Characteristic sequence, marker primer and identification method of fig variety Maskh daufen
By developing the characteristic sequence and molecular-specific marker primer combination of the fig variety Mas-Itaufn, and using SLAF-seq technology and PCR amplification electrophoresis detection, the problem of identification between fig varieties was solved, and rapid and reliable variety identification was achieved.
Patent Information
- Application Number
- CN202410257405.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-07
- Publication Date
- 2025-09-09
AI Technical Summary
Existing technologies make it difficult to achieve accurate and rapid molecular-level identification between fig varieties, resulting in inconveniences in variety identification, promotion and communication in production.
The characteristic sequence and molecular specific marker primer combination of the fig variety Mas-Yitaufn were developed, and molecular markers were developed for 23 materials using SLAF-seq technology. More than 1,000 pairs of primers were designed, and specific identification was achieved through PCR amplification and electrophoresis detection.
The rapid, reliable and specific identification of the fig variety Maas-Yitaufen was achieved, which reduced the sample requirements, made the detection convenient and intuitive, and improved the reliability of identification.
Smart Images
Figure CN120608165A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a characteristic sequence of a fig variety Maas-Ytaufn, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Maas-Ytaufn by utilizing the molecular specific marker primer combination. Background Art
[0002] Fig Ficus carica Ficus genus, Moraceae Ficus A deciduous shrub or small tree native to the Mediterranean coast, it is now being cultivated in many parts of my country, characterized by high yields and rapid returns. Currently, over 20 varieties have performed well, including 'Boji Red,' 'Blanrick,' and 'Mas Yi Dafen.' The fig fruit contains a variety of active ingredients, including polysaccharides, flavonoids, and psoralens, with benefits such as treating sore throats, fighting tumors, lowering blood sugar and lipids, and boosting immunity. Consequently, market demand for figs is growing. While the fruit shape, size, color, and flavor of different fig cultivars vary significantly, the differences between individual plants are minimal. Furthermore, the naming of hybrids between some fig cultivars is confusing, making it difficult to identify, promote, communicate, and cultivate new varieties. Therefore, efforts are underway to develop stable and specific DNA markers at the molecular level, a scientific approach to accurately and rapidly identifying fig varieties. Summary of the Invention
[0003] The purpose of the present invention is to provide a characteristic sequence of the fig variety Mas-yi-Taufin, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Mas-yi-Taufin using the molecular specific marker primer combination; The technical solution adopted in the present invention is: The characteristic sequence groups of the fig variety Mas-Yitaufen are as follows: 1) 45261_48: 5'-ACCTTTCGACAGGATACATCCACCTCAAATGAACCGGTCCACATAACCTAACTTCCCGAACTAAGTGCACCGTTAGATGGATCATTATATCAAAAAAGGCTGGTAGGAAATACTTCTCAAGCATGCNNN NNNNNNNACTCTTCCAACTTCAAAAGTTTGGTGTCGATGAAATATTTGAGGCTCGTTGGAATGAAAACACATGATTGTCTTATTTTGATGCAACAATTATTACCTCTTGCATTGCGGAGAGTATTAACGAAAG -3' 2) 117112_45: 5'-CCGAATTGACTCTTGATCCTCCAACGACGAGCACTGAACCAGAAGATTGGTGGACACTTATGGTTGACGGAGCATCCAATGTCAAAGGTTCTGGCATAGGAGTGTACTGCAGGTCCCCCGATGGCGNNNNN NNNNNACCTGGTTTACAATGAGCTGCGAGTCGCTTTGGATCTTCAAACGTCGAGCCCCCAGCGTTTTTGCCAGCCGTAGTCCAACGATCAAGGCTTCGTATTCAGCTTCATTGTTGGAGGCATTGAATCCT-3' Where NNNNNNNNNN is an unknown sequence within 300bp.
[0004] The present invention also relates to a molecular specific marker primer set for the fig variety Mas-Y-Taufin, wherein the primer sequence is: 1) 45261_48 primer set: 45261_48LF GTCGATGAAATATTTGAGGGCTCG 45261_48RR GTTAATACTCTCCGCAATGCAAG 45261_48SF TCAAATGAACCGGTCCACATAACC 2) 117112_45 primer set: 117112_45LF GAGTCGCTTTGGATCTTCAAAC 117112_45RR AACAATGAAGCTGAATACGAAGC 117112_45SFCGACGAGCACTGAACCAGAAA The two primer sets described above were derived from 23 accessions using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology to develop molecular markers covering the entire genome. An average of 118,891 SLAF tags were developed per sample in this project, with an average sequencing depth of 10.12x. A total of 72.00 Mb reads were generated. Bioinformatics analysis identified 166,254 SLAF tags, including 6,575 polymorphic SLAF tags, for a total of 72,678 population SNPs. Based on these results, over 1,000 primer pairs were designed and screened and validated in 23 samples. DNA fragments specific to the fig variety Maas-et-Aufman were identified; no specific fragments were obtained for the selected primer combinations in other fig varieties. It should be noted that the molecular marker primer combinations described in this invention are limited to fig variety identification, meaning that the samples tested are limited to figs.
[0005] The results of a random sampling of 5 plants of this variety showed that the characteristics of the Mas-Yitaufen fig variety are shown in the table below: The present invention also relates to a method for rapidly identifying the fig variety Maas-Yitaufen using the molecular specific marker primer combination, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primer set as amplification primers, and performing PCR amplification, wherein the primers correspond to binding sites on characteristic sequences such as Figure 1 , Figure 2 As shown; The key to the method of the present invention lies in the selection of amplification primer combinations, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be performed according to conventional methods in the art. Compared with existing molecular marker methods for fig varieties, such as SSR markers, the method of the present invention has the following advantages: (1) Because the primers used have been sequenced and repeatedly verified, their reliability has been greatly improved; (2) The detection is convenient and intuitive. The presence or absence of band combinations can be directly determined by ordinary electrophoresis. However, if the SSR marker method is used, further analysis or sequencing by high-resolution electrophoresis is required after amplification. (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification; Preferably, the PCR amplification system of the present invention is composed as follows: The final concentration of PCR Buffer is 1× dNTPs 1 mmol / L MgCl2 2.5 mmol / L Taq enzyme 1.0 U / reaction 0.2 μM each of upstream and downstream primers Template DNA 60 ng / reaction The balance is ddH2O; The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C; The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used, with a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2, and 1.0% Triton-X-100, with ddH2O as the solvent. Specifically, the method is as follows: (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific labeled primers as amplification primers, PCR amplification is performed: The PCR reaction system per 15 μL is composed as follows: 2×TsingKE master mix 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; PCR reaction conditions are as follows: After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C. (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, spot it on a 1.5% agarose gel, and electrophorese it in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain it with EB and photograph it on an automatic gel image analyzer. If the electrophoresis results show that the DNA sample can be PCR amplified into two bands in the 45261_48 primer set and one band in the 117112_45 primer set, then the fig variety to be tested from the DNA sample is Maastricht; if it does not have this characteristic, then it is not. BRIEF DESCRIPTION OF THE DRAWINGS
[0006] Figure 1 Schematic diagram of the relative positions of the primers in the 45261_48 primer set within the fig DNA signature sequence fragment 45261_48; Figure 2 Schematic diagram of the relative positions of the primers in the 117112_45 primer set within the fig DNA signature sequence fragment 117112_45; Figure 3 PCR amplification results of DNA from 23 fig varieties using the 45261_48 primer set (variety numbers 1-23 represent: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mars-Yitaufen; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). Takara DL2000 marker was used as the marker. Two specific DNA bands were amplified from the fig variety 5, Mars-Yitaufen, using the 45261_48 primer set. Figure 4 PCR amplification results of DNA from 23 fig varieties using the 117112_45 primer set (variety numbers 1-23 represent: 1. Brooke Red; 2. Grace; 3. Brunswick; 4. Early Yellow; 5. Marseilles-Taufin; 6. Strawberry; 7. B1011; 8. Huishankou; 9. Jinaofen; 10. Qinghua; 11. Hongyan; 12. Papa John's; 13. BNR; 14. Hardy; 15. BBR; 16. Baishan; 17. Sala; 18. Rockery; 19. Green Anti-1; 20. Dela; 21. Baiya; 22. California Black; 23. Baraunay). Takara DL2000 marker was used as the marker. Fig variety 5, Marseilles-Taufin, amplified a single DNA band using the 117112_45 primer set. DETAILED DESCRIPTION
[0007] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto: Example
[0008] (1) Extraction of genomic DNA from fig varieties: 0.05 g of young leaves of the tested fig varieties were collected and thoroughly ground with liquid nitrogen. Genomic DNA from the leaves was extracted using the CTAB method. After multiple extractions, the genomic DNA extract of the fig varieties was obtained. The DNA extract was then subjected to 1.5% agarose gel electrophoresis to test the integrity, purity, and concentration. The brightness of the bands was determined for subsequent PCR amplification. The DNA extract was stored in a refrigerator at -20°C until use. (2) Design specific PCR amplification primers. The sequences of the primer pairs are: 1) 45261_48 primer set: 45261_48LF GTCGATGAAATATTTGAGGGCTCG 45261_48RR GTTAATACTCTCCGCAATGCAAG 45261_48SF TCAAATGAACCGGTCCACATAACC 2) 117112_45 primer set: 117112_45LF GAGTCGCTTTGGATCTTCAAAC 117112_45RR AACAATGAAGCTGAATACGAAGC 117112_45SFCGACGAGCACTGAACCAGAAA Synthesized by Shanghai Bioengineering Technology Co., Ltd.; (3) PCR amplification: PCR reaction solution composition (15 μL): 2×TsingKE master mix (Qingke Biotechnology, Beijing) 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 20 ng / μL template DNA 2 μL dd H2O 5.1 μL; The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C. (4) Electrophoresis detection: Take 3 μL of the PCR amplification product from step (3), mix it with 1 μL of 0.25% bromophenol blue buffer, apply it to a 1.5% agarose gel, and electrophorese it in 1×TAE buffer at 5 V / cm. After the electrophoresis is completed, stain it in an aqueous solution containing 0.5 μg / ml EB for 30 minutes, and then stain it on a Bio-rad Gel imaging systemGel Doc takes photos; According to the above method, 24 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 3 , Figure 4 ; Only fig variety number 5, Maas-et-Aufing, amplified two specific DNA bands using primer set 45261_48, and one specific DNA band using primer set 117112_45; the number of bands for the remaining fig varieties varied. This demonstrates that the molecularly specific marker primer pairs developed by this invention are highly stable and specific for early identification of the fig variety Maas-et-Aufing.
Claims
1. The characteristic sequence of the fig variety Mas-Yitaufen, which is composed of two coexisting specific DNA fragments, has the following sequence: 1）45261_48： 5'-ACCTTTCGACAGGATACATCCACCTCAAATGAACCGGTCCACATAACTTAACTTCCCGAACTAAGTGCACCGTTAGATGGATCATTATATCAAAAAAGGCTGGTAGGAAATACTTCTCAAGCATGCNNN NNNNNNNACTCTTCCAACTTCAAAAGTTTGGTGTCGATGAAATATTTGAGGCTCGTTGGAATGAAAACACATGATTGTCTTATTTTGATGCAACAATTATTACCTCTTGCATTGCGGAGAGTATTAACGAAAG -3', 2）117112_45： 5'-CCGAATTGACTCTTGATCCTCCAACGACGAGCACTGAACCAGAAGATTGGTGGACACTTATGGTTGACGGAGCATCCAATGTCAAAGGTTCTGGCATAGGAGTGTACTGCAGGTCCCCCGATGGCGNNN NNNNNNNACCTGGTTTACAATGAGCTGCGAGTCGCTTTGGATCTTCAAACGTCGAGCCCCCAGCGTTTTTGCCAGCCGTAGTCCAACGATCAAGGCTTCGTATTCAGCTTCATTGTTGGAGGCATTGAATCCT -3', Where NNNNNNNNNN is an unknown sequence within 300bp.
2. A primer set for detecting the characteristic sequence of the fig variety Mas-Yitaufen according to claim 1, wherein the primer set is composed of the following primer sequences: 1) 45261_48 primer set: 45261_48LF:GTCGATGAATATTTGAGGGCTCG 45261_48RR:GTTAATACTCTCCGCAATGCAAG 45261_48SF:TCAAATGAACCGGTCCACATAACC 2) 117112_45 primer set: 117112_45LF: GAGTCGCTTTGGATCTTCAAAC 117112_45RR:AACAATGAAGCTGAATACGAAGC 117112_45SF:CGACGAGCACTGAACCAGAAA.
3. A method for rapidly identifying the fig variety Maas-et-Aufman using the primer set of claim 2, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, performing PCR amplification using the primers in groups, and performing electrophoresis on the amplified products. If the electrophoresis results show two specific DNA bands amplified by the 45261_48 primer set and one specific DNA band by the 117112_45 primer set, the fig variety to be tested is the fig variety Maas-et-Aufman; otherwise, the fig variety is not identified; the primer set comprises the following primer sequences: 1) 45261_48 primer set: 45261_48LF:GTCGATGAATATTTGAGGGCTCG 45261_48RR:GTTAATACTCTCCGCAATGCAAG 45261_48SF:TCAAATGAACCGGTCCACATAACC 2) 117112_45 primer set: 117112_45LF: GAGTCGCTTTGGATCTTCAAAC 117112_45RR:AACAATGAAGCTGAATACGAAGC 117112_45SF:CGACGAGCACTGAACCAGAAA.
4. The method according to claim 3, wherein The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s; denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s, for a total of 30 to 40 cycles; and a final fill-in at 72°C for 300 s, with a termination temperature of 4°C.
5. The method according to claim 3, wherein The method is as follows: 1) Take the fig leaves to be tested, grind them in liquid nitrogen, and extract the genomic DNA from the fig leaves using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) 3 μL of the amplified product from step 2) was mixed with 1 μL of 0.25% bromophenol blue buffer and spotted on a 1.5% agarose gel. The gel was electrophoresed in 1×TAE buffer at 5 V / cm. After electrophoresis, the gel was stained with EB and photographed on an automated gel image analyzer. If the electrophoresis results showed the characteristic band described in claim 3, the fig variety being tested was Maas-Hil-Taufn; otherwise, it was not.