Bacillus amyloliquefaciens engineering bacterium capable of increasing mycoprotein content and amino acid content and construction method of bacillus amyloliquefaciens engineering bacterium

Abstract

According to the bacillus amyloliquefaciens engineering bacterium capable of improving the mycoprotein content and the amino acid content and the construction method of the bacillus amyloliquefaciens engineering bacterium, NAD-specific glutamate dehydrogenase coding gene gudB is expressed in bacillus amyloliquefaciens BAX-1 in a free mode through a genetic engineering method, the bacillus amyloliquefaciens engineering bacterium is successfully obtained, and compared with a control strain, the bacillus amyloliquefaciens engineering bacterium has the advantages that the yield is high; the mycoprotein content and the amino acid content of the bacillus amyloliquefaciens engineering bacteria are remarkably increased, the mycoprotein content is increased by 14.02%, and the total amino acid content is increased by 13.85%.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an engineered bacillus amyloliquefaciens bacterium with increased bacterial protein and amino acid content and a construction method thereof. Background Art

[0002] Food protein is a vital nutrient for humans, playing a crucial role in maintaining physiological functions. With population growth and improved living standards, traditional agriculture and animal husbandry are no longer able to meet the demand for high-quality protein. Exploiting novel protein resources as an organic supplement to traditional protein production is crucial for alleviating the global protein supply crisis and maintaining sustainable agricultural development. Microbial protein, with its high production efficiency, low energy consumption, and comprehensive nutritional profile, represents a promising new source of high-quality alternative protein.

[0003] Bacillus amyloliquefaciens, a food-grade, safe strain, is easy to culture, has a fast growth rate, strong tolerance, low drying cost, and possesses multiple beneficial functions and can efficiently express proteins, making it a potential candidate strain for increasing microbial protein content. Based on this, the present invention significantly increases the protein content and amino acid content of Bacillus amyloliquefaciens by free-expressing the NAD-specific glutamate dehydrogenase encoding gene gudB in Bacillus amyloliquefaciens BAX-1, providing a potential gene resource for the exploration of new alternative proteins. Summary of the Invention

[0004] The present invention aims to provide an engineered Bacillus amyloliquefaciens strain with increased bacterial protein and amino acid content and a construction method thereof. By genetic engineering technology, the NAD-specific glutamate dehydrogenase encoding gene gudB is freely expressed in Bacillus amyloliquefaciens BAX-1, thereby significantly increasing the bacterial protein and amino acid content of Bacillus amyloliquefaciens.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] A Bacillus amyloliquefaciens engineered strain with increased bacterial protein and amino acid content is constructed by episomal expression of the NAD-specific glutamate dehydrogenase encoding gene gudB in Bacillus amyloliquefaciens BAX-1. The specific construction method is as follows:

[0007] 1) Using genomic DNA of Bacillus amyloliquefaciens BAX-1 as a template, PCR amplified the NAD-specific glutamate dehydrogenase encoding gene gudB;

[0008] 2) double-digesting the gudB gene fragment and expression vector with XbaI and SmaI restriction endonucleases to obtain the digested gene fragment and the linearized plasmid fragment, which were then ligated with DNA ligase to obtain an episomal expression vector containing the NAD-specific glutamate dehydrogenase encoding gene gudB;

[0009] 3) The free expression vector is transformed into Bacillus amyloliquefaciens BAX-1, positive transformants are screened by resistance culture, and Bacillus amyloliquefaciens engineered bacteria are obtained after colony PCR verification and sequencing.

[0010] The application of the Bacillus amyloliquefaciens engineered bacteria prepared by the above method in improving the bacterial protein content and amino acid content: the colony was picked and inoculated into LB medium for seed culture, and then inoculated into the fermentation medium (xylose 40 g / L, sodium citrate 15 g / L, ammonium sulfate 10 g / L, KH2PO4 1 g / L, CaCl2 1 g / L, MgSO4·7H2O 1 g / L, MnSO4·H2O 0.15 g / L, ZnSO4·7H2O 1 g / L) at a 5% inoculum size, and cultured at 37°C and 230 rpm for 36 hours. The results showed that the bacterial protein content and amino acid content of the Bacillus amyloliquefaciens engineered bacteria were increased by 14.02% and 13.84%, respectively, compared with the control strain.

[0011] The present invention attempts for the first time to express the NAD-specific glutamate dehydrogenase encoding gene gudB in Bacillus amyloliquefaciens BAX-1 in a free manner, significantly increasing the bacterial protein content and amino acid content of Bacillus amyloliquefaciens compared with the control strain, providing a potential gene resource for the exploration of new alternative proteins.

[0012] Compared with the prior art, the present invention has the following advantages and effects:

[0013] 1. The present invention first discovered that the free expression of the NAD-specific glutamate dehydrogenase encoding gene gudB in Bacillus amyloliquefaciens BAX-1 can significantly increase the protein content and amino acid content of Bacillus amyloliquefaciens. Compared with the control strain, the protein content of the Bacillus amyloliquefaciens engineered bacteria constructed by the present invention increased by 14.02% and the total amino acid content increased by 13.85%.

[0014] 2. The increase in bacterial protein and amino acid content in Bacillus amyloliquefaciens has high application value in food, feed, biofertilizer and other fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The process of constructing the episomal expression vector pHY-gudB.

[0016] Figure 2The PCR verification results of Bacillus amyloliquefaciens BAX-1 / pHY-gudB and BAX-1 / pHY in Example 1 are shown. Lane M is a DNA marker, and lanes 1 and 2 are BAX-1 / pHY-gudB and BAX-1 / pHY, respectively.

[0017] Figure 3 To investigate the effect of episomal expression of the NAD-specific glutamate dehydrogenase encoding gene gudB in Bacillus amyloliquefaciens BAX-1 on bacterial protein content.

[0018] Figure 4 To investigate the effect of episomal expression of the NAD-specific glutamate dehydrogenase encoding gene gudB on the amino acid content of Bacillus amyloliquefaciens BAX-1. DETAILED DESCRIPTION

[0019] In the following examples, molecular biology experimental methods without specific conditions specified were performed under conventional conditions according to the Molecular Cloning Laboratory Manual (New York: Cold Spring Harbor).

[0020] Biomaterial Description:

[0021] Bacillus amyloliquefaciens BAX-1 and plasmid pHY are publicly available biological materials and have been reported in the article (Weijie Chen, Lu Li, Changwen Ye, Ziyue Zhao, Kuo Huang, Dian Zou, Xuetuan Wei*, Efficient production of extracellular alkaline protease in Bacillus amyloliquefaciens by host strain construction, LWT-Food Science and Technology, 2022, 163, 113620.) and are currently preserved in the Microbial Engineering Laboratory of Huazhong Agricultural University.

[0022] Among them, Bacillus amyloliquefaciens BAX-1 was knocked out of the epr gene using HZ-12 as the starting strain, and the nucleotide sequence of the epr gene is shown in SEQ ID NO. 2. The construction method is as follows: the upstream homology arm and the downstream homology arm of epr were connected by overlap extension PCR to form a homology arm fusion fragment, the homology arm fusion fragment and the temperature-sensitive knockout plasmid T2(2)-ori were double-digested with restriction endonucleases BamHI and XbaI, and the homology arm fusion fragment and the plasmid after enzyme digestion were ligated with T4 ligase at 25°C for 3 hours. The ligation product was transformed into E. coli DH5α competent cells, and after confirming the positive transformants, the plasmid was extracted to obtain the knockout vector T2-Δepr of the gene epr. The T2-Δepr plasmid was electroporated into the competent wild-type B. amyloliquefaciens HZ-12 strain, plated on Kan-resistant plates, and cultured at 37°C for 16-20 hours. The HZ-12 strain with the epr gene successfully knocked out was screened through homologous recombination double exchange screening and named B. amyloliquefaciens BAX-1.

[0023] The pHY plasmid is prepared by adding the strong promoter P43, the multiple cloning site MCS and the TamyL terminator to the replication origin of the purchased plasmid backbone pHY300PLK.

[0024] Example 1: Construction of episomal expression vector

[0025] Using Bacillus amyloliquefaciens BAX-1 genomic DNA as a template, PCR amplification with primers gudB-F and gudB-R yielded a 1275 bp gudB gene, the nucleotide sequence of which is shown in SEQ ID NO. 1, encoding NAD-specific glutamate dehydrogenase. The primer sequences are as follows:

[0026] gudB-F: GCTCTAGAATGGCAGCCGATCGATTC (containing XbaI restriction site)

[0027] gudB-R: GCCCCGGGTTATATCCAGCCTCTGAAACGC (containing SmaI restriction site)

[0028] PCR system: ddH2O 14.0μL, 5× TransStart TM FastPfu Buffer 5.0μL, dNTPs (0.2

[0029] mM) 2.5 μL, FastPfu DNA Polymerase 1.0 μL, forward primer (0.4 μM) 1.0 μL, reverse primer (0.4 μM) 1.0 μL, template DNA 0.5 μL.

[0030] PCR reaction conditions: 95°C for 5 min; 95°C for 30 s, 50-60°C for 30 s, 72°C for 30-60 s, 30-35 cycles; 72°C for 5 min, 25°C for 5 min.

[0031] The gudB gene fragment and the free expression plasmid pHY were double-digested with XbaI and SmaI restriction endonucleases to obtain the digested gene fragment and the linearized plasmid fragment. The digested gene fragment and the linearized plasmid fragment were ligated with T4 DNA ligase to obtain a ligation product (such as Figure 1 ); the ligation product was transformed into Escherichia coli DH5α by the calcium chloride transformation method and screened at 37°C in resistant LB medium (peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, pH 7.2) containing tetracycline antibiotics (20 μg / mL). Transformants were screened and verified by colony PCR (primers used were pHY-F and pHY-R). After sequencing by the company, the sequence alignment was correct, and the plasmid was extracted to successfully construct the free expression plasmid pHY-gudB.

[0032] Among them, the sequences of pHY-F and pHY-R are:

[0033] pHY-F:GTTTATTATCCATACCCTTAC

[0034] pHY-R: CAGATTTCGTGATGCTTGTC.

[0035] Example 2: Construction of episomal expression strain

[0036] The free plasmid vector pHY-gudB was electroporated into BAX-1 Bacillus amyloliquefaciens competent cells and screened at 37°C in a resistant culture medium containing tetracycline antibiotics (20 μg / mL). Transformants were screened and verified by colony PCR (primers used were pHY-F and pHY-R). The transformants were sequenced by the company and the sequence alignment was correct, thus obtaining the positive transformant BAX-1 / pHY-gudB (i.e., Bacillus amyloliquefaciens BAX-1 into which the pHY-gudB vector was transferred). The genomic DNA of Bacillus amyloliquefaciens BAX-1 / pHY-gudB and BAX-1 / pHY (transferred into the empty vector pHY) was extracted as a template, and PCR verification was performed using the pHY-F and pHY-R primers in Example 1 ( Figure 2 ).

[0037] The verified correct colony was picked into 5 mL of resistant LB medium containing tetracycline antibiotics (20 μg / mL), cultured in a 37°C constant temperature shaker at 180 rpm for 12 h, and 800 μL was aspirated and stored in a glycerol tube, which was then stored in a -80°C ultra-low temperature refrigerator. The engineered bacteria BAX-1 / pHY-gudB were obtained by genetic engineering.

[0038] Example 3: Effect of episomal expression of gudB gene on bacterial proteins in Bacillus amyloliquefaciens BAX-1

[0039] Single colonies of Bacillus amyloliquefaciens BAX-1 / pHY and BAX-1 / pHY-gudB were picked and inoculated into 5 mL of resistant culture medium LB containing tetracycline antibiotics (20 μg / mL), cultured at 37°C and 180 rpm for 12 h, and then inoculated into 25 mL of fermentation medium (xylose 40 g / L, sodium citrate 15 g / L, ammonium sulfate 10 g / L, KH2PO4 1 g / L, CaCl2 1 g / L, MgSO4·7H2O 1 g / L, MnSO4·H2O 0.15 g / L, ZnSO4·7H2O 1 g / L) at a 5% inoculum size and cultured at 37°C and 230 rpm for 36 h. The cells were collected by centrifugation at 7,500 rpm for 10 min, resuspended in 10 mL of sterile water, and centrifuged at 7,500 rpm for 10 min to collect the cells. Repeat this process three times, remove the culture medium, and dry in an electric constant temperature drying oven at 103°C until the mass remains constant.

[0040] 2-4 mg of Bacillus amyloliquefaciens cell powder was weighed and compacted in a tin boat. The nitrogen content (%) in the sample was determined using a German Elementar Vario PYRO cube and Isoprime 100 elemental analyzer, using acetanilide as the standard. The combustion tube temperature was set at 950°C, the reduction tube temperature was set at 600°C, the helium flow rate was 228 L / min, and the oxygen flow rate was 20 L / min. The cell protein content was calculated as 6.25 times the nitrogen content. The results are shown in the figure below. Figure 3 As shown, the bacterial protein content of the engineered Bacillus amyloliquefaciens strain BAX-1 / pHY-gudB was 65.53%, which was increased by 14.02% compared with the crude protein content of BAX-1 / pHY of 57.47%.

[0041] In addition, according to the method of GB / T5009.124-2016 "Determination of Amino Acids in Foods", an amino acid analyzer (ninhydrin post-column derivatization ion exchange chromatography) was used to determine the content of each amino acid in Bacillus amyloliquefaciens. A certain mass of Bacillus amyloliquefaciens powder was weighed into a hydrolysis tube, 10-15 mL of 6 mol / L hydrochloric acid solution was added, and 3-4 drops of phenol were added. The hydrolysis tube was placed in a refrigerant and frozen for 3-5 minutes. After vacuuming, it was filled with nitrogen. After repeating three times, it was sealed while filled with nitrogen. The sealed hydrolysis tube was placed in an electric blast thermostat at 110℃±1℃. After hydrolysis for 22 hours, it was removed and cooled to room temperature. The hydrolyzate was filtered into a 50 mL volumetric flask, and the water washing solution was transferred to a 50 mL volumetric flask and the volume was adjusted. Transfer 1.0 mL of the filtrate to a 15 mL test tube and dry under reduced pressure at 40°C–50°C. Dissolve the residue in 1 mL of water and evaporate to dryness under reduced pressure. Dissolve the residue in 1.0 mL of pH 2.2 sodium citrate buffer and filter through a 0.22 μm filter to obtain the sample solution. Use a sulfonic acid cationic resin as the column filler, and detect at wavelengths of 570 nm and 440 nm.

[0042] The contents of 15 amino acids, including threonine (Thr), valine (Val), methionine (Met), isoleucine (Ile), leucine (Leu), phenylalanine (Phe), lysine (Lys), histidine (His), aspartic acid (Asp), serine (Ser), glutamic acid (Glu), glycine (Gly), alanine (Ala), tyrosine (Tyr), and arginine (Arg), in Bacillus amyloliquefaciens engineered strains BAX-1 / pHY-gudB and BAX-1 / pHY were detected, of which the first 8 amino acids are essential amino acids. The results showed that ( Figure 4 ), the total amino acid content of BAX-1 / pHY-gudB was 47.712%, which was 13.85% higher than that of the control strain BAX-1 / pHY at 41.908%. Among them, the content of 8 essential amino acids in BAX-1 / pHY-gudB was 18.33%, which was 12.14% higher than that of the control strain BAX-1 / pHY at 16.345%.

Claims

1. An engineered Bacillus amyloliquefaciens strain with increased bacterial protein and amino acid content, characterized in that: The engineering bacteria is in Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ) BAX-1 overexpresses the gene encoding NAD-specific glutamate dehydrogenase gudB Income.

2. The Bacillus amyloliquefaciens engineered bacterium according to claim 1, characterized in that Gene encoding episomally expressed NAD-specific glutamate dehydrogenase gudB The nucleotide sequence is shown in SEQ ID NO.

1.

3. The Bacillus amyloliquefaciens engineered bacterium according to claim 1, characterized in that The Bacillus amyloliquefaciens BAX-1 is obtained by knocking out the epr gene from the Bacillus amyloliquefaciens HZ-12 as a starting strain, and the epr gene sequence is shown in SEQ ID NO.

2.

4. The method for constructing the Bacillus amyloliquefaciens engineered bacteria according to claim 1, wherein The following steps are involved: 1) Using the genomic DNA of Bacillus amyloliquefaciens BAX-1 as a template, PCR amplified the gene encoding NAD-specific glutamate dehydrogenase gudB ; 2) Adoption Xba I and Sma I restriction endonuclease pair gudB The gene fragment and expression vector were double-enzyme digested to obtain the enzyme-digested gene fragment and the linear plasmid fragment, which were then connected with DNA ligase to obtain the gene encoding NAD-specific glutamate dehydrogenase. gudB Episomal expression vectors; 3) The episomal expression vector is transformed into Bacillus amyloliquefaciens BAX-1, positive transformants are screened by resistance culture, and engineered Bacillus amyloliquefaciens strains are obtained after verification by colony PCR and sequencing.

5. The construction method according to claim 4, characterized in that The PCR amplification primer sequences are shown in SEQ ID NOs. 3 and 4.

6. Use of the engineered Bacillus amyloliquefaciens strain according to claim 1 in increasing the protein content and amino acid content of the bacteria.

Images