALB-F5 / hALB-R5, BCR-ALB-probe, hALB-probe, DNase / RNase-free deionized water, and CryoSure-DMSO as shown in Table 2:

[0079] Table 2

[0080]

[0081]

[0082] (2) Preparation of total reaction system (MIX 1): Calculate the amount of each reagent based on the number of samples and prepare the PCR mixture according to Table 3 below.

[0083] Table 3

[0084]

[0085] The primer sequences of the target gene BCR-ALB and the internal reference gene hALB are shown in Table 4, and the Taqman qPCR probe sequences are shown in Table 5.

[0086] Table 4

[0087]

[0088] Table 5

[0089]

[0090] (3) The PCR reaction solutions (MIX 2) for each sample were prepared as shown in Table 6:

[0091] Table 6

[0092]

[0093]

[0094] 4. Add sample to PCR reaction system:

[0095] (1) Prepare the complete PCR reaction system (MIX2) and add MIX2 according to the 96-well plate diagram in Table 7. Then, add the standard of each concentration, NTC, the sample to be tested, and the positive control (PC) in sequence. 20 μL per well, and replicate three wells for each sample.

[0096] Table 7

[0097]

[0098] Note: This example shows the detection of 6 concentration gradient standard curves (STD1 to STD7), 1 no-template control NTC, 2 test samples (S1, S2), and a positive control (PC).

[0099] (2) After adding the sample, close the 8-row caps, first the two end caps, then the middle cap, and mark them. Check for bubbles in the tube. If there are bubbles, flick them upwards with your fingers. Once there are no bubbles, centrifuge the sample in a handheld centrifuge until there is no liquid residue or obvious bubbles on the tube wall.

[0100] 5. On-machine testing:

[0101] Turn on the PCR instrument and set the reaction parameters according to the "ABI 7500 Real-time Fluorescence Quantitative PCR Instrument Standard Operating Procedure" before testing.

[0102] PCR reaction program and reaction plate settings:

[0103] (1) Set up a two-step reaction program: pre-denaturation at 95°C for 2 min; 95°C for 10 s, 60°C for 15 s, 40 cycles; reaction volume: 20 μL.

[0104] (2) Set up the sample reaction plate: Create a new detection probe named BCR-ALB, select the reporter fluorophore as FAM, and the quencher fluorophore as none; create a new detection probe named hALB, select the reporter fluorophore as CY5, and the quencher fluorophore as none. Edit the standard name and concentration, NTC, positive control (PC), and the batch number of the sample to be tested according to the sample loading position of the PCR reaction system. Save the reaction plate file to the target folder. Start the PCR program, save the result file to the target folder, and start the PCR reaction.

[0105] 6. Quantitative Analysis of Mutant Gene BCR-ALB and Reference Gene hALB

[0106] After the PCR amplification reaction is completed, the threshold is adjusted to improve linearity and amplification efficiency and optimize the deviation of the three parallel wells of the sample. The natural logarithm (base 10) of the copy number of the standard sample with different gradient dilutions is used as the horizontal axis, and the average Ct value of the different copy number gradients of each standard sample is used as the vertical axis. Linear fitting is performed to obtain the standard curve and linear equation of the target gene BCR-ALB and the internal reference gene hALB. The amplification efficiency and R of the standard curve are judged. 2 , slope, intercept and whether the detection values ​​of different genes in each sample are consistent with expectations (linear determination coefficient R 2 >0.99, overall amplification efficiency between 85% and 110%, and Ct value differences between triplicate samples (Δct ≤ 1). Substitute the average Ct value of the sample into the curve equation to calculate the logarithm of the BCR-ALB or hALB gene concentration. Then, take the antilogarithm to base 10 to obtain the sample BCR-ALB or hALB gene concentration or the starting template amount. The formula for calculating the template amount at the fluorescence threshold of the qPCR gene amplification reaction is as follows:

[0107] X T =X0×(1+E X )×C T,X =K X

[0108] Where: X T It is the copy number when the fluorescence intensity of the amplified gene reaches the threshold;

[0109] X0 is the amount of molecules of the starting target gene;

[0110] E X is the amplification efficiency of the qPCR reaction;

[0111] C T,X is the number of cycles when the target gene molecule amplification reaches the threshold; in the formula, K X is a constant that reflects the multiplication factor of the PCR target sequence.

[0112] Calculation of BCR-ALB gene copy number: Each diploid cell genome contains two hALB genes, based on which the BCR-ALB gene copy number per K562 cell is calculated. The formula is as follows:

[0113]

[0114] Example 3

[0115] This example uses the method described in Example 2 to detect the copy number of residual trophoblast cells.

[0116] The ZL009 plasmid standard containing the BCR-ALB gene and hALB gene with known starting copy numbers was serially diluted, and the Ct value at which the detection gene reached the threshold was plotted on the X-axis, and the logarithm of the starting template copy number was plotted on the Y-axis to establish the standard curves for the internal reference gene hALB and the target gene BCR-ALB, respectively. Figure 5 、 Figure 6 As shown in the standard curve, there is a linear relationship between the template Ct value and the logarithm of the initial copy number of the template. The standard curve of the internal reference gene is Y = -3.332X + 40.528; R 2 =0.999, the overall PCR amplification efficiency is 99.6%. The standard curve of the target gene is Y = -3.397X + 40.997; R 2 =1.000, the overall PCR amplification efficiency is 97.0%. The linear correlation coefficient R of the dual-channel standard curve is 2 The values ​​of the standard curve are all close to 1, indicating that the standard curve is accurate and can be used for quantitative analysis. The overall amplification efficiency of qPCR is related to the specificity of the primers, the purity of the standard, the effectiveness of the Taq enzyme, etc. According to the calculation formula of the amplification slope 1+E=10 1 / S (where S is the slope of the standard curve). Generally, the slope range for qPCR amplification is -3.743 to -3.008, resulting in a calculated effective amplification efficiency of 85% to 110%. In this experiment, dual-channel qPCR assays for target gene copy number showed amplification efficiencies exceeding 97% for both the BCR-ALB and hALB genes, as reflected by both the FAM and CY5 channels. This demonstrates high specificity of the amplified products. Fluorescence changes during qPCR amplification accurately reflect target gene amplification, enabling subsequent copy number calculation.

[0117] Real-time fluorescence dual-channel qPCR detection of BCR-ALB and hALB genes:

[0118] The amplification curves of the target gene BCR-ALB and the internal reference gene hALB are as follows Figure 7 and Figure 8As shown, the curve is a set of S-shaped curves with equal spacing. The three parallel wells basically overlap, indicating that the amplification repeatability between the duplicate wells is good. The quantitative range of the amplification Ct value of the standard curve is between 17 and 37, which well encompasses the Ct value of the sample. Figure 9 The amplification curve shows that when the extracted NK cell genomic DNA is used to detect the mutant gene BCR-ALB copies of the residual K562 engineered cells, the sample Ct value is between ST5 (30.91) and ST7 (37.44), while the average Ct value of the positive control K562 cells is 21.55, indicating that the starting copy number of the BCR-ALB gene in NK cells is very small, that is, the residual K562 engineered cells in NK cells are at a very low level. The internal reference gene hALB has a high level of expression in both the NK cell genomic DNA and the K562 engineered cell genomic DNA used as the positive control, and is relatively constant, as shown below. Figure 10 The Δct between triplicate wells of different samples was ≤ 1. No amplification curve was observed in both channels of the blank control wells for qPCR amplification, indicating no cross-contamination of samples and a high degree of confidence in the experimental results.

[0119] Example 4

[0120] The results of K562 cell residue detection by qPCR were statistically compared with the flow cytometry data.

[0121] In this embodiment, normally cultured K562 engineered cells were used as positive controls (PC), and different batches of NK cells were used as experimental groups (Sample, sample names were C1, C2, C3, C4, and the sample sources were human CAR-NK cells). NK cell genomic DNA and K562 engineered cell genomic DNA were extracted respectively, and 3 parallel wells were made for each sample. Quantitative PCR reactions were performed, and the residual copy number of K562 cells was quantitatively detected by calibrating the standard of known starting copies. Table 8 below shows the Ct values ​​and copy numbers obtained by detecting BCR-ALB and hALB genes in different samples. Among them, the positive control PC target gene BCR-ALB copy number is much higher than the residual copy number of K562 cells in NK cells. The copy number of the internal reference gene hALB in different NK cells and positive control K562 cells is substantially constant.

[0122] Table 8

[0123]

[0124] K562 cells are used as trophoblasts in the production process of CAR NK products. Although they lose their proliferation capacity due to DNA damage after irradiation, more detection methods besides copy number detection are still needed to measure their residual amount to better evaluate the safety of NK cell preparations. Using the Click-iT EdU flow cytometry proliferation kit with Alexa Fluor 647 dye, DNA synthesis activity of trophoblasts at different culture times was detected by flow cytometry to determine cell proliferation capacity. A control group was set up by adding an appropriate amount of live cells to the trophoblasts to detect the percentage of cells with proliferation capacity in K562 cells. The test results were compared with the target gene copy number detection method. The results are summarized in Table 9 below.

[0125] Table 9

[0126]

[0127]

[0128] As can be seen from Table 9, the results of the qPCR method for detecting the residual copy number of K562 cells in NK cells are consistent with those of the flow cytometry method.

[0129] In summary, the method for detecting the copy number of residual trophoblast cells of the present invention can quantitatively detect the copy number of residual trophoblast cells with high sensitivity and can distinguish interference signals from debris.

[0130] The applicant states that the present invention is intended to illustrate the detailed methods of the present invention through the above-described embodiments, but the present invention is not limited to the above-described detailed methods, that is, it does not mean that the present invention must rely on the above-described detailed methods in order to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions for various raw materials in the products of the present invention, addition of auxiliary ingredients, and selection of specific methods, etc., are all within the scope of protection and disclosure of the present invention.

Claims

1. A method for detecting the copy number of residual trophoblast cells, characterized in that: The method comprises the following steps: (1) Trophoblast cells containing the BCR-ALB mutant genome were inoculated in a culture medium containing fetal bovine serum, and the cell pellets were collected after amplification to the logarithmic growth phase; (2) Extract the BCR-ALB mutant genome and detect the concentration and purity of the BCR-ALB mutant genome; (3) Design primers and TaqMan probes for the target gene BCR-ALB mutant genome and internal reference gene; (4) constructing a real-time fluorescence quantitative PCR reaction system to perform real-time fluorescence quantitative PCR reaction; (5) The target gene BCR-ALB mutant genome was cloned into a vector to obtain a plasmid standard, which was linearized and then serially diluted to draw a standard curve; (6) Calculate the copy number of the residual trophoblast cells in the sample to be tested based on the Ct value of the sample to be tested and the standard curve.

2. The method according to claim 1, characterized in that The trophoblast cells include K562 trophoblast cells.

3. The method according to claim 1 or 2, characterized in that The BCR-ALB mutant genome includes the functional domain of BCR gene exon 3, the translocation junction and the albumin binding domain of ALB gene exon 12; Preferably, the length of the BCR-ALB mutant genome is 100-120 bp; Preferably, the nucleic acid sequence of the BCR-ALB mutant genome includes the sequence shown in SEQ ID NO.

1.

4. The method according to any one of claims 1 to 3, characterized in that The mass percentage of fetal bovine serum in the culture medium is 8-12%; Preferably, the culture medium further contains L-glutamine and penicillin-streptomycin dual antibody; Preferably, the final concentration of L-glutamine in the culture medium is 1-5 mM; Preferably, the mass percentage of penicillin-streptomycin dual antibody in the culture medium is 0.5-2%; Preferably, the cell proliferation activity of the fetal bovine serum is ≥95%.

5. The method according to any one of claims 1 to 4, characterized in that The nucleic acid sequences of the primers include sequences shown in SEQ ID NO.2 to SEQ ID NO.5; Preferably, the GC content of the primer is 40-60%; Preferably, the final concentration of the primer is 0.4-0.6 μM.

6. The method according to any one of claims 1 to 5, characterized in that The nucleic acid sequence of the TaqMan probe includes the sequence shown in SEQ ID NO.6-SEQ ID NO.7; Preferably, the 5' end of the probe contains a fluorescent group and the 3' end contains a quencher group; Preferably, the fluorescent group includes any one or a combination of at least two of FAM, VIC, CY5 or ROX; Preferably, the quenching group includes any one of BHQ1, BHQ2 or MGB, or a combination of at least two of them.

7. The method according to any one of claims 1 to 6, characterized in that The procedures of the real-time fluorescence quantitative PCR reaction include:

1. pre-denaturation: 93-95°C, 10-15 minutes, 1-2 cycles; 2. denaturation: 93-95°C, 15-20 seconds, 35-45 cycles; 3. annealing / extension: 58-60°C, 1-2 minutes.

8. The method according to any one of claims 1 to 7, characterized in that The standard curve uses the natural logarithm of the copy number of the standard sample at different gradient dilutions as the abscissa, and the average Ct value of the copy number gradient of each standard sample as the ordinate.

9. The method according to any one of claims 1 to 8, characterized in that The calculation formula for the copy number of the residual trophoblast cells is shown in formula (1):

10. Use of the method according to any one of claims 1 to 9 in the preparation of a product for diagnosing and / or treating immune diseases.

Images