Method for improving expression of full-length collagen type iii

Abstract

The application relates to a method for improving the expression amount of full-length type III collagen, and belongs to the field of genetic engineering. The 15th leucine of human full-length type III collagen shown in SEQ ID NO. 1 is mutated into aspartic acid, and the obtained mutant is high-level secretory expressed in CHO-S cells. The provided human full-length type III collagen mutant provides a basis for the preparation and production of biological medicines, biological materials and cosmetics.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for increasing the expression level of full-length type III collagen. Background Technology

[0002] Collagen is a biological macromolecule and a major component of animal connective tissue. It is also the most abundant and widely distributed functional protein in mammals, accounting for 25%–30% of total protein, and in some organisms, even exceeding 80%. As the most abundant animal protein, 28 types of collagen have been identified to date. Type I collagen, the most common type in humans, is mainly distributed in the skin, tendons, and bones; Type II is mainly distributed in cartilage; and Type III is mainly distributed in the skin and vascular system. Type III collagen has wide applications in repairing damaged skin, promoting wound healing, and maintaining skin appearance and condition. However, with human growth, the proportion of Type III collagen in skin tissue gradually decreases.

[0003] Currently, there are two main methods for obtaining collagen: animal extraction and genetic engineering. However, collagen obtained through animal extraction has a more complex composition, loses some biological activity, is difficult to purify, and presents problems such as immunogenicity. In recent years, strategies for obtaining recombinant human collagen through genetic engineering have been successful, but most of these are fragments, approximately tens of kDa in size, and do not reflect the natural structure and function of collagen. Therefore, developing natural full-length human collagen through genetic engineering is of great significance.

[0004] Recombinant human collagen expression systems include prokaryotes (mainly Escherichia coli) and eukaryotes (mainly yeast, plants, mammalian cells, and baculoviruses). Currently, commonly used expression systems primarily utilize E. coli and yeast. However, low-cost microbial expression systems using E. coli and yeast require the addition of corresponding modifying enzymes and lack post-translational modifications found in animal cells. In contrast, human full-length collagen expressed in plants, baculoviruses, and mammalian cells exhibits a better triple-helix structure and biological activity, but its yield is lower than that of microbial expression systems.

[0005] CHO-S cells are the most commonly used cell type in mammalian cell expression systems, possessing high genetic stability and suitability for large-scale culture and recombinant protein production. They offer advantages such as genetic stability, high expression levels, ease of culture, and wide applicability. Therefore, increasing the expression level of full-length human collagen in CHO-S cells is of great significance. However, current technologies lack effective methods for increasing the expression level of full-length human collagen in CHO-S cells. Summary of the Invention

[0006] The purpose of this invention is to provide a method for increasing the expression level of full-length human type III collagen in CHO-S cells.

[0007] The technical solution of the present invention is as follows:

[0008] This invention provides a human full-length type III collagen mutant, obtained by mutating the 15th leucine at the N-terminus to aspartic acid based on the amino acid sequence shown in SED ID NO.1.

[0009] In one embodiment, the amino acid sequence of the mutant is shown in SED ID NO.4.

[0010] The present invention also provides a fusion protein containing the mutant.

[0011] In one embodiment, a 6×His fragment and the signal peptide shown in SEQ ID NO.7 are sequentially linked to the N-terminus of the mutant.

[0012] The present invention also provides a gene encoding the above-mentioned mutant, the nucleotide sequence of which is shown in SEQ ID NO. 5.

[0013] The present invention also provides a gene encoding the fusion protein.

[0014] The present invention also provides a recombinant plasmid containing the above-mentioned gene.

[0015] The present invention also provides recombinant CHO cells expressing the mutant or the fusion protein or carrying the gene or containing the recombinant plasmid.

[0016] The present invention also provides a recombinant CHO cell, using CHO-S cells as the host and pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin as the vector, to recombinantly express the fusion protein.

[0017] In one embodiment, the recombinant CHO cells are constructed as follows: the signal peptide gene shown in SEQ ID NO. 8 and the human full-length type III collagen mutant gene containing the 6×His encoding gene shown in SEQ ID NO. 6 are sequentially linked after the CMV promoter of the plasmid pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin to construct a recombinant plasmid; the recombinant plasmid is then transfected into CHO-S cells to obtain recombinant CHO cells.

[0018] The present invention also provides a method for in vitro recombinant expression of full-length human type III collagen, wherein the recombinant CHO cells are cultured in a culture medium for at least 5 days.

[0019] In one embodiment, feeding and sugar supplementation are performed during the culture process; the feeding is performed by adding fresh culture medium on days 1, 3, and 5 of the culture, with the amount of supplementation being 5-10% of the initial culture medium volume; the sugar supplementation is performed by adding glucose to a concentration of 6 g / L or higher when the glucose concentration is below 3 g / L.

[0020] The present invention also provides the use of the mutant, the fusion protein, the gene, the recombinant plasmid, or the recombinant CHO cell in the in vitro expression of full-length human type III collagen or products containing full-length human type III collagen.

[0021] Beneficial effects:

[0022] This invention utilizes genetic engineering methods to successfully express full-length human type III collagen in CHO-S cells. By mutating the 15th leucine residue at the N-terminus of full-length human type III collagen to aspartic acid and linking it to a signal peptide, its expression level was increased, with the mutant showing a 1.3-fold increase in expression compared to the wild type. Attached Figure Description

[0023] Figure 1 A schematic diagram of the construction of full-length human type III collagen protein particles.

[0024] Figure 2 A schematic diagram of the construction of full-length human type III collagen protein particles containing signal peptides.

[0025] Figure 3 A schematic diagram of the construction of a human full-length type III collagen L15D mutant plasmid containing a signal peptide.

[0026] Figure 4 Human full-length type III collagen SDS-PAGE gel electrophoresis; 1-4 represent supernatant samples taken on days 2, 4, 6, and 8 after transfection, respectively.

[0027] Figure 5 SDS-PAGE gel electrophoresis of human full-length type III collagen L15D mutant; 1-4 represent supernatant samples taken on days 2, 4, 6, and 8 after transfection, respectively.

[0028] Figure 6 Enzyme-linked immunosorbent assay (ELISA); WT: natural sequence of human full-length type III collagen.

[0029] Figure 7 Western blotting results of full-length type III collagen mutants from different individuals; Ctrl: cell culture supernatant without plasmid transfection; 1: K6D; 2: W9D; 3: L34D; 4: K45E; 5: S58E; 6: Q69D; 7: T95D; 8: L15D.

[0030] Figure 8Enzyme-linked immunosorbent assay (ELISA) of different mutants. Detailed Implementation

[0031] The invention will be further described in detail below through examples.

[0032] However, the following examples are merely illustrative, and the content of this invention is not limited to the following embodiments.

[0033] The cell growth medium used in the following examples was serum-free CHO Hi-Trans medium, 6 mmol / L L-glutamine, and 100–200× anti-clustering agent (Opmai, catalog number AC609916).

[0034] The culture conditions used in the following examples are 8% (v / v) CO2 shaker, 120 rpm, 37°C.

[0035] Example 1: Construction of recombinant full-length human type III collagen and its mutant plasmid

[0036] A 6×His fragment was ligated to the N-terminus of the amino acid sequence of full-length human type III collagen COL3A1, designated as fragment 1; the nucleotide sequence encoding fragment 1 (e.g., SED ID) was artificially synthesized. As shown in NO.3, using the nucleotide fragment as a template, PCR was performed with primers ATTTCCGGTATGCACCATCACCATCACCAC and CGAGGAATTCTCACAGGAAGCACACGGGGC to obtain fragment 2. Using plasmid pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin (purchased from Hanheng Biotechnology Co., Ltd., product number LV012) as a template, PCR was performed with primers GTGTGCTTCCTGTGAGAATTCCTCGAGACTAG and GTGATGGTGCATACCGGAAATAGATCCTCT to obtain fragment 3. Fragment 2 and fragment 3 were ligated using homologous recombination to obtain a recombinant plasmid. After transformation, colony PCR, and sequencing, the recombinant plasmid pHBLV-CMV-COL3A1-EF1-Zsgreen-T2A-puromycin was finally obtained. The constructed plasmid map is shown below. Figure 1 As shown.

[0037] Two pairs of primers were designed for PCR amplification. A signal peptide sequence was added after the CMV promoter of the recombinant plasmid pHBLV-CMV-COL3A1-EF1-Zsgreen-T2A-puro. First, using the recombinant plasmid pHBLV-CMV-COL3A1-EF1-Zsgreen-T2A-puro as a template, primers were added with the following sequence: CCGGCGTGCGCGCGCGGGCAGCGGCATGCACCATCACCATCACCACATGAGCTTCGTGCAG.

[0038] PCR amplification was performed using TCAGCAGCACCAGGCAGCACAGCAGCGCGCTGCTATGCATACCGGAAATAGATCCTCTA as primers. Then, using the amplified product as a template, amplification was performed using GTGCTGCCTGGTGCTGCTGACCGGCGTGCGCGCG and TCAGCAGCACCAGGCAGCACAGCAGCGCGCTGCTATGCATACCGGAAATAGATCCTCTA as templates to obtain a recombinant plasmid carrying the signal peptide nucleotide sequence (SED ID NO. 8). After transformation, colony PCR verification, and sequencing, the recombinant plasmid pHBLV-CMV-SP-COL3A1-EF1-Zsgreen-T2A-puro was obtained. The constructed plasmid map is shown below. Figure 2 .

[0039] Based on the recombinant plasmid pHBLV-CMV-SP-COL3A1-EF1-Zsgreen-T2A-puro, primers for the mutation site were designed. The primer sequences are GCTGCTCCTGGCCCTGGATCACCCTACCATTATCC and GGATAATGGTAGGGTGATCCAGGGCCAGGAGCAGC. After PCR, DpN I digestion was performed, followed by transformation, colony PCR, and sequencing. The recombinant mutant plasmid pHBLV-CMV-SP-COL3A1-N-L15D-EF1-Zsgreen-T2A-puro was finally obtained. The constructed plasmid map is as follows: Figure 3 .

[0040] Example 2 Construction and Culture of Recombinant Cells

[0041] CHO-S cell culture:

[0042] Preheat CHO Hi-Trans medium at 37°C for 20-30 minutes, and supplement with L-glutamine to a final concentration of 6 mM. Collect cells at a density of (3-4) × 10⁶ cells / day. 6Cells with a density of cells / ml, cell viability greater than 95%, and in mid-logarithmic growth phase were passaged. The required amount of seed culture was aseptically transferred to an appropriate volume of shake flask, and CHO Hi-Trans medium containing 6 mM L-glutamine and 100–200 × anti-clustering agent was added. The shake flasks were then placed in a cell culture shaker at 37°C, 80% humidity, 120 rpm (50 mm amplitude), and 8% CO2 for culture.

[0043] CHO-S cell transfection:

[0044] Taking a 125mL shake flask as an example:

[0045] 1. Transfected cell preparation: Seed cells and culture to (5-6)×10⁶ cells / year. 6 cells / ml, cell viability ≥95%.

[0046] 2. Preparation of transfection complex

[0047] (1) Preparation of plasmid dilution: Add 25 μg of plasmid to CHO Hi-Trans medium and mix gently. The volume of plasmid dilution is 1.25 mL.

[0048] (2) Preparation of transfection reagent dilution: Add 175 μL of CarpTrans transfection reagent to CHO Hi-Trans medium and mix gently. The volume of the transfection reagent dilution is 1.25 mL.

[0049] (3) Preparation of plasmid-transfection reagent complex: Add the transfection reagent dilution to the plasmid dilution, mix gently, and incubate at room temperature for 10-15 min to fully react and form the plasmid-transfection reagent complex.

[0050] 3. Transfection and culture

[0051] (1) Slowly add the incubated plasmid-transfection reagent complex to the cells to be transfected while gently shaking the flask.

[0052] (2) The cells were cultured in a cell culture shaker at 37°C, 80% humidity, 120 rpm (50 mm amplitude), and 8% CO2. To increase the expression level, the culture temperature was lowered to 32°C 16-20 h after transfection.

[0053] (3) Add anti-clustering agent

[0054] Add 125-250 μL of anti-cell clumping agent 12-18 h after transfection.

[0055] (4) Add supplementary feed and glucose

[0056] When protein can only be harvested after more than 5 days of cell culture, additional feed and glucose need to be added.

[0057] Feeding: CHO Hi-Trans feed was added on days 1, 3, and 5 after transfection, with each addition being 7.5% of the initial culture volume, i.e., 1.875 mL.

[0058] Sugar supplementation: Sample the glucose concentration in the supernatant daily. If it is below 3g / L, supplement to 6g / L.

[0059] 4. Cell harvesting

[0060] When expressing secreted proteins, cells are harvested when cell viability is ≤60%.

[0061] Following the method described above, the recombinant plasmid pHBLV-CMV-SP-COL3A1-EF1-Zsgreen-T2A-puro obtained in Example 1 was transfected into CHO-S cells to obtain wild-type recombinant cells; the recombinant mutant plasmid pHBLV-CMV-SP-COL3A1-N-L15D-EF1-Zsgreen-T2A-puro was transfected into CHO-S cells to obtain mutant recombinant cells. After transfection, the obtained recombinant cells were cultured again following the method described above, and samples were taken on days 2, 4, 6, and 8 post-transfection to detect the expression of full-length human type III collagen.

[0062] Example 3: Expression of full-length human type III collagen

[0063] SDS-PAGE gel electrophoresis was used to detect the expression of full-length human type III collagen.

[0064] A 10% separating gel and a 5% stacking gel were prepared. The supernatants from CHO-S cells transfected with full-length human type III collagen and its mutant plasmids were subjected to SDS-PAGE gel electrophoresis on days 2, 4, 6, and 8. The results are as follows: Figure 4 and Figure 5 As shown, the 130kDA band represents full-length human collagen, and the mutant expression level was higher than that of the native full-length collagen on day 8.

[0065] Collect the culture supernatant from day 8 of culture and perform protein-linked immunosorbent assay (ELISA) on full-length human type III collagen:

[0066] 1. Sample Addition: Set up 5 concentration points for the standards in 10 wells, with each concentration having parallel wells. Add 50 μL of the standard at different concentrations. Set up 1 blank well and add 50 μL of distilled water. For the sample wells, first add 40 μL of sample diluent to the sample wells on the ELISA plate, then add 10 μL of the sample to be tested. When adding the sample, place it at the bottom of the well, avoiding contact with the well walls, and gently shake to mix.

[0067] 2. Incubation: After sealing the plate with sealing film, incubate at 37°C for 30 minutes.

[0068] 3. Solution preparation: Dilute the 30-fold concentrated washing solution with distilled water 30 times and set aside.

[0069] 4. Washing: Carefully peel off the sealing film, discard the liquid, shake dry, fill each well with washing solution, let stand for 30 seconds and then discard. Repeat this process 5 times, then pat dry.

[0070] 5. Add enzyme: Add 50 μL of enzyme-labeled reagent to each well, except for the blank wells.

[0071] 6. Incubation: Same procedure as 2.

[0072] 7. Washing: Same as 4.

[0073] 8. Color development: Add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix, and develop at 37°C in the dark for 15 min.

[0074] 9. Termination: Add 50 μL of stop solution to each well to stop the reaction (the blue color will immediately turn yellow).

[0075] 10. Measurement: Zero the instrument using the blank well, and measure the absorbance (OD value) of each well sequentially at a wavelength of 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.

[0076] The results are as follows Figure 6 As shown, the expression level of full-length human type III collagen in the natural sequence is approximately 38 mg / L, while the expression level of the mutant L15D is approximately 50 mg / L. The expression level of full-length human type III collagen in the mutant is 1.3 times that of the natural sequence.

[0077] Comparative Example 1: Expression of other mutants of full-length type III collagen

[0078] Following the method described in Example 1, the N-terminal 6th lysine, 9th tryptophan, 34th leucine, 45th lysine, 58th serine, 69th glutamine, and 95th threonine of human full-length type III collagen were mutated to aspartic acid, aspartic acid, aspartic acid, glutamic acid, glutamic acid, aspartic acid, and aspartic acid, respectively. This resulted in seven recombinant mutant plasmids: pHBLV-CMV-SP-COL3A1-N-K6D-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-W9D-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-CO L3A1-N-L34D-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-K45E-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-S58E-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-Q69D-EF1-Zsgreen-T2A-puro, and pHBLV-CMV-SP-COL3A1-N-T95D-EF1-Zsgreen-T2A-puro, with corresponding primers TTCG, are respectively... TGCAGGATGGCAGCTGGCTGCTCCTG and GCTGCCATCCTGCACGAAGCTCATGTGGTGAT, GTGCAGAAGGGCAGCGATCTGCTCCTGGCCCTG and CAGGGCCAGGAGCAGATCGCTGCCC TTCTGCAC, GCGGCTGCAGCCACGATGGGCAGAGCTACGC and GCGTAGCTCTGCCCATCGTGGGCTGCAGCCGC, ACGTGTGGGAGCCCGAGCCCTGTCAGATCTGCGTG and CACGCAGATC TGACAGGGCTCGGGCTCCCACACGT, GACAGCGGCGAGGTGCTGTGCGACGACATCATCTG and CAGATGATGTCGTCGCACAGCACCTCGCCGCTGTC, GACGACATCATCTGCGACGAC GATGAGCTGGACTG and CAGTCCAGCTCATCGTCGTCGCAGATGATGTCGTC, GCCCCCCACAGCCCCTGATAGACCTCCCAACGG and CCGTTGGGAGGTCTATCAGGGGCTGTGGGGGGC.

[0079] Referring to Example 2, the above 7 recombinant mutant plasmids and the recombinant plasmid pHBLV-CMV-SP-COL3A1-N-L15D-EF1-Zsgreen-T2A-puro constructed in Example 1 were transfected into CHO-S cells to obtain mutant recombinant cells. Samples were taken on the 8th day after transfection, and the expression of human full-length type III collagen was detected by Western Blot.

[0080] The specific experimental steps for Western blotting are as follows:

[0081] 1. SDS-PAGE gel electrophoresis: Load samples in sequence and run the gel;

[0082] 2. PVDF membrane treatment: Cut a PVDF membrane to the same size as the SDS-PAGE gel, place it in an appropriate amount of methanol, shake and soak for 30 seconds, then place the PVDF membrane in a pre-cooled transfer buffer to equilibrate for transfer; remove the SDS-PAGE gel after electrophoresis and place it in the transfer buffer to equilibrate.

[0083] 3. Transfer: Following the sequence of blackboard-sponge-3 layers of filter paper-SDS gel-PVDF membrane-3 layers of filter paper-sponge-whiteboard, make a sandwich clip, place it in the transfer electrophoresis tank, set the constant current mode, 300mA, transfer for 150min;

[0084] 4. Blocking: After the transfer is complete, wash the membrane 3 times with TBST, 5 min each time; place the membrane in the blocking solution and block at room temperature for 1-2 h;

[0085] 5. Incubation of primary antibody: Dilute COL3A1 primary antibody with blocking buffer at the optimal ratio and incubate overnight at 4°C;

[0086] 6. Rinsing: After primary antibody incubation, wash the membrane three times with TBST, 10 min each time;

[0087] 7. Incubate the secondary antibody: Dilute the secondary antibody with TBST, add the secondary antibody, and incubate at room temperature for 1 hour;

[0088] 8. Rinsing: After the secondary antibody incubation is completed, wash the membrane 3 times with TBST, 10 min each time;

[0089] 9. Exposure: Mix equal amounts of solution A and solution B of the Western Blot ultrasensitive luminescent solution, and drop them evenly onto the PVDF membrane. Expose the membrane using the instrument.

[0090] The results are as follows Figure 7 As shown, among the eight recombinant mutant plasmids, the expression levels from high to low were L15D, K45E, S58E, Q69D, and T95D, with L15D showing the highest expression level after mutation.

[0091] Following the method described in Example 3, all mutants underwent protease-linked immunosorbent assay (PCR) of full-length human type III collagen, and the results are as follows: Figure 8 As shown, the protein concentration after the 15th leucine is mutated to aspartic acid is much higher than that of other mutation sites.

[0092] The examples above are merely illustrative of the present invention and should not be construed as limiting the invention. Many different combinations can be made without departing from the scope and spirit of the invention; therefore, the invention is not limited to the disclosed embodiments. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the invention should be defined by the claims.

Claims

1. A fusion protein containing a human full-length type III collagen mutant, characterized in that, The mutant is based on the amino acid sequence shown in SEQ ID NO.1, with leucine at position 15 mutated to aspartic acid; The fusion protein is a mutant in which a 6×His fragment and the signal peptide shown in SEQ ID NO.7 are sequentially linked at the N-terminus.

2. The gene encoding the fusion protein of claim 1.

3. A recombinant plasmid carrying the gene described in claim 2.

4. Recombinant CHO cells expressing the fusion protein of claim 1, carrying the gene of claim 2, or containing the recombinant plasmid of claim 3.

5. A recombinant CHO cell, characterized in that, Using CHO-S cells as the host and pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin as the vector, the fusion protein of claim 1 was recombinantly expressed.

6. The recombinant CHO cells as described in claim 5, characterized in that, The method for constructing the recombinant CHO cells is as follows: The signal peptide gene shown in SEQ ID NO. 8 and the human full-length type III collagen mutant gene containing the 6×His encoding gene shown in SEQ ID NO. 6 are sequentially linked after the CMV promoter of the plasmid pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin to construct the recombinant plasmid; the recombinant plasmid is then transfected into CHO-S cells to obtain recombinant CHO cells.

7. A method for in vitro recombinant expression of full-length human type III collagen, characterized in that, The recombinant CHO cells of claim 5 or 6 are cultured in a culture medium for at least 5 days.

8. The method as described in claim 7, characterized in that, During the culture process, feeding and sugar supplementation are carried out; the feeding is to add fresh culture medium on the 1st, 3rd and 5th days of culture, and the amount of supplementation is 5 to 10% of the initial culture medium volume; the sugar supplementation is to add glucose to a concentration of 6 g / L or above when the glucose concentration is lower than 3 g / L.

9. The use of the fusion protein of claim 1, the gene of claim 2, the recombinant plasmid of claim 3, or the recombinant CHO cells of any one of claims 4 to 6 in the in vitro expression of full-length human type III collagen or products containing full-length human type III collagen.

Images