A fermented traditional Chinese medicine feed additive for increasing lean meat percentage of fattening pigs

Abstract

The application provides a fermented traditional Chinese medicine feed additive for improving lean meat percentage of fattening pigs, and belongs to the technical field of feed.The application prepares a feed additive by compounding stem and leaf powder of Radix Dipsaci, stem and leaf powder of Radix Anemarrhenae and corn powder and then carrying out double fermentation by Bacillus subtilis and Lactobacillus.The expression level of fatty acid synthase of the feed additive fed to the fattening pigs is significantly reduced.The lean meat percentage of the control group of pigs is 62.75%, the lean meat percentage of the group of pigs fed with a conventional traditional Chinese medicine feed additive is 64.35%, and the lean meat percentage of the group of pigs fed with the fermented traditional Chinese medicine feed additive is 67.87%, and the lean meat percentage is significantly improved.The fattening cycle of the control group of pigs is 104 days, and the feed conversion ratio is 3.02:1;the fattening cycle of the group of pigs fed with the conventional traditional Chinese medicine feed additive is 101 days, and the feed conversion ratio is 2.94:1;the fattening cycle of the group of pigs fed with the fermented traditional Chinese medicine feed additive is shortened to 88 days, and the feed conversion ratio is 2.57:1, and the breeding efficiency is significantly improved.

Description

Technical Field

[0001] This invention belongs to the field of feed technology, and in particular relates to a fermented traditional Chinese medicine feed additive for improving the lean meat percentage of fattening pigs. Background Technology

[0002] With the improvement of living standards, the concept of healthy eating has gained popularity, and meat products that are high in protein, low in cholesterol, and low in calories are becoming increasingly popular. High lean meat percentage means low fat, aligning with modern healthy eating trends. As the most consumed meat in my country, pork with a high lean meat percentage has become a crucial indicator for the pig farming industry. Pigs with a high lean meat percentage have higher muscle growth efficiency and generally better feed conversion ratio (FCR), meaning they consume less feed to gain 1 kg of weight, reducing breeding costs. Pigs with a low lean meat percentage require more energy for fat deposition and have lower feed utilization. Pigs with a high lean meat percentage (such as Duroc and Landrace) grow faster, shortening the time to market and improving capital turnover. The high carcass yield of pigs with a high lean meat percentage better meets the needs of processing enterprises (such as those producing ham and sausages, which prefer lean meat). Pigs with excessive fat may require additional trimming during slaughter, increasing labor and costs.

[0003] Driven by strong market demand for high-lean-ratio pork, ractopamine was once a powerful tool for increasing the lean meat percentage of pork. Ractopamine is a class of substances that can promote muscle growth and reduce fat deposition in animals; it belongs to the β-adrenergic receptor agonists. The most well-known examples are ractopamine and clenbuterol. They activate β-receptors, accelerate fat breakdown, inhibit fat synthesis, and allow more nutrients to be used for muscle growth. However, consuming pork with ractopamine residues can cause serious harm to humans; serious adverse events of ractopamine poisoning have occurred in the past. Excessive pursuit of lean meat percentage can also lead to stress sensitivity in pigs; for example, some high-lean-ratio breeds are prone to stress syndrome. Rapid muscle growth may increase the burden on bones and joints, causing leg problems. Traditional Chinese medicine has the effects of regulating and improving the health of pigs, strengthening muscles and bones, promoting nutritional exercise and lipid-protein conversion, etc. Developing traditional Chinese medicine feed additives is a safe and effective way to improve the lean meat percentage of pigs. Summary of the Invention

[0004] The purpose of this invention is to provide a fermented traditional Chinese medicine feed additive for improving the lean meat percentage of fattening pigs, belonging to the field of feed technology.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] Firstly, this invention provides a fermented traditional Chinese medicine feed additive for improving the lean meat rate of fattening pigs. The feed additive is a compound of Dipsacus asper stem and leaf powder, Achyranthes bidentata stem and leaf powder and corn flour, prepared by double fermentation with Bacillus subtilis and Lactobacillus plantarum.

[0007] Furthermore, the mass ratio of Dipsacus asperoides stem and leaf powder, Achyranthes bidentata stem and leaf powder to corn flour in the feed additive is 1:1:1.

[0008] Furthermore, the feed additive can be used to increase the lean meat percentage of fattening pigs.

[0009] Furthermore, the preparation method of the feed additive is as follows:

[0010] (1) Harvesting of Authentic Sichuan Dipsacus root: Harvest Sichuan Dipsacus root on the same day; Dry and crush Sichuan Dipsacus stems and leaves.

[0011] (2) Harvesting of Authentic Sichuan Achyranthes: The roots of Sichuan Achyranthes are harvested on the same day, and the stems and leaves of Sichuan Achyranthes are dried and crushed.

[0012] (3) Mix the powder of stems and leaves of Dipsacus asperoides, powder of stems and leaves of Achyranthes bidentata and corn flour in a mass ratio of 1:1:1, add water equal to 55% of the dry powder weight, and stir evenly.

[0013] (4) Press 1×10 9 Add Bacillus subtilis at a rate of CFU / kg, mix well and ferment for 24 hours;

[0014] (5) Press 1×10 9 Add Lactobacillus plantarum at a rate of CFU / kg, mix well and ferment for 48 hours;

[0015] (6) Dry with hot air at 60~80°C until the moisture content is ≤10%, crush with a pulverizer, and store in sealed plastic bags.

[0016] Furthermore, the feed additive is mixed into the basic feed at a ratio of 1% by mass.

[0017] Beneficial Effects: This invention combines the stem and leaf powders of *Dipsacus asper* and *Achyranthes bidentata* with corn flour, and prepares a feed additive through dual fermentation by *Bacillus subtilis* and *Lactobacillus plantarum*. The fatty acid synthase expression level of fattening pigs fed this feed additive was significantly lower than that of the control group and the group fed with conventional Chinese herbal feed additives. The lean meat percentage of the control group was 62.75%, the lean meat percentage of the group fed with conventional Chinese herbal feed additives was 64.35%, and the lean meat percentage of the group fed with fermented Chinese herbal feed additives was 67.87%, showing a significant increase in lean meat percentage. The fattening period of the control group was 104 days with a feed conversion ratio of 3.02:1; the fattening period of the group fed with conventional Chinese herbal feed additives was 101 days with a feed conversion ratio of 2.94:1; and the fattening period of the group fed with fermented Chinese herbal feed additives was shortened to 88 days with a feed conversion ratio of 2.57:1, significantly improving breeding efficiency. This invention relates to a fermented Chinese herbal medicine feed additive prepared from the non-medicinal parts of pure natural Chinese medicinal plants. It is low in cost and highly safe, and can improve the lean meat rate of pigs while increasing breeding efficiency. Attached Figure Description

[0018] Figure 1Effects of additives on the expression level of porcine fatty acid synthase;

[0019] Figure 2 The impact of additives on the pig fattening cycle;

[0020] Figure 3 The effect of additives on the feed conversion ratio of pigs;

[0021] Figure 4 The effect of additives on the lean meat percentage of pork. Detailed Implementation

[0022] Example 1: Preparation of conventional Chinese herbal feed additives

[0023] (1) Harvesting of Authentic Sichuan Dipsacus root: Harvest Sichuan Dipsacus root on the same day; Dry and crush Sichuan Dipsacus stems and leaves.

[0024] (2) Harvesting of Authentic Sichuan Achyranthes: The roots of Sichuan Achyranthes are harvested on the same day, and the stems and leaves of Sichuan Achyranthes are dried and crushed.

[0025] (3) Mix the powdered stems and leaves of Dipsacus asperoides and the powdered stems and leaves of Achyranthes bidentata with corn flour in a mass ratio of 1:1:1 to make a feed additive.

[0026] Example 2: Preparation of Fermented Traditional Chinese Medicine Feed Additive

[0027] (1) Harvesting of Authentic Sichuan Dipsacus root: Harvest Sichuan Dipsacus root on the same day; Dry and crush Sichuan Dipsacus stems and leaves.

[0028] (2) Harvesting of Authentic Sichuan Achyranthes: The roots of Sichuan Achyranthes are harvested on the same day, and the stems and leaves of Sichuan Achyranthes are dried and crushed.

[0029] (3) Mix the powder of stems and leaves of Dipsacus asperoides, powder of stems and leaves of Achyranthes bidentata and corn flour in a mass ratio of 1:1:1, add water equal to 55% of the dry powder weight, and stir evenly.

[0030] (4) Press 1×10 9 Add Bacillus subtilis at a rate of CFU / kg, mix well and ferment for 24 hours;

[0031] (5) Press 1×10 9 Add Lactobacillus plantarum at a rate of CFU / kg, mix well and ferment for 48 hours;

[0032] (6) Dry with hot air at 60~80°C until the moisture content is ≤10%, crush with a pulverizer, and store in sealed plastic bags.

[0033] Example 3: Effects of Traditional Chinese Medicine Feed Additives on Fattening Pigs

[0034] (1) Select 300 healthy Landrace piglets weighing 30±1.5 kg and randomly divide them into 3 groups of 100 piglets each. They are then isolated and fed in isolation. Each group of pigs is immunized and fed according to the routine immunization program.

[0035] (2) The control group was fed a basic feed; the conventional Chinese medicine feed additive group was fed a basic feed with 1% conventional Chinese medicine feed additive by mass; the fermented Chinese medicine feed additive group was fed a basic feed with 1% fermented Chinese medicine feed additive by mass; the pigs were fed once at 8:00 and 16:00 every day, and were allowed free access to food and water. During this period, the health status and activity of the pigs were observed.

[0036] (3) Effects of traditional Chinese medicine feed additives on the expression level of fatty acid synthase in pigs

[0037] After feeding the pigs with the traditional Chinese medicine feed additive for one month, 10 pigs were randomly selected from each group. 2 mL of anticoagulated peripheral blood was collected, and total RNA was extracted using the Trizol method and reverse transcribed into cDNA. Using cDNA as a template and GAPDH as a correction factor, relative real-time quantitative PCR was used to detect the mRNA levels of fatty acid synthase (FASN) in the peripheral blood of each group of pigs.

[0038] The primers for real-time PCR are as follows:

[0039] GAPDH-F:tggacattgtcgccatcaat

[0040] GAPDH-R: gactgtgccgtggaacttgc

[0041] FASN-F: ggtctggttcatctgctcag

[0042] FASN-R: gtccgagcgcaggatggagt

[0043] Real-time quantitative PCR detection reaction system (20 μL):

[0044] 2×SYBR Green supermix 10μL

[0045] F / R (upstream / downstream primers) 0.4 μL / 0.4 μL

[0046] 0.8 μL template cDNA

[0047] ddH2O 8.4μL

[0048] from Figure 1 It can be seen that the expression level of fatty acid synthase in pigs fed with conventional Chinese medicine feed additives was slightly lower than that in the control group fed only with basal feed, while the expression level of fatty acid synthase in pigs fed with fermented Chinese medicine feed additives was significantly lower than that in the conventional Chinese medicine feed additive group and the control group.

[0049] (4) Each group of pigs was raised to an average weight of approximately 110 kg before slaughter. The feeding cycle and feed conversion ratio of each group of pigs were recorded. The lean meat percentage of pigs was determined by the carcass division method after slaughter. After slaughter, the head, hooves, and internal organs were removed to obtain the carcass. The carcass was divided into lean meat, fat, bone, skin, etc. according to commercial standards. The lean meat percentage was calculated after weighing: lean meat percentage = lean meat weight / carcass weight × 100%.

[0050] Depend on Figure 2 , Figure 3 It can be seen that the fattening period of pigs in the control group fed only basic feed was 104 days, with a feed conversion ratio of 3.02:1; the fattening period of pigs in the group fed with conventional Chinese herbal feed additives was 101 days, with a feed conversion ratio of 2.94:1; and the fattening period of pigs in the group fed with fermented Chinese herbal feed additives was shortened to 88 days, with a feed conversion ratio of 2.57:1, significantly improving breeding efficiency.

[0051] Depend on Figure 4 It can be seen that the lean meat rate of pigs in the control group fed only basic feed was 62.75%; the lean meat rate of pigs in the group fed conventional Chinese herbal feed additives was 64.35%; and the lean meat rate of pigs in the group fed fermented Chinese herbal feed additives was 67.87%, showing a significant increase in lean meat rate.

Claims

1. A fermented traditional Chinese medicine feed additive for improving the lean meat percentage of fattening pigs, characterized in that, The feed additive is a compound of Dipsacus asperoides stem and leaf powder, Achyranthes bidentata stem and leaf powder and corn flour, prepared by double fermentation of Bacillus subtilis and Lactobacillus plantarum.

2. The feed additive according to claim 1, characterized in that, The mass ratio of the powdered stems and leaves of Dipsacus asperoides and Achyranthes bidentata to corn flour in the feed additive is 1:1:

1.

3. The feed additive according to claim 1, characterized in that, The preparation method of the feed additive is as follows: (1) Harvesting of Authentic Sichuan Dipsacus root: Harvest Sichuan Dipsacus root on the same day; Dry and crush Sichuan Dipsacus stems and leaves. (2) Harvesting of Authentic Sichuan Achyranthes: The roots of Sichuan Achyranthes are harvested on the same day, and the stems and leaves of Sichuan Achyranthes are dried and crushed. (3) Mix the powder of stems and leaves of Dipsacus asperoides, powder of stems and leaves of Achyranthes bidentata and corn flour in a mass ratio of 1:1:1, add water equal to 55% of the dry powder weight, and stir evenly. (4) Press 1×10 9 Add Bacillus subtilis at a rate of CFU / kg, mix well and ferment for 24 hours; (5) Press 1×10 9 Add Lactobacillus plantarum at a concentration of CFU / kg, mix well, and ferment for 48 hours. (6) Dry with hot air at 60~80°C until the moisture content is ≤10%, then crush with a pulverizer and store in sealed plastic bags.

Images