UORF element for regulating and controlling rice GLW7 and GW7 gene expression and application

Abstract

The invention provides a uORF element for regulating and controlling the expression of rice GLW7 and GW7 genes and application of the uORF element. The nucleotide sequence of the uORF element for regulating and controlling the expression of the rice GLW7 and GW7 genes is shown as any one of SEQ ID NO.1-3. The invention further provides a preparation method of the uORF element for regulating and controlling the expression of the rice GLW7 and GW7 genes. Wherein the GLW7-uORF1 can be used as an expression regulation element of the GLW7 gene, and the nucleotide sequence of the GLW7-uORF1 is as shown in SEQ ID NO. 1; the GW7-uORF1 and the GW-uORF2 can be used as expression regulation and control elements of the GW7 gene, and the nucleotide sequences of the GW7-uORF1 and the GW-uORF2 are respectively shown as SEQ ID NO.2 and SEQ ID NO.3. The uORF regulation element can be respectively used for regulating protein expression levels of rice GLW7 and GW7 genes, the grain shape of grains is improved, and the uORF regulation element has important application value when being applied to rice variety improvement work.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a uORF element for regulating the expression of rice GLW7 and GW7 genes and a use thereof. Background Art

[0002] Rice is the staple food for more than half the world's population. Rice varieties have a rich variety of grain shapes, which are not only a yield trait but also an important appearance quality trait of rice.

[0003] Grain shape is a complex quantitative trait controlled by multiple genes. Currently, multiple genes controlling grain shape have been cloned, each with varying effects, potentially facilitating genetic improvement of grain shape in rice varieties. Examples include genes GS3, GL3.1, and GLW7 that influence grain length and weight; genes GW2, GW5 / qSW5, GS5, and GW8 that influence grain width and weight; genes GS2 and BG1 that influence grain length, width, and weight; and genes GL7 / GW7 that influence grain shape but not weight. Furthermore, based on their regulatory effects on grain shape, genes can be further categorized as positive regulators (genes whose upregulation exhibits favorable effects) such as GL7 / GW7, GLW7, GS5, and BG1; and negative regulators (genes whose upregulation exhibits unfavorable effects) such as GS3, GL3.1, GS2, GW2, and GW5. Despite the cloning of numerous rice grain shape regulatory genes, the genetic resources available for breeding remain limited.

[0004] uORFs are specialized regulatory elements located upstream of gene coding regions that regulate plant development and metabolism by inhibiting the translation of downstream functional genes. For example, mutations in the uORF upstream of the rice TBF1 gene can improve disease resistance without reducing yield, providing a potential new approach for rice disease resistance breeding. Currently, there are few reports on the discovery of uORF elements in genes related to rice yield and quality traits (including grain shape). This may be due to the diversity of start codons of plant uORFs and the lack of clear identification features, making the study and application of uORFs in plants more difficult.

[0005] Therefore, the discovery of uORF elements of important trait genes such as grain shape in rice is of great significance for analyzing the characteristics and molecular mechanisms of uORF in rice and its application in breeding. Summary of the Invention

[0006] Purpose of the invention: In order to solve the problems existing in the process of improving rice grain shape, the present invention aims to provide uORF elements that regulate the expression of rice GLW7 and GW7 genes, solving the difficult problem of using positive regulatory genes to improve rice grain shape traits without any traces of genetic modification.

[0007] The present invention also provides the use of uORF elements upstream of rice GLW7 and GW7 genes.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a uORF element for regulating the expression of rice GLW7 and GW7 genes, wherein the nucleotide sequence of the uORF element for regulating the expression of rice GLW7 and GW7 genes is shown in any one or more of SEQ ID NOs. 1-3.

[0009] The nucleotide sequence of the uORF element regulating the expression of the rice GLW7 gene is shown in SEQ ID NO. 1, and the nucleotide sequence of the uORF element regulating the expression of the rice GW7 gene is shown in SEQ ID NO. 2 and / or 3.

[0010] sequence name sequence Sequence number GLW7-uORF1 ATGAGCTCGAGCTCGAGCTAG SEQ ID NO.1 GW7-uORF1 ATGGCATTCGCACGCCATTGA SEQ ID NO.2 GW7-uORF2 ATGTGCGTGAGCTGG SEQ ID NO.3

[0011] The present invention provides a recombinant expression vector based on the uORF element for regulating the expression of rice GLW7 and GW7 genes.

[0012] Among them, the method for constructing the recombinant expression vector is: designing a target site for editing near the uORF element, then designing the target site into a reverse complementary primer connected to the intermediate vector SK-gRNA, and the enzyme-cut product after connection is connected to the final vector pC1300-Cas9, and transformed by Agrobacterium to obtain the recombinant expression vector.

[0013] Furthermore, the uORF elements of rice GLW7 and GW7 genes were gene-edited using recombinant expression vectors.

[0014] The invention relates to the use of the uORF element for regulating the expression of rice GLW7 and GW7 genes in regulating agronomic traits of rice.

[0015] The uORF element is gene-edited to regulate the protein expression level of the rice GLW7 and / or GW7 gene, thereby improving the rice grain shape. The gene editing includes adding, substituting, inserting or deleting one or more nucleotides to generate mutants, alleles or derivatives.

[0016] Furthermore, by gene editing uORF elements, base mutations are caused to increase the expression of rice GLW7 and / or GW7 genes, thereby improving the shape of rice grains.

[0017] The method for regulating rice grain shape of the present invention edits the uORF element sequence to change the expression of GLW7 and / or GW7 genes, thereby regulating rice grain shape.

[0018] Furthermore, by gene editing uORF elements, the expression levels of GLW7 and / or GW7 genes in the target rice varieties are changed, thereby obtaining rice plants with different grain shapes.

[0019] The invention relates to the use of the uORF element for regulating the expression of rice GLW7 and GW7 genes in cultivating high-yield rice germplasm.

[0020] Gene editing technologies, such as CRISPR / Cas9, are currently popular for targeted genome editing. They have been demonstrated to be highly efficient and convenient for targeted editing of target sites in rice. Importantly, the target site and the T-DNA insertion site are typically located on different chromosomes. Therefore, in transgenic rice plants transformed with Agrobacterium-mediated genetic transformation, traces of the transgene can be removed through progeny screening, potentially enabling its practical application in production.

[0021] The GLW7 and GW7 genes in this invention positively regulate rice grain shape traits, and upregulating their expression has beneficial effects. Conventional transgenic overexpression techniques can achieve upregulation of gene expression, but due to the presence of transgenic traces, they are currently difficult to implement in production practices. Therefore, using CRISPR / Cas9 gene editing technology to edit uORF elements and upregulate the expression of grain shape genes such as GLW7 and GW7 is an important method for improving rice grain shape.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0023] This study, published in the journal Nature Communications, discovered for the first time that uORF elements can regulate the expression of the GLW7 and GW7 genes, improving rice grain shape. By gene editing uORF elements, base mutations are introduced, thereby upregulating the expression of the GLW7 and GW7 genes. This significantly alters grain length and grain aspect ratio, and fine-tunes grain width, improving grain shape without affecting rice growth and development. Furthermore, traces of genetic modification can be removed through simple progeny separation. This study broadens the application scope of the GLW7 and GW7 genes, addressing the limited application scope of naturally occurring GLW7 and GW7 alleles. This provides a useful genetic resource for improving rice grain shape, demonstrating excellent breeding value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 These are the wild-type sequence and mutant sequence of the uORF element upstream of the GLW7 gene in Example 1 of the present invention.

[0025] Figure 2 This is the effect of the mutation of the uorf element upstream of the GLW7 gene on the gene expression level in Example 1 of the present invention.

[0026] Figure 3This is the effect of the uorf element mutation upstream of the GLW7 gene in Example 1 of the present invention on the agronomic traits of rice.

[0027] Figure 4 These are the wild-type sequence and mutant sequence of the uORF element upstream of the GW7 gene in Example 2 of the present invention.

[0028] Figure 5 This is the effect of the mutation of the uorf element upstream of the GW7 gene on the gene expression level in Example 2 of the present invention.

[0029] Figure 6 This is the effect of the mutation of the uorf element upstream of the GW7 gene in Example 2 of the present invention on the grain shape traits of rice.

[0030] Figure 7 This is the effect of the mutation of the uorf element upstream of the GW7 gene in Example 2 of the present invention on the agronomic traits of rice in the field. DETAILED DESCRIPTION

[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0032] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0033] The young ears and grains of grain shape genes such as GLW7 and GW7 during the period of high expression were provided by Yangzhou University.

[0034] The construction of the pC1300-Cas9 recombinant vector and the intermediate vector SK-gRNA is detailed in patent CN105112435A, Construction and Application of Plant Multi-Gene Knockout Vectors.

[0035] Example 1

[0036] Mining, identification and effect analysis of uORF elements upstream of the GLW7 gene in rice

[0037] 1. uORF element mining and identification

[0038] Nipponbare is an important variety in rice breeding research and is fully publicly available. Using Nipponbare, a long-term preserved variety at Yangzhou University, as the experimental material, young panicles (5 cm and 10 cm in length) from the period of high expression of grain shape genes such as GLW7 (Si et al. 2016, OsSPL13 controls grain size in cultivated rice, Nature Genetics), grains from the critical period of grain development (10, 15, and 20 days after flowering), and leaves from the vegetative growth period (control) were used as experimental materials. Ribosome imprint sequencing (Ribo-seq) and transcriptome sequencing (RNA-seq) analyses were performed. Combined with bioinformatics methods, the main uORF elements of the important grain shape gene GLW7 (LOC_Os07g32170) were discovered. The results showed that there was a uORF element in the upstream untranslated region of the GLW7 gene. The nucleotide sequence of the uORF element is shown in SEQ ID NO.1 ( Figure 1 , GLW7-uORF1).

[0039] 2. Creation and identification of rice materials containing mutant uorf elements

[0040] Based on existing CRISPR / Cas9 experimental methods and referring to patent CN105112435A, two sequences containing NGG as a PAM site were selected as knockout target sites within the uORF element of the GLW7 gene. One specific target site sequence was 5'-CTCGAGCTCGAGCTCATGAG-3', and the other was 5'-CCTCCTAGGGGAGGTGGAAG-3'. The target sites were designed as reverse complementary primers and then ligated into the intermediate vector SK-gRNA, which had been digested with Aar I. The intermediate vector containing the target sites was then digested with Kpn I and Bgl II, and the gRNA fragment containing the target sites was recovered and ligated into the final vector pC1300-Cas9, which had been digested with Kpn I and BamH I to obtain a recombinant vector. After sequencing, the recombinant vector was transformed into an Agrobacterium strain. Using Nipponbare as the transformation recipient, the recombinant vector was transferred into rice by Agrobacterium-mediated genetic transformation. Positive transgenic seedlings were obtained through tissue culture. Finally, after testing and identification, they were transplanted into the field to obtain T0 generation rice plants, that is, plants containing mutant uorf elements (mutated GLW7-uORF1 elements, including GLW7-uORF#30, GLW7-uORF#34, and GLW7-uORF#19).

[0041] The wild-type Nipponbare, a control variety containing uORF elements, and the plants containing mutant uorf elements only had sequence differences near the uORF elements. After using the CTAB method to quickly extract genomic DNA from rice leaves during the tillering period, a pair of PCR sequencing primers were designed upstream and downstream of the uORF element editing target site sequence (detection primers are: GLW7-uORF-F: TCCACCATCAAGACGAAACGA; GLW7-uORF-R: CACGGCACCCGCCTTTAT) to detect sequence variations near the target site. After PCR amplification and sequencing analysis of the target site-based sequence, the sequence of the mutant uorf element was obtained. Compared with the wild-type uORF element, the mutant uorf element has multiple base deletions, indicating that the characteristics of the uORF element have been completely destroyed ( Figure 1 ).

[0042] 3. Effects of uorf mutations upstream of the GLW7 gene on gene expression in rice

[0043] Young spikelets (about 5 cm in length) of the wild-type Nipponbare, a control variety containing a uORF element, and plants containing a mutant uorf element prepared by the present invention were taken. The samples were placed in liquid nitrogen, ground to disrupt the cells, and total RNA was extracted. cDNA was obtained using a reverse transcription kit. The mRNA expression level of the GLW7 gene in the control variety Nipponbare and the plants containing the mutant uorf element was then detected using the SYBR Green fluorescent quantitative PCR method (detection primers: qRT-GLW7-F: GAGGTGCCAGGTGGAGAGGT; qRT-GLW7-R: GGAACCGGCTGCATTGCT). Similarly, the young spikelet samples were placed in liquid nitrogen, ground to disrupt the cells, and total protein was extracted. The protein expression level of the GLW7 gene in the control variety Nipponbare and the plants containing the mutant uorf element was then detected using the Western blotting method. The results showed that there was no difference in the mRNA expression level of the GLW7 gene in the plants containing the mutant uorf element, but the protein expression level of the GLW7 gene was significantly increased ( Figure 2 ), which is consistent with the characteristic that typical uORF elements can regulate the protein expression of downstream target genes without affecting mRNA expression.

[0044] 4. Determination of agronomic traits of rice containing mutant uorf elements

[0045] To clarify the biological function of uORF elements, the field agronomic traits of plants containing mutated uORF elements were investigated. Plants were grown in the field under conventional cultivation and management conditions. When the rice reached maturity, the agronomic traits of the rice were compared with those of the control variety, Nipponbare. Figure 3As shown, plants harboring mutant uorf elements (GLW7-uORF#30, GLW7-uORF#34, and GLW7-uORF#19) showed no changes in plant architecture, panicle shape, or seed setting rate. Plants harboring mutant uorf elements only showed significant changes in grain length and grain length / grain width ratio, with minor adjustments to grain width, resulting in improved grain shape. The trend of the mutant GLW7-uorf1 element affecting plant traits is consistent with its regulation of GLW7 gene expression. The changes in plant traits caused by the GLW7-uorf1 mutation are similar to the effects of sequence variation in the GLW7 gene coding region on grain shape reported (Si et al., 2016, OsSPL13 controls grain size in cultivated rice, Nature Genetics). uORF is an element that can slightly upregulate endogenous gene expression at the translation level, indicating that the uORF element discovered in the present invention does improve grain shape and promote rice growth by regulating GLW7 gene expression.

[0046] Example 2

[0047] Mining, identification and effect analysis of uORF elements of GW7 gene in rice

[0048] 1. uORF element mining and identification

[0049] Using preserved Nipponbare rice as the experimental material, young ears (5 cm and 10 cm in length) during the period of high expression of grain shape genes such as GW7 (Wang et al. 2015, The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality, Nature Genetics), grains during the critical period of grain development (10 days, 15 days and 20 days after flowering), and leaves during the vegetative growth period (control) were used as experimental materials. Ribosome imprint sequencing (Ribo-seq) and transcriptome sequencing (RNA-seq) analyses were performed. Combined with bioinformatics methods, the main uORF elements of the important grain shape gene GW7 gene (LOC_Os07g41200) were discovered. Two uORF elements were found in the upstream untranslated region of the GW7 gene. The nucleotide sequences of the uORF elements are shown in SEQ ID NOs. 2 and 3, respectively ( Figure 4 , GW7-uORF1, GW7-uORF2)

[0050] 2. Creation and identification of rice materials containing mutant uorf elements

[0051] Based on existing CRISPR / Cas9 experimental methods and with reference to patent CN105112435A, two sequences containing NGG as a PAM site were selected as knockout target sites within the uORF of the GW7 gene. One specific target site sequence was 5'-ATGGCGTGCGAATGCCATGC-3', and the other was 5'-GCAGTTGGATGTGCGTGAGC-3'. The target sites were designed as reverse complementary primers and then ligated into the intermediate vector SK-gRNA, which had been digested with Aar I. The intermediate vector containing the target sites was then digested with Kpn I and Bgl II, and the gRNA fragment containing the target sites was recovered and ligated into the final vector pC1300-Cas9, which had been digested with Kpn I and BamH I, to obtain a recombinant vector. After sequencing, the recombinant vector was transformed into an Agrobacterium strain. Using Nipponbare as the transformation recipient, the recombinant vector was transferred into rice by Agrobacterium-mediated genetic transformation. Positive transgenic seedlings were obtained through tissue culture. Finally, after testing and identification, they were transplanted into the field to obtain T0 generation rice plants, that is, plants containing mutant uorf elements (including mutant GW7-uORF1 and uORF2 elements, including GW7-uORF#57, GLW7-uORF#58, and GLW7-uORF#49).

[0052] The wild-type Nipponbare, a control variety containing uORF elements, and the plants containing mutant uorf elements only had sequence differences near the uORF elements. After using the CTAB method to quickly extract genomic DNA from rice leaves during the tillering period, a pair of PCR sequencing primers were designed upstream and downstream of the uORF element editing target site sequence (detection primers are: GW7-uORF-F: AGCAGATGCCACAGGAAG; GW7-uORF-R: CCATCCCTCCCGCTTAT) to detect sequence variations near the target site. After PCR amplification and sequencing analysis based on the target site sequence, the sequence of the mutant uorf element was obtained. Compared with the wild-type uORF, the mutant uorf has multiple base deletions, and the characteristics of the uORF element have been completely destroyed ( Figure 4 ).

[0053] 3. Effects of uorf mutations upstream of the GW7 gene on gene expression in rice

[0054] Young panicles (about 5 cm in length) of the wild-type Nipponbare control variety containing uORF elements and plants containing mutant uorf elements were collected. The samples were ground in liquid nitrogen to break the cells and extract total RNA. cDNA was obtained using a reverse transcription kit. Then, the mRNA expression levels of the GW7 gene in the control variety Nipponbare and plants containing mutant uorf elements were detected according to the SYBR Green fluorescence quantitative PCR method (detection primers: qRT-GW7-F: AAGGTCCATTCTCGCATTTCA; qRT-GW7-R: AGGCAGGCTGTTCGGGTT).

[0055] In addition, the dual-luciferase in vitro transient expression system was used to detect the effect of uORF on regulating the expression of downstream target gene proteins in tobacco leaves. The unmutated uORF elements (wild type, including GW7-uORF1 and GW7-uORF2, SEQ ID NO. 2 and 3), sequences containing mutant GW7-uorf1 elements (artificially synthesized to mutate the start codon ATG of wild-type uORF1 to AAA), and sequences containing mutant GW7-uorf2 elements (artificially synthesized to mutate the start codon ATG of wild-type uORF2 to AAA) were respectively connected into the expression vector pGreenII0800-LUC containing the dual-luciferase reporter gene. The connected uORF or uorf element was located upstream of the firefly luciferase reporter gene (reference method: Xing et al., 2020, Fine-tuning sugar content in strawberry. Genome Biology) to obtain recombinant vectors, and the recombinant vectors after sequencing were transformed into Agrobacterium strains. Then, the recombinant vector-containing Agrobacterium was used to infect Nicotiana benthamiana leaves and cultured for 48 hours. The luciferase activity of the infected tobacco leaves was detected (reference method: Xiong et al., 2022, Brassinosteroids regulate rice seed germination through the BZR1-RAmy3D transcriptional module. Plant Physiology). The results showed that Figure 5 As shown, there was no difference in the expression of GW7 gene mRNA in plants containing mutant GW7-uorf elements, but the fluorescence signal of the downstream reporter gene in plants containing mutant GW7-uorf1 elements was enhanced (LUC / RENactivity), that is, the protein expression level was increased, and the fluorescence signal of the downstream reporter gene in plants containing mutant GW7-uorf2 elements did not change, indicating that GW7-uorf1 is a valid uORF element, while GW7-uorf2 is an invalid uORF element.

[0056] The above results are consistent with the characteristics of typical uORF elements that can regulate the protein expression of downstream target genes without affecting mRNA expression.

[0057] 4. Determination of agronomic traits of rice containing mutant uorf elements

[0058] To clarify the biological function of uORF elements, the field agronomic traits of plants containing mutated uORF elements were investigated. Plants were grown in the field under conventional cultivation and management conditions. When the rice reached maturity, the agronomic traits of the rice were compared with those of the control variety, Nipponbare. Figure 6 and 7 As shown, the plant type, panicle type, seed setting rate, etc. of plants containing mutant uorf1 elements or mutant uorf1 and 2 elements did not change. Plants containing mutant uorf1 elements or mutant uorf1 and 2 elements only significantly changed grain length, grain length / grain width ratio, grain weight, fine-tuned grain width, and improved rice grain shape. This is similar to the effect of sequence variation in the GW7 gene coding region on grain shape reported (Wang et al., 2015, The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality, Nature Genetics). uORF is an element that can slightly increase the expression level of endogenous gene protein and is used for fine improvement of rice traits. This shows that the uORF element excavated by the present invention does improve grain shape by regulating GW7 gene expression, and does not affect rice growth and development.

Claims

1. A uORF element for regulating the expression of rice GLW7 and GW7 genes, characterized in that: The nucleotide sequence of the uORF element regulating the expression of rice GLW7 and GW7 genes is shown in any one or more of SEQ ID NOs. 1-3.

2. The uORF element for regulating the expression of rice GLW7 and GW7 genes according to claim 1, characterized in that: The nucleotide sequence of the uORF element that preferably regulates the expression of the rice GLW7 gene is shown as SEQ ID NO.1, and the nucleotide sequence of the uORF element that regulates the expression of the rice GW7 gene is shown as SEQ ID NO.2 and / or 3.

3. A recombinant expression vector based on the uORF element for regulating the expression of rice GLW7 and GW7 genes according to claim 1.

4. The recombinant expression vector according to claim 3, characterized in that The method for constructing the recombinant expression vector comprises the following steps: designing a target site, then designing the target site into a reverse complementary primer connected to the intermediate vector SK-gRNA, connecting the enzyme digestion product after connection to the final vector pC1300-Cas9, and obtaining the recombinant expression vector through Agrobacterium transformation.

5. Use of the uORF element for regulating the expression of rice GLW7 and GW7 genes according to claim 1 in regulating agronomic traits of rice.

6. The use according to claim 5, characterized in that The protein expression level of rice GLW7 and / or GW7 genes is regulated by gene editing of the uORF element, thereby improving the shape of rice grains.

7. The application according to claim 6, characterized in that The gene editing includes mutants, alleles or derivatives generated by adding, substituting, inserting or deleting one or more nucleotides.

8. The use according to claim 6, characterized in that By gene editing uORF elements, base mutations are caused to increase the expression of rice GLW7 and / or GW7 genes, thereby improving the shape of rice grains.

9. A method for regulating rice grain shape, characterized in that: The uORF element sequence according to claim 1 is edited to change the expression of the GLW7 and / or GW7 genes, thereby regulating the shape of rice grains.

10. Use of the uORF element for regulating the expression of rice GLW7 and GW7 genes according to claim 1 in cultivating high-yield rice germplasm.

Images