KASP molecular marker closely linked with pepper fruit color gene cachl1, primer and kit thereof, obtaining method and application
By developing the KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, the problems of long breeding cycle and environmental influence in pepper fruit color breeding were solved, rapid and accurate fruit color identification and breeding were achieved, and the research on fruit color change and regulation mechanism was promoted.
Patent Information
- Application Number
- CN202411773984.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-05
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-12-05
AI Technical Summary
The existing technology for pepper fruit color breeding has problems such as long breeding cycle and susceptibility to environmental influences, and little research on the genetic mechanism of chlorophyll, resulting in low breeding efficiency.
A KASP molecular marker and its primers were developed, which are tightly linked to the pepper fruit color gene CaCHL1. Fruit color was identified by single nucleotide polymorphism at base 13072545 on pepper chromosome 5. The KASP molecular marker screening method was used to quickly identify the pepper fruit color genotype.
It has achieved rapid and accurate pepper fruit color identification, improved breeding efficiency, reduced the planting scale and workload of later identification, and laid the foundation for studying fruit color changes and regulatory mechanisms.
Smart Images

Figure CN119553004B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of pepper breeding and molecular biology, and particularly relates to a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, its primers, kit, acquisition method and application in predicting pepper fruit color change and molecular-assisted breeding. Background Art
[0002] chili( Capsicum annuum L. Pepper (Capsicum annuum) belongs to the genus Capsicum in the Solanaceae family and is one of China's most important vegetable crops. Pepper fruit is its primary economic output. Pepper fruit has a variety of colors. During the green stage, carotenoid content is low, with chlorophyll, the primary pigment, determining its color. Immature fruit can range in color from dark green, light green, yellow-green, creamy white, purple, to black. Pepper fruit color is a key economic trait that influences consumer choice and is also a key breeding target.
[0003] The development of gene sequencing technology and the publication of the pepper genome sequence have promoted the application of molecular breeding technology in peppers and the rapid development of pepper genomics. The positioning and cloning of genes related to a series of important breeding traits have laid the foundation for the development of molecular markers and their application in pepper breeding. In terms of yield traits, researchers have identified approximately 215 fruit-related QTLs sites through natural populations or hybrid populations, of which 17 sites have a genetic effect greater than 20%. A genome-wide association study (GWAS) using 94 pepper materials identified 16 SNP sites associated with fruit weight, of which 7 SNPs are located on known fruit weight genes, such as STYLOSA 、 FASCIATED 、 WUSCHEL and CLAVATA1 Isogenic. C. annuum x C. frutescens Several QTLs for flesh thickness were identified on chromosome 4, and QTLNloLG25.1 was found to be associated with ovary number. C. annuum Two QTLs for flesh thickness were identified in the population. Qpt.iivr-2.1 , Qpt.iivr-3.1 、 ftd2.1 and other QTLs loci, and found that QTL NloLG25.1 was associated with ovary number. Ma et al. (2022) used C. annuum cv. GS6 x C. annuum cv. Qiemen The constructed F2 and F2:3 genetic populations identified key QTLs controlling fruit length, fruit width, fruit shape, fruit weight and ventricle number: ftl2.1 , ftd2.1 , fts1.1 , ftw2.1 and lcn1.1Although some relevant gene QTLs have been discovered in pepper fruit trait research, the action modes of these regulatory factors are still poorly understood, and their application is still limited and inefficient.
[0004] At present, the research on the mechanism of pepper fruit color mainly focuses on the synthetic metabolic mechanism of capsanthin, and the breeding goal is concentrated on breeding new pepper varieties with high capsanthin; less attention has been paid to the analysis of the genetic mechanism of pepper chlorophyll.
[0005] Therefore, exploring the key genes or QTL functions of important agronomic traits of pepper, such as fruit color, and developing molecular markers related to fruit color are beneficial to the breeding of pepper fruit color, and lay the foundation for cloning stay-green genes and studying the molecular mechanism of chlorophyll degradation. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 and its primers, kit, acquisition method and application.
[0007] In order to solve the above technical problems, the technical solution proposed by the present invention is:
[0008] A KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, with the pepper zunla-1 gene as the reference gene, and a single nucleotide polymorphism at base 13072545 on pepper chromosome 5, where a base substitution from G to C occurred.
[0009] The KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 is preferably CaCHL1 The CDS nucleotide sequence of the coding region is shown in SEQ ID NO: 1:
[0010] [G / C]AGAATAGAGACATCGTCTTCGCGGACATTGTCAAGTGGTTAGAGGAGAAAATAAGGATGGGTAACTCAAGGCTAGAGAGGCAACAAAAGCAAGCAAATGATCAAAAAATCAGCAGCAGTTAG。
[0011] The above-mentioned KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 preferably has a nucleotide sequence as shown in SEQ ID NO: 2: GCTCTCCTACGGTGAATTTCCACAGAATAGAGACATCGTCTTCGCGGACATTGTCAAGTGGTTAGAGGAGAAAATAAGGATGGGTAACTCAAGGCTAGAGAGGCAACAAAAGCAAGCAAATGATCA.
[0012] As a general inventive concept, the present invention also provides a primer for identifying a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, comprising:
[0013] Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTGCTCTCCTACGGTGAATTTCCA-3′ (as shown in SEQ ID NO: 3);
[0014] Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTGCTCTCCTACGGTGAATTTCCAC-3′ (as shown in SEQ ID NO: 4);
[0015] Reverse primer: 5'-TGATCATTTGCTTGCTTTTGTTGC-3' (as shown in SEQ ID NO: 5).
[0016] The above primers, preferably, the two forward primers are connected to different fluorescent linker sequences, respectively, the linker sequence matching FAM fluorescence in forward primer 1 is GAAGGTGACCAAGTTCATGCT (as shown in SEQ ID NO: 6), and the linker sequence matching HEX fluorescence in forward primer 2 is GAAGGTCGGAGTCAACGGATT (as shown in SEQ ID NO: 7).
[0017] As a general inventive concept, the present invention also provides a kit for identifying KASP molecular markers tightly linked to the pepper fruit color gene CaCHL1, comprising the above-mentioned primers.
[0018] As a general inventive concept, the present invention also provides a method for screening a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, comprising the following steps:
[0019] (1) Resequencing pepper materials, and performing genome-wide association analysis on pepper fruit color traits based on the resequencing results. On this basis, a high-generation inbred line with light green pepper fruit was used as the male parent, and a high-generation inbred line with dark green pepper fruit was used as the female parent, and hybridization was performed to construct an F2 population;
[0020] (2) The fruit color phenotype of the F2 population was identified, and a mixed pool of light green fruit and a dark green fruit mixed pool were obtained by using a mixed pool separation analysis population positioning method, and RNA-seq sequencing was performed. After bioinformatics analysis of the sequencing results, candidate chromosome regions linked to pepper fruit color were obtained;
[0021] (3) Develop molecular marker technology for single base substitution / insertion / deletion in the candidate region of the chromosome to narrow the candidate interval and ultimately obtain the KASP molecular marker that is closely linked to the pepper fruit color gene.
[0022] As a general inventive concept, the present invention also provides a use of the above-mentioned KASP molecular marker, the above-mentioned primer, or the above-mentioned kit in identifying pepper fruit color types or molecular-assisted breeding, which is beneficial to the rapid identification and breeding of pepper fruit color genes, and lays a foundation for cloning major effect genes that control fruit color, and for studying the regulatory mechanism of fruit color changes.
[0023] The above application preferably comprises the following steps:
[0024] (1) Extracting DNA from pepper samples to be tested as a template;
[0025] (2) Add the above primers or the above kit to perform PCR amplification;
[0026] (3) Perform genotyping on the amplified products and read the genotyping results.
[0027] In the above application, preferably, in step (2), the PCR amplification program is: Preincubation 94°C 900S; 94°C 20S, 78°C 10S, TD 62°C, 0 Cyc->57 (-0°C), 10 cycles; 94°C 20S, 57°C 60S, 35 cycles; Cooling 37°C 30S.
[0028] In the aforementioned application, PARMS PCR amplification is performed using a quantitative PCR instrument. When a fluorescent group and its corresponding fluorescent quencher are in close proximity, the fluorescence emitted by the fluorescent group is absorbed by the quencher, resulting in the emission of longer-wavelength fluorescence or heat release. At this point, no fluorescent signal can be detected at the corresponding wavelength. Once the two groups separate, the fluorescent signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers. When the corresponding allele is amplified, a corresponding fluorescent signal will appear. When performing genotyping on the amplified products, if only the fluorescent signal (blue) corresponding to the forward primer 1 connected to the fluorescent linker sequence is detected in the amplified product, the detection site is the G:G genotype, and the pepper fruit is judged to be a light green dominant plant; if only the fluorescent signal (green) corresponding to the forward primer 2 connected to the fluorescent linker sequence is detected in the amplified product, the detection site is the C:C genotype, and the pepper fruit is judged to be a dark green recessive plant; if the fluorescent signals (red) corresponding to both forward primers 1 and 2 connected to the fluorescent linker sequence are detected in the amplified product, the detection site is the G:C genotype, and the pepper fruit is judged to be a light green heterozygous plant.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] (1) The present invention screened a KASP molecular marker that can be directly used for the identification of pepper fruit color, and then relied on this molecular marker for assisted breeding, which can effectively solve the problems of long conventional breeding cycles and susceptibility to environmental influences. It is of great significance in the practice of pepper fruit color breeding and the study of fruit color change and regulatory mechanisms. The marker was used to identify the genotypes of 90 randomly sampled individual plants in the F2 population, and the coincidence rate reached 100%. This result not only helps in the identification of pepper fruit color and assisted breeding, but also lays the foundation for the map-based cloning of fruit color genes and the analysis of the molecular mechanism of pepper fruit color change.
[0031] (2) The present invention can quickly screen satisfactory plants by utilizing the KASP molecular marker at an early stage, effectively reducing the planting scale, reducing the workload of later identification, and improving the efficiency and accuracy of selection, which is of great significance for studying the color formation mechanism of fruit color. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 The dark green and light green fruit parent phenotypes of pepper in the embodiment of the present invention;
[0033] Figure 2 for CaCHL1 The initial chromosome location;
[0034] Figure 3Partial genotyping results for the F2 population constructed from “19CL148” and “LY116”. DETAILED DESCRIPTION
[0035] To facilitate understanding of the present invention, the present invention will be described in more comprehensive and detailed form below in conjunction with the accompanying drawings and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.
[0036] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.
[0037] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.
[0038] Example 1:
[0039] In this example, an F2 population was constructed using two highly homozygous materials. The pooled segregation analysis (BSA) population mapping method was used to identify a chromosomal region closely linked to pepper fruit color (light green), and molecular markers were developed within the candidate interval to identify candidate genes. CaCHL1 The nucleotide sequence is shown in SEQ ID NO: 1. A KASP molecular marker, identified through base mutation screening of candidate genes, can be directly used to identify pepper fruit color. This molecular marker can then be used in assisted breeding, effectively addressing the long conventional breeding cycles and susceptibility to environmental influences. Early use of this molecular marker allows for rapid selection of satisfactory plants, effectively reducing the scale of planting, alleviating the workload of subsequent identification, and improving selection efficiency and accuracy.
[0040] Pepper fruit color gene CaCHL1 The method for obtaining the linked molecular marker KASP molecular marker is as follows:
[0041] Construction of genetic populations
[0042] In the early stages of this invention, a mutant resource "LY116" with a stable heritability and dark green color (high chlorophyll content) in peppers at the ripening stage was screened from the '19CL148' mutant library. Phenotypic observation and physical and chemical index measurements revealed that the mutant had substantially the same characteristics as the wild type, except for a significantly higher chlorophyll content in the ripening fruit. Using the mutant and its wild type as parents (e.g. Figure 1The F1 and F2 populations were constructed and planted. Genetic analysis revealed that the F1 population exhibited a light green phenotype for ripe fruit. The F2 population contained 359 low-chlorophyll (light green) and 126 high-chlorophyll (dark green) mutants, with a segregation ratio of 2.84:1. The chi-squared test (χ2 = 0.186), consistent with a segregation ratio of 3:1 (χ2 < 3.86), confirmed that the high-chlorophyll mutant phenotype is controlled by a single recessive gene.
[0043] 2. Fruit color identification
[0044] The chlorophyll content of green pepper fruits of mutant "LY116" and wild type "19CL148" 30 days after flowering was determined.
[0045] 3. Fruit color gene mapping
[0046] 25 plants with dark green and light green fruit were selected, and leaf DNA was extracted from each plant. After the sample DNA passed the quality inspection, equal amounts of light green pool and dark green pool DNA were mixed. The whole genome of the two mixed pools (sequencing depth of 30×) and the two parents (sequencing depth of 10×) were resequenced using the Illumina sequencing platform. The F2 segregating population was further expanded to 1000 plants, and the recombinant plants F3 selected from the first round of F2 were added. Then, based on the initial positioning CaCHL1 SNP information on both sides of the gene, such as Figure 2 As shown, KASP marker primers were developed using Geneious software, and linkage analysis was performed using join map 4.0 together with the typing results. QTL prediction and fine positioning were performed using the software map-QTL combined with the genetic map. CaCHL1 .
[0047] 4. Development of molecular markers linked to dark green fruit color
[0048] Analyze the annotation information of genes within the fine-mapped interval to identify functionally related genes. Total RNA was extracted from different tissues of the chlorophyll mutant and wild-type strains. The RNA was mixed and reverse-transcribed into cDNA. Based on the candidate gene sequence in the reference genome, primers were designed using Geneious. PCR amplification was performed using the parental cDNA as a template. The amplified product was purified and then subjected to TA cloning and sequencing. Correct sequencing alignment was achieved, completing the full-length CDS clone of the candidate gene. CaCHL1The CDS nucleotide sequence of the coding region is shown as SEQ ID NO: 1, and the sequence of the gene is further cloned. Sequencing found that the gene has 1 base variation, and KASP marker primers are designed for site markers, which can well distinguish the parent deep green, light green and F1, and genotype 90 random single plants in the F2 population. With the gene of pepper zunla-1 as the reference gene, the KASP molecular marker is a single nucleotide polymorphism at the 13072545th base on chromosome 5 of pepper, where a base G to C substitution occurs, and the nucleotide sequence of the KASP marker is shown as SEQ ID NO: 2, and the 23rd base in SEQ ID NO: 2 is replaced by G to C.
[0049] 5. Application of molecular marker linked to deep green fruit color
[0050] (1) CTAB method for extracting DNA from 90 single plants in F2 population
[0051] a. Add dithiothreitol (DTT, 0.2%) to the CTAB extraction solution;
[0052] b. Add 2 pieces of fresh leaves to a 2.0 ml centrifuge tube; grind into powder with liquid nitrogen, add 800 µL of CTAB buffer, and mix well;
[0053] c. 65°C water bath for 45 min, gently invert and shake 3 times during the period, and cool to below 15°C after water bath at 4°C or room temperature;
[0054] d. Add 500 chloroform / isopentanol (24:1), mix well up and down for 5 min, and make sure the sample is fully mixed with chloroform;
[0055] e. Centrifuge at 12,000 rpm for 10 min; take 500 µL of supernatant and add it to a 1.5 ml centrifuge tube containing 500 µL of isopropanol, mix well by inverting up and down; 4°C or -20°C refrigerator for 30 min;
[0056] f. Centrifuge at 12,000 rpm for 20 min, discard the supernatant; wash the precipitate with 500ul of 75% alcohol, centrifuge at 12,000 rpm for 5 min, discard the supernatant;
[0057] g. Super-clean dry DNA, and let the alcohol evaporate completely; add 100 µL of pure water (containing a final concentration of 1% RNase) to dissolve the DNA;
[0058] h. Remove RNA in a 37°C water bath or at room temperature for 1 hour; collect DNA for electrophoresis. After confirming that the bands are intact, determine the DNA concentration using a micro-spectrophotometer. The 260 / 280 and 260 / 230 ratios should be greater than 1.8. Dilute the DNA to 100 ng and store at -20°C until ready for use.
[0059] (2) KASP marker typing of F2 population individual plants
[0060] a. KASP primer reagents generally consist of three primers, two of which are allele-specific forward primers and one is a universal reverse primer. The two allele-specific forward primers differ only in the 3' end base, corresponding to different alleles. The allele-specific forward primers will produce different fluorescent signals through competitive PCR reactions. The adapter sequence that matches FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence that matches HEX fluorescence is GAAGGTCGGAGTCAACGGATT.
[0061] KASP primers were designed by SNPWay ( http: / / www.snpway.com / ):
[0062] Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTGCTCTCCTACGGTGAATTTCCA-3′;
[0063] Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTGCTCTCCTACGGTGAATTTCCAC-3′;
[0064] Reverse primer: 5′-TGATCATTTGCTTGCTTTTGTTGC-3′;
[0065] b. KASP primers were synthesized from Qingke Biotechnology (PAGE purified);
[0066] c. The typing system is shown in Table 1 below:
[0067] Table 1: Classification system
[0068]
[0069] Amplification procedure:
[0070] Preincubation 94℃ 900s; 94℃ 20s, 78℃ 10s, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20s, 57℃ 60s, 35 cycles; Cooling 37℃ 30s.
[0071] (3) Typing results
[0072] The KASP marker was used to phenotypically identify the fruit color of individual plants in the F2 population. If only the fluorescent signal (blue) corresponding to the forward primer 1 connected to the fluorescent linker sequence was detected in the amplified product, the detection site was the G:G genotype, and the pepper fruit was determined to be a light green dominant plant; if only the fluorescent signal (green) corresponding to the forward primer 2 connected to the fluorescent linker sequence was detected in the amplified product, the detection site was the C:C genotype, and the pepper fruit was determined to be a dark green recessive plant; if the fluorescent signals (red) corresponding to both forward primers 1 and 2 connected to the fluorescent linker sequence were detected in the amplified product, the detection site was the G:C genotype, and the pepper fruit was determined to be a light green heterozygous plant.
[0073] The fruit color and genotype of 90 individual plants in the F2 population constructed by 19CL148 and LY116 using KASP marker are shown in Table 2. Some of the results are shown in Figure 3 As shown in the figure, the genotypic identification results were 100% consistent with the phenotypic identification results.
[0074] Table 2: Fruit color and genotype of 90 individual plants in the F2 population constructed by 19CL148 and LY116 using KASP marker
[0075]
[0076] The above identification results show that by using molecular marker identification and screening in breeding, retaining the material in which the fluorescent signal corresponding to forward primer 1, in which the primer is connected to a fluorescent linker sequence, is detected, homozygous material with a green-ripe fruit color of light green can be bred. Retaining the material in which the fluorescent signal corresponding to forward primer 2, which is connected to a fluorescent linker sequence, is detected, homozygous material with a green-ripe fruit color of dark green can be bred. Retaining the material in which both the fluorescent signals of forward primer 1 and forward primer 2, which are connected to a fluorescent linker sequence, are detected, heterozygous material with a green-ripe fruit color of light green can be bred. Screening with molecular markers in the early stages can reduce the workload of later screening and identification, accelerating the breeding process.
Claims
1. A molecular marker tightly linked to the pepper fruit color gene CaCHL1, characterized in that: The nucleotide sequence is shown in SEQ ID NO: 2, in which the 23rd base is substituted from G to C.
2. A primer for identifying the molecular marker tightly linked to the pepper fruit color gene CaCHL1 as claimed in claim 1, characterized in that: include: Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTGCTCTCCTACGGTGAATTTCCA-3′; Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTGCTCTCCTACGGTGAATTTCCAC-3′; Reverse primer: 5′-TGATCATTTGCTTGCTTTTGTTGC-3′.
3. The primer according to claim 2, wherein The two forward primers were connected to different fluorescent linker sequences, wherein the linker sequence matching the FAM fluorescence in forward primer 1 was GAAGGTGACCAAGTTCATGCT, and the linker sequence matching the HEX fluorescence in forward primer 2 was GAAGGTCGGAGTCAACGGATT.
4. A kit for identifying the molecular marker tightly linked to the pepper fruit color gene CaCHL1 according to claim 1, characterized in that: Comprising the primer according to claim 2 or 3.
5. Use of the primer according to claim 2 or 3 or the kit according to claim 4 in identifying pepper fruit color types or in molecular-assisted breeding of pepper fruit color.
6. The use according to claim 5, characterized in that The following steps are involved: (1) Extracting DNA from pepper samples to be tested as a template; (2) adding the primers described in claim 2 or 3 or the kit described in claim 4 to perform PCR amplification; (3) Perform genotyping on the amplified products and read the genotyping results.
7. The use according to claim 6, characterized in that When performing genotyping on the amplified product, if only the fluorescent signal corresponding to the forward primer 1 connected to the fluorescent linker sequence is detected in the amplified product, the detection site is the G:G genotype, and the pepper fruit is determined to be a light green dominant plant; if only the fluorescent signal corresponding to the forward primer 2 connected to the fluorescent linker sequence is detected in the amplified product, the detection site is the C:C genotype, and the pepper fruit is determined to be a dark green recessive plant; if the fluorescent signals corresponding to both forward primers 1 and 2 connected to the fluorescent linker sequence are detected in the amplified product, the detection site is the G:C genotype, and the pepper fruit is determined to be a light green heterozygous plant.
Citation Information
Patent Citations
Molecular marker linked to green retardation gene of pepper and application thereof
CN109207622A
Application of SNP (Single Nucleotide Polymorphism) molecular marker for detecting color of mature pepper fruit, specific primer of SNP molecular marker and obtaining method of SNP molecular marker
CN117844959A