Preparation method and application of anti-chicken CD80 monoclonal antibody for flow cytometry

By preparing and optimizing the anti-chicken CD80 monoclonal antibody 3F10, the problem of the inability of existing technologies to specifically identify chicken CD80 surface molecules was solved, the application of flow cytometry was realized, and the development of avian immunology research was promoted.

CN120623345APending Publication Date: 2025-09-12YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510791259.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

The existing technology lacks effective chicken CD80 monoclonal antibodies, which makes it impossible to specifically identify chicken CD80 surface molecules by flow cytometry, limiting the in-depth development of avian immunology research.

Method used

The anti-chicken CD80 monoclonal antibody 3F10 was prepared and optimized. The full-length chicken CD80 gene was constructed into the eukaryotic expression vector pcDNA3.1. The monoclonal antibody that could specifically recognize chicken CD80 was screened using hybridoma technology and labeled with fluorescein for use in flow cytometry detection.

Benefits of technology

It provides a monoclonal antibody tool that can specifically recognize chicken CD80 natural protein, fills the gap in flow cytometry in avian immunology, simplifies the study of chicken CD80 expression, and expands the research methods for studying the function of the avian immune system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120623345A_ABST
    Figure CN120623345A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method and application of an anti-chicken CD80 monoclonal antibody, firstly, eukaryotic recombinant plasmids are constructed, the eukaryotic recombinant plasmids are used as immunogens to prepare the anti-chCD80 monoclonal antibody, and the antibody can perform specific recognition on chCD80 natural protein. According to the chicken CD80 immunodetection kit, the deficiency of chicken CD80 immunodetection tools and the technical blank are filled, and the deficiency of antigen presenting cell activation research in the poultry field is effectively made up, so that the research in the poultry related field is greatly facilitated. And the monoclonal antibody is simple to prepare and easy to obtain, and can be widely applied to the fields of Western blot and flow cytometry subsequently.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of poultry immunology, biological research and diagnostic reagents, and relates to a preparation method and application of an anti-chicken CD80 monoclonal antibody for flow cytometry, and in particular to the preparation and application of a monoclonal antibody capable of specifically recognizing the chicken immune stimulatory molecule CD80. Background Art

[0002] CD80, a major member of the B7 family, is a key immune co-stimulatory molecule. Chicken CD80 is a transmembrane protein with a full length of 951 bp, encoding 316 amino acids, and a theoretical size of approximately 35.1 kDa. This molecule has seven potential glycosylation sites, and after glycosylation, its native protein molecular weight can reach approximately 55 kDa. It is primarily expressed as a dimer on the surface of antigen-presenting cells (APCs), such as macrophages (MΦ), dendritic cells (DCs), and activated B cells.

[0003] CD80 binds to receptors on the surface of lymphocytes, thereby participating in immune regulation. Following the MHC-peptide-TCR linkage, CD80 binding to the CD28 receptor on T cells promotes T cell activation and proliferation, leading not only to the production of Th1 cytokines but also to the significant secretion of high levels of Th2 cytokines, such as IL-4 and IL-10. Conversely, during the late activation phase, CD80 binding to CTLA-4 inhibits T cell activation and, through ligand endocytosis by Tregs, reduces CD80 levels on the surface of APCs, inhibiting CD80-mediated costimulatory signals to maintain immune homeostasis and prevent autoimmune responses. This demonstrates the crucial role of CD80 in T cell regulation. Compared to mammalian CD80 research, global research on avian CD80 has lagged behind, primarily due to the lack of key immunological tools for CD80 detection. Due to the lack of an effective monoclonal antibody against chicken CD80, the most widely used approach currently relies on detecting chCD80 expression at the mRNA level. Lee et al. used eukaryotic recombinant chCD80 / IgG4 protein to prepare mouse anti-chicken monoclonal antibodies, but the application effect of this antibody in flow cytometric phenotypic analysis of chicken primary cells has not been clearly verified. Summary of the Invention

[0004] The present invention aims to solve the technical problem and overcomes the shortcomings of the existing technology to provide an anti-chicken CD80 monoclonal antibody for flow cytometry and its preparation method and use. The monoclonal antibody can specifically recognize the native chCD80 protein after antigen stimulation or lipopolysaccharide activation.

[0005] One of the objects of the present invention is to provide an anti-chicken CD80 monoclonal antibody, wherein the monoclonal antibody is secreted by the hybridoma cell line 3F10 with a deposit number of CCTCC NO: C2025169 or a subculture cell line thereof.

[0006] Studies have shown that MHC-II + The subpopulation of chicken BMDCs exhibited a more mature phenotype, with significantly increased surface CD80 expression levels, a phenomenon also confirmed by MoDC expression. These findings not only deepen our understanding of the regulatory mechanism of avian CD80 expression, but also provide new ideas for further research on the functional characteristics of the avian immune system. The present invention successfully prepared the chCD80 monoclonal antibody 3F10 by using a method for preparing monoclonal antibodies using chicken CD80 eukaryotic spleen immunization. This monoclonal antibody was verified by Western blot to specifically recognize the natural chicken CD80 protein, and flow cytometry showed that it can recognize the chCD80 protein on the surface of chicken APCs, providing a key research tool for avian immunology.

[0007] The technical solution further optimized by the present invention is as follows: Preferably, the monoclonal antibody can specifically bind to CD80 protein expressed on the surface of chicken antigen-presenting cells.

[0008] Preferably, the monoclonal antibody is used for Western-blot and flow cytometry to verify the CD80 protein on the surface of chicken macrophages activated after lipopolysaccharide stimulation.

[0009] The second object of the present invention is to provide a eukaryotic expression method for preparing recombinant chicken CD80 protein. The full-length chicken CD80 gene was constructed into the eukaryotic expression vector pcDNA3.1, and the recombinant plasmid pcDNA3.1-chCD80 was successfully expressed in DF-1 cells.

[0010] In the above-mentioned eukaryotic expression method for preparing recombinant chicken CD80 protein, the full-length chicken CD80 gene sequence is from the Genbank sequence, and its Genbank accession number is EF554723.1.

[0011] The third object of the present invention is to provide an application of an anti-chicken CD80 monoclonal antibody, wherein the monoclonal antibody is purified and labeled with fluorescein and then used in flow cytometry to detect changes in the expression of CD80 in different antigen-presenting cell subsets after chicken infection or vaccination.

[0012] The application of the above anti-chicken CD80 monoclonal antibody, the antigen presenting cell subset is Bu-1 + cells, Bu-1 - MHC-II + KuL01 +cells, Bu-1 - MHC-II + KuL01 - cell.

[0013] A fourth object of the present invention is to provide a method for preparing an anti-chicken CD80 monoclonal antibody. The full-length chicken CD80 gene is constructed into the eukaryotic expression vector pcDNA3.1, and the constructed eukaryotic plasmid is used to immunize BALB / c mice. Before fusion, DF-1 transfected cells are used for pulse immunization, and the antibody is obtained by hybridoma screening.

[0014] The present invention first constructs a eukaryotic expression vector pcDNA3.1-chCD80 based on the full-length sequence of chCD80; uses the recombinant plasmid to immunize mouse spleens, performs cell fusion on immune-positive mice and screens positive clones, thereby obtaining monoclonal antibodies that can specifically recognize antigen-presenting cells expressing chicken CD80 molecules in flow cytometry staining, and provides the applicability of the anti-chicken CD80 monoclonal antibody in other related experimental technologies for chicken CD80 identification, as well as the antibody types and subtype categories of the monoclonal antibody.

[0015] The present invention constructs the complete chCD80 gene sequence (EF554723.1) in NCBI into the pcDNA3.1 eukaryotic expression vector and successfully expresses it in DF-1 cells. The recombinant plasmid is used to immunize the spleen of mice, supplemented by intramuscular injection. After the immunization, cell fusion is performed to screen positive hybridoma cells, and the positive hybridoma cells are identified by IFA, western blot and flow cytometry. Finally, an anti-chicken CD80 protein monoclonal antibody 3F10 is successfully obtained. The monoclonal antibody can specifically recognize the recombinant chicken CD80 protein expressed in eukaryotes and prokaryotes, as well as the CD80 protein naturally expressed on the surface of chicken macrophages, and can be preliminarily applied to flow cytometric surface staining.

[0016] The hybridoma cell line 3F10 is classified as mouse anti-chicken CD80 monoclonal antibody 3F10 mouse anti-chicken (gallus gallus) CD80 hybridoma cell line 3F10 and is deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China; the deposit date is June 11, 2025; and the deposit number is CCTCC NO: C2025169.

[0017] The present invention prepares monoclonal antibodies that specifically recognize chicken CD80 and labels them with fluorescein. Through flow cytometry surface staining, it can directly evaluate the expression of different chicken antigen-presenting cells after infection, immunization or in vitro stimulation, which is a very important immunological tool.

[0018] This invention fills a long-standing gap in avian immunology, which has been unable to specifically identify the chicken CD80 surface molecule via flow cytometry. The monoclonal antibody against the chicken immune co-stimulatory molecule CD80 can specifically recognize the CD80 protein on the surface of infected chicken antigen-presenting cells, effectively addressing the lack of research on antigen-presenting cell activation in poultry, thereby greatly facilitating research in poultry-related fields. Furthermore, this monoclonal antibody is simple to prepare and readily available, and can subsequently be widely used in Western blot and flow cytometry. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the IFA identification result of DF-1 cells transfected with pcDNA3.1-chCD80.

[0020] Figure 2 This is the result of the recognition (IFA) of eukaryotic recombinant protein by a chCD80 monoclonal antibody 3F10.

[0021] Figure 3 The figure shows the recognition results of prokaryotic and eukaryotic proteins by a chCD80 monoclonal antibody 3F10 (WB).

[0022] Figure 4 The figure shows the recognition (WB) results of a chCD80 monoclonal antibody 3F10 against three natural proteins (PBMC, bone marrow-derived macrophages BMDM, and peritoneal macrophages PM).

[0023] Figure 5 The figure shows the results of flow cytometry verification of the reactivity of chCD80 monoclonal antibody 3F10 to natural macrophage chCD80.

[0024] Figure 6 This is a diagram of 3F10 ascites purification.

[0025] Figure 7 The results show the reactivity of chCD80 monoclonal antibody 3F10 with CD80 in different spleen cell subsets detected by MDV-infected and immunized chickens. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection authority of the present invention is not limited to the following embodiments.

[0027] The pcDNA3.1 eukaryotic vector, DF-1 cells, and pCold-I prokaryotic vector of the present invention are stored in the laboratory of the College of Veterinary Medicine of Yangzhou University. The remaining materials and reagents mentioned in the present invention can be purchased by the public from commercial channels at home and abroad. Example 1

[0028] (1) Construction and expression of chCD80 eukaryotic expression vector Based on the Genbank sequence of the chCD80 gene from NCBI (Genbank accession number EF554723.1), upstream and downstream specific primers were designed. The primer sequences are shown in Table 1 and synthesized by Qingke Biotechnology. The full-length chicken CD80 gene (1-316 aa) was amplified using these specific primers and then inserted into the pcDNA3.1 eukaryotic vector. After double enzyme digestion and sequencing, pcDNA3.1-chCD80 was successfully constructed.

[0029] Table 1 Chicken CD80 upstream and downstream primers Primers sequence Primers CAGTGTGGTGGAATTCATGAAGATGGGGTGCCTGAAG Downstream primer CCTCTAGACTCGAGTAGAGATGACATTCACATGTC PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 65°C for 30 s, extension at 72°C for 45 s, 30 cycles of denaturation, annealing, and extension; final extension at 72°C for 5 min.

[0030] pcDNA3.1-chCD80 was transfected into DF-1 cells and its expression was verified by IFA. Figure 1 As shown, pcDNA3.1-chCD80 was successfully expressed in DF-1 cells. Figure 1 Including transfection of eukaryotic plasmids and transfection of empty vector pairs.

[0031] (2) Screening of positive hybridoma cells ① Mouse immunization and cell fusion 6-8 week old Balb / c mice (purchased from the Center for Comparative Medicine, Yangzhou University) were injected intramuscularly with 100 μg of pcDNA3.1-chCD80 plasmid three times per mouse, with an interval of 2 weeks between each injection. The spleen was then immunized once, and two weeks later, the mice with better immune responses were given a booster immunization (5×10 6 Three days after the fusion, myeloma cells and mouse spleen cells were fused. Peritoneal macrophages were harvested the day before the fusion to prepare the feeder layer. SP2 / 0 cells were mixed with sterile immune spleen cells, the supernatant removed by centrifugation, and PEG-1500 was used to induce cell fusion. The cells were resuspended in incomplete DMEM medium and centrifuged again to completely remove the supernatant to terminate the cell fusion. The fused cells were cultured in HAT medium at 37°C in a 5% CO2 cell culture incubator.

[0032] ② Hybridoma cell screening and cloning culture After the cells were cultured for 10 days, the cell culture supernatant was taken for IFA detection of antibodies, such as Figure 2 As shown. Hybridoma cell wells that showed a strong positive reaction in the first test were expanded and subcloned by limiting dilution. Monoclonal wells with strong positive reactions were selected and preserved to establish a monoclonal cell line capable of stable passage and continuous and efficient secretion of specific antibodies: hybridoma cell line 3F10.

[0033] (3) Western blot identification of prokaryotic and eukaryotic chCD80 proteins by mAb ① Western blot identification of chCD80 prokaryotic protein by mAb Based on the Genbank sequence of the chCD80 gene in NCBI (Genbank accession number EF554723.1), upstream and downstream specific primers were designed for its extracellular region. The primer sequences are shown in Table 2 and were synthesized by Qingke Biotechnology. The chicken CD80 extracellular region (33-253 aa) was amplified using the designed specific primers and constructed into the pCold-I prokaryotic vector. After double enzyme digestion and sequencing, pCold-I-ed-chCD80 was successfully constructed. The recombinant plasmid was transformed into BL21 (DE3) host bacteria (purchased from Tolo Harbor Biotechnology Co., Ltd.) and induced with a small amount of IPTG. SDS-PAGE results showed that the chCD80 recombinant protein was successfully expressed in inclusion bodies. Subsequent large-scale induction and purification were performed, and approximately 25 mg of protein was obtained after renaturation. 20 μg of the above protein was added to protein loading buffer and boiled. Western blotting was performed using anti-his antibody as the primary antibody and HRP goat anti-mouse as the secondary antibody. The results are shown in Figure 2. Figure 3 As shown, mAb can recognize chCD80 prokaryotic protein, which is approximately 28 kDa in size. Anti-his antibody was purchased from Quanshijin Biotechnology Co., Ltd., and HRP goat anti-mouse was purchased from Abcam.

[0034] Table 2 Upstream and downstream primers of chicken CD80 extracellular region Primers sequence Upstream primer TCGGTACCCTCGAGCAGGAGAAGAAAGTGGCCA Downstream primer TCGACAAGCTTGAATTCGGATGGAAGTGCAGTAGG PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 65°C for 30 s, extension at 72°C for 45 s, 30 cycles of denaturation, annealing, and extension; final extension at 72°C for 5 min.

[0035] ② Western blot identification of chCD80 eukaryotic protein by mAb DF-1 cells were transfected with pcDNA3.1-chCD80. After 24-30 hours, the cells were lysed and the cell proteins were extracted. 5× loading buffer was added and the sample was boiled in a 99°C metal bath for 10 minutes. After centrifugation at 12000g for 1 minute, the chCD80 eukaryotic protein sample was obtained. Western blot was then performed using anti-his antibody as the primary antibody and HRP goat anti-mouse as the secondary antibody. The results are shown in Figure 2. Figure 3 As shown, mAb can recognize chCD80 prokaryotic protein, which is about 55-60 kDa in size. Since chCD80 has 7 potential glycosylation sites, the actual value is greater than the theoretical value.

[0036] (4) Western blot identification of native chCD80 protein by mAb ① Western blot identification of native CD80 protein in chicken PBMCs using mAb Chicken peripheral blood mononuclear cells (PBMCs) were cultured for 12 hours. Adherent macrophages were isolated and cellular proteins were extracted. 5× loading buffer was added and the sample was boiled in a 99°C metal bath for 10 minutes. Centrifuged at 12,000 g for 1 minute to obtain the native chCD86 protein sample. Western blotting was then performed using 3F10 hybridoma supernatant as the primary antibody and HRP goat anti-mouse as the secondary antibody. The results are shown below. Figure 4 As shown, mAb can recognize chCD80 native protein, which is about 80-90 kDa in size. Since chCD80 has 7 potential glycosylation sites and CD80 exists as a dimer in its native state, the actual value is greater than the theoretical value.

[0037] ② Western blot identification of native CD80 protein in chicken bone marrow-derived macrophages using mAb Chicken bone marrow cells were harvested and induced to differentiate into bone marrow-derived macrophages (BMDM) with chicken granulocyte-macrophage colony-stimulating factor (GMCSF). Stimulated with lipopolysaccharide (LPS) for 8-10 hours, adherent cells were harvested, and cellular protein was extracted. 5× loading buffer was added, and the sample was boiled in a 99°C metal bath for 10 minutes and centrifuged at 12,000 g for 1 minute to obtain the native chCD80 protein sample. Western blotting was then performed using 3F10 hybridoma supernatant as the primary antibody and HRP goat anti-mouse as the secondary antibody. The results are shown below. Figure 4 As shown, the mAb was able to recognize the chCD80 native protein.

[0038] ③ Western blot identification of native CD80 protein in chicken peritoneal macrophages (PM) using mAb Chicken peritoneal macrophages were obtained and stimulated with lipopolysaccharide for 8-10 hours after adherence. The adhered cells were harvested and the cellular proteins were extracted. 5× loading buffer was added and the sample was boiled in a 99°C metal bath for 10 minutes. After centrifugation at 12,000 g for 1 minute, the native chCD80 protein sample was obtained. Western blotting was then performed using 3F10 hybridoma supernatant as the primary antibody and HRP goat anti-mouse as the secondary antibody. The results are shown below. Figure 4 As shown, the mAb was able to recognize the chCD80 native protein.

[0039] (5) FCM identification of native chCD80 protein by mAb ① FCM identification of CD80 protein in chicken bone marrow-derived macrophages (BMDM) using mAb Chicken bone marrow cells were obtained and induced to differentiate into bone marrow-derived macrophages (BMDM) by chicken GMCSF. They were stimulated with lipopolysaccharide for 8-10 hours, and the adherent cells were collected for flow cytometry surface staining. First, the mAb hybridoma supernatant was used as the primary antibody, incubated at room temperature for 30 minutes, and washed with 0.5% BSA; then incubated with Goat-Anti-mouse IgG (AF488) secondary antibody at room temperature for 30 minutes, washed with 0.5% BSA; finally, incubated with chicken Kul-01 and MHC-II antibodies at room temperature for 30 minutes, washed with 0.5% BSA, and detected by flow cytometry. Goat-Anti-mouse IgG (AF488) was purchased from ABclonal, Kul-01 antibody was purchased from SouthernBiotech, and MHC-II antibody was purchased from SouthernBiotech. The results are as follows. Figure 5 As shown, mAb 3F10 had a significant CD80 cell population.

[0040] ② FCM identification of CD80 protein in chicken peritoneal macrophages (PM) using mAb Chicken peritoneal macrophages were taken and treated for adhesion. The cells were collected and subjected to flow cytometry surface staining. First, the mAb hybridoma supernatant was used as the primary antibody, incubated at room temperature for 30 minutes, and washed with 0.5% BSA; then incubated with Goat-Anti-mouse IgG (AF488) secondary antibody for 30 minutes at room temperature, washed with 0.5% BSA; finally, incubated with chicken Kul-01 and MHC-II antibodies at room temperature for 30 minutes, washed with 0.5% BSA, and detected by flow cytometry. The results are shown in Figure 2. Figure 5 As shown, mAb 3F10 had a significant CD80 cell population.

[0041] (6) Identification of 3F10 antibody subtypes The monoclonal antibody 3F10 was subtyped using the monoclonal antibody subclassification kit (BF06002X) from Beijing Biolong Immunotechnology Co., Ltd. The results showed that the monoclonal antibody 3F10 belonged to the IgG2b subtype.

[0042] (7) Purification and labeling of 3F10 antibody ascites Antibody purification was performed according to the instructions of the Bio-Tech Protein A+G Agarose prepacked column and ultrafiltration was performed to concentrate the antibody. The antibody concentration was measured to be 1 mg / ml. Figure 6 As shown; and the antibody was fluorescently labeled. For specific steps, please refer to the instructions of abcam's PE-cy7 coupling kit - Lightning-Link® (ab201807).

[0043] (8) FCM identification of chCD80 expression by mAb in different immune cell populations in the spleen SPF-grade 3-day-old chickens (purchased from Jiangsu Lihua Animal Husbandry Co., Ltd.) were used for MDV infection and immunization experiments. They were divided into three groups, namely the control group, the CVI988 immunization group, and the HN302 virulent challenge group. The control group was a blank control group that was not vaccinated and not challenged, and the HN302 virulent challenge group was an artificially infected MDA virus group. The chickens were killed on the 4th and 7th days after treatment, and peripheral blood, spleen and lung were collected. Mononuclear cells were separated and flow cytometry surface staining was performed. An appropriate amount of cells was plated on a 96-well V-well plate and incubated with antibodies for 25 minutes (CD45, MHC-II, KUL01, Bu-1, chCD80-3F10) for detection. chCD80-3F10 was purified by step (7), and the antibody CD45 was purchased from SouthernBiotech, and Bu-1 was purchased from SouthernBiotech. Three different subpopulations of cells (Bu-1 + cells、Bu-1 - MHC-II + KuL01 + cells、Bu-1 - MHC-II + KuL01 - The expression of chCD80 in cells was analyzed. Figure 7 It shows that chCD80 monoclonal antibody-3F10 works and its expression level is significantly upregulated after MDV infection and immunization.

[0044] The above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or replacements within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.

Claims

1. An anti-chicken CD80 monoclonal antibody, characterized in that The monoclonal antibody is secreted by the hybridoma cell line 3F10 with a deposit number of CCTCC NO: C2025169 or its successive cell line.

2. The anti-chicken CD80 monoclonal antibody according to claim 1, characterized in that: The monoclonal antibody can specifically bind to the CD80 protein expressed on the surface of chicken antigen-presenting cells.

3. A eukaryotic expression method for preparing recombinant chicken CD80 protein, characterized in that: The full-length chicken CD80 gene was constructed into the eukaryotic expression vector pcDNA3.1, and the recombinant plasmid pcDNA3.1-chCD80 was successfully expressed in DF-1 cells.

4. A eukaryotic expression method for preparing recombinant chicken CD80 protein according to claim 3, characterized in that: The full-length gene sequence of chicken CD80 was obtained from Genbank, and its Genbank accession number is EF554723.

1.

5. The anti-chicken CD80 monoclonal antibody according to claim 1, characterized in that: The monoclonal antibody was used for Western-blot and flow cytometry to verify the CD80 protein on the surface of chicken macrophages activated after lipopolysaccharide stimulation.

6. The use of an anti-chicken CD80 monoclonal antibody according to any one of claims 1 to 5, characterized in that: The monoclonal antibody is purified, labeled with fluorescein, and then used in flow cytometry to detect the expression changes of CD80 in different antigen-presenting cell subsets after chicken infection or vaccine immunization.

7. The use of an anti-chicken CD80 monoclonal antibody according to claim 6, characterized in that: The antigen presenting cell subset is Bu-1 + cells, Bu-1 - MHC-II + KuL01 + cells, Bu-1 - MHC-II + KuL01 - cell.

8. The method for preparing an anti-chicken CD80 monoclonal antibody according to claim 1, wherein: The full-length chicken CD80 gene was constructed into the eukaryotic expression vector pcDNA3.

1. The constructed eukaryotic plasmid was used to immunize BALB / c mice. Before fusion, DF-1 transfected cells were used for shock immunization and the mice were screened by hybridoma technology.