MiR-13a-3p simulant, biological reagent and application

Abstract

The invention discloses a miR-13a-3p simulant, a biological reagent and application. The miRNA simulant is composed of a positive-sense strand with the sequence shown as SEQ ID NO: 1 and an antisense strand with the sequence shown as SEQ ID NO: 2. The simulant has biological functions consistent with miR-13a-3p, and can effectively realize negative regulation of the beta GRP gene; the bacillus thuringiensis toxic protein synergist can be introduced into lepidoptera pests for use, so that the insecticidal activity on the lepidoptera pests is effectively improved, and a new thought is provided for prevention and control of agricultural pests.

Description

Technical Field

[0001] The present invention relates to agricultural biotechnology, and in particular to a miR-13a-3p mimic, a biological reagent and applications. Background Art

[0002] Insect β-1,3-glucan recognition proteins (βGRPs) are an important class of pattern recognition receptors that specifically recognize fungal β-1,3-glucans and bacterial lipopolysaccharides, thereby activating the prophenoloxidase activating system (PPO-AS). This allows for the formation of cysts or the production of toxic quinones to eliminate pathogens through melanization reactions. For example, βGRP2 in the tobacco moth (Manduca sexta) can be induced by yeast or bacteria to promote hemolymph agglutination of pathogens and activate prophenoloxidase (PPO); βGRP in the silkworm (Bombyx mori) triggers the PPO cascade by binding to β-1,3-glucans; and βGRP3 in the Asian corn borer (Ostrinia furnacalis) activates the PPO-AS-mediated melanization immune response upon bacterial infection. These findings suggest that βGRPs are key molecular switches for initiating innate immunity in insects.

[0003] Bacillus thuringiensis (Bt) is a widely used biopesticide. Its toxin proteins, such as Cry family proteins, exert their insecticidal effects by disrupting insect midgut epithelial cells. Studies have shown that insect resistance to Bt is closely linked to melanization: In Bt-resistant strains of cotton bollworm and Asian corn borer, melanization intensity and PO activity are significantly higher in the gut and hemolymph than in susceptible strains. Furthermore, the PPO protein in the midgut brush border membrane vesicles of resistant corn borers can bind to the Cry1Ah toxin, and PPO gene expression is 7.5-fold higher in resistant strains than in susceptible strains. These findings suggest a potential link between βGRPs and Bt resistance.

[0004] MicroRNAs (miRNAs) are a class of endogenous noncoding RNAs approximately 19-24 nucleotides in length that regulate gene expression by binding to the RNA-induced silencing complex (RISC) and targeting the 3'-untranslated region of mRNA. In insects, miRNAs are involved in numerous key life processes, including development, metabolism, immunity, and reproduction. Therefore, understanding the interaction between miRNAs, βGRPs-PPO-AS, and Bt in insects may provide new insights into the development of novel pest control strategies and the delay of Bt resistance. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a miR-13a-3p mimic that can inhibit the expression of the βGRP gene of agricultural pests, thereby enhancing the insecticidal effect of Bacillus thuringiensis or Bacillus thuringiensis toxic protein; the second purpose is to provide a biological agent containing the miR-13a-3p mimic, or miR-13a-3p; the third purpose is to provide the application of the miR-13a-3p mimic or biological agent in agricultural pest control.

[0006] Technical solution: The miR-13a-3p mimetic of the present invention is composed of a sense strand with a sequence as shown in SEQ ID NO: 1 and an antisense strand with a sequence as shown in SEQ ID NO: 2.

[0007] The biological reagent of the present invention contains the aforementioned miR-13a-3p mimic, or miR-13a-3p having the nucleotide sequence shown in SEQ ID NO: 3.

[0008] Application of the miR-13a-3p mimics or biological reagents of the present invention in the prevention and treatment of agricultural pests expressing βGRPs genes.

[0009] Preferably, the agricultural pests are lepidopteran pests, including:

[0010] a. A lepidopteran pest expressing the βGRP3 gene of SEQ ID NO: 4, namely, Ostrinia furnacalis;

[0011] b. A lepidopteran pest expressing a βGRPs gene having at least 70% sequence identity to the sequence shown in SEQ ID NO: 4.

[0012] Preferably, the lepidopteran pest expresses a βGRPs gene having at least 80% sequence identity with the sequence shown in SEQ ID NO:4.

[0013] Preferably, the application is to enhance the insecticidal activity of Bacillus thuringiensis or Bacillus thuringiensis toxin protein against agricultural pests.

[0014] Preferably, the Bacillus thuringiensis toxic protein is a Cry protein.

[0015] Preferably, the applying step comprises: introducing the miR-13a-3p mimic according to claim 1 or the biological agent according to any one of claims 2-3 into the body of a lepidopteran pest; the method of introducing the miR-13a-3p mimic into the body of a lepidopteran pest comprises a transgenic plant-mediated method, a microinjection method, an extracellular vesicle delivery method or a feeding method.

[0016] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The present invention discovered for the first time that miR-13a-3p can achieve negative regulation of βGRP gene expression, and thus designed and synthesized miRNA mimics with consistent biological functions; 2. miR-13a-3p or its mimics can be used as a synergist of Bacillus thuringiensis toxin protein, effectively improving the insecticidal activity against lepidopteran pests, providing a new idea for agricultural pest control. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1Statistical graph of the relative expression levels of miR-13a-3p and Of-βGRP3 genes in Cry1Ac-treated Asian corn borer;

[0018] Figure 2 This is a statistical diagram showing the results of the dual luciferase reporter system validation of the in vitro interaction between miR-13a-3p and Of-βGRP3;

[0019] Figure 3 Statistical graph of the relative expression level of Of-βGRP3 gene after the fourth-instar larvae of Asian corn borer were injected with miR-13a-3p mimics or inhibitors;

[0020] Figure 4 Statistical graph of hemolymph phenoloxidase assay results after injection of miR-13a-3p mimics or negative control into fourth-instar larvae of Asian corn borer;

[0021] Figure 5 Statistical graph of the Cry1Ac sensitivity assay results for fourth-instar larvae of the Asian corn borer after injection of miR-13a-3p mimics or negative control. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below.

[0023] Example 1: Screening and Validation of miR-13a-3p

[0024] 1. Screening of miR-13a-3p

[0025] Based on the transcriptome data of Asian corn borer treated with Bacillus thuringiensis insecticidal crystal protein Cry1Ac, miR-13a-3p having the sequence shown in SEQ ID NO: 3 was screened.

[0026] Based on the miR-13a-3p sequence and the specific region of the Asian corn borer β-1,3-glucan recognition protein (Of-βGRP3) mRNA sequence as shown in SEQ ID NO: 4 published in GenBank: KF425324.1, qPCR primers as shown in Table 1 were designed and synthesized by Nanjing Qingke Biological Co., Ltd.:

[0027] Table 1 qPCR primers

[0028] Primer name Primer sequence (5'→3') miR-13a-3p primers TATCACAGCCACTTTGATGTG Of-βGRP3 upstream primer GACGATTTCCACGAATACTCCA OF-βGRP3 downstream primers CATTGCTCGCCATCCACT Of-RPL8 upstream primer ACGGAGGTGGTAACCATCAACA Of-RPL8 downstream primer ACGCCTCCTTCTTGGTTGTCG U6 upstream primer GGAACGATACAGAGAAGATTAGC U6 downstream primer TGGAACGCTTCACGAATTTGCG

[0029] 2. Changes in relative expression levels of miR-13a-3p and Of-βGRP3 in Cry1Ac-treated Asian corn borer

[0030] The Asian corn borer (Ostrinia furnacalis) was reared in an artificial climate chamber at a temperature of 25 ± 1°C, a relative humidity of 80 ± 5%, and a photoperiod of 16 hours light: 8 hours dark. Larvae were fed an artificial diet and distinguished by head capsule width. Adults were reared in a translucent plastic box with 20% honey solution. The inner wall of the box was covered with sulfuric acid paper to facilitate egg collection.

[0031] The formula of the artificial feed is as follows: 15 g soybean meal, 19 g corn meal, 9 g yeast powder, 7.5 g glucose, 0.5 g sorbic acid, 0.5 g ascorbic acid, 2 g agar, and 120 mL sterilized water.

[0032] The Cry1Ac protoxin used in the experiment was extracted from the Bacillus thuringiensis HD73 strain. The extracted Cry1Ac protoxin was diluted to 0.347 mg / mL with sterile ddH2O. A group treated with sterile ddH2O served as a blank control. Each group was treated with three replicates, with 20 insects per replicate.

[0033] For each replicate, 4 g of artificial feed was added to a 90 mm diameter sterile culture dish. 1 mL of the aforementioned toxin dilution or sterile ddH2O was added to the feed. After thorough mixing, 20 fourth-instar larvae of Asian corn borer that had been starved for 6 h were picked out and transferred together to an artificial climate chamber for rearing. The rearing conditions were the same as those for normal rearing.

[0034] Twelve hours later, the midgut tissue of the fourth-instar larvae of the Asian corn borer was dissected and the total RNA was extracted using the Trizol method. The genomic DNA-free cDNA was obtained using the Norvegian HiScript QRT SuperMix for qPCR (+gDNA wiper) reverse transcription kit.

[0035] The qPCR method was used to detect the expression of miR-13a-3p and Of-βGRP3 after Cry1Ac treatment. The qPCR primers are shown in Table 1 above, the reaction system is shown in Table 2, and the reaction conditions are shown in Table 3. Three repeated reactions were used to obtain the average Ct value, and the relative expression levels of miR-13a-3p and Of-βGRP3 genes were calculated.

[0036] Table 2 qPCR reaction system

[0037] Ingredients volume SYBR Green Master Mix 10 μL 10 μM upstream primer 0.4μL 10 μM downstream primer 0.4μL cDNA 100ng <![CDATA[ddH2O]]> Make up to 20 μL

[0038] Table 3 qPCR reaction conditions

[0039]

[0040] The results are as follows Figure 1As shown in the figure, in Asian corn borer treated with Cry1Ac, miR-13a-3p was significantly downregulated 12 h after treatment, while its target gene βGRP3 was significantly upregulated 12 h after treatment.

[0041] Example 2: In vitro validation of the interaction between miR-13a-3p mimics and βGRP3

[0042] Based on the miR-13a-3p sequence shown in SEQ ID NO: 3, a miR-13a-3p mimic with a sense chain shown in SEQ ID NO: 1 and an antisense chain shown in SEQ ID NO: 2 was designed and commissioned to Suzhou Genetech Co., Ltd. to synthesize.

[0043] Based on the psi-check2 dual-luciferase reporter vector, a target fragment-containing dual-luciferase recombinant plasmid psi-check2-βGRP3 with a sequence as shown in SEQ ID NO: 5 was constructed. The predicted target site in the recombinant plasmid psi-check2-βGRP3 was mutated using a gene site-directed mutagenesis kit to obtain a mutant recombinant plasmid psi-check2-βGRP3-mutation with a sequence as shown in SEQ ID NO: 6.

[0044] 5×10 cells were seeded per well of a 24-well plate. 4 HEK-293T cells were transfected into four groups when the confluence reached 80%: psi-check2-βGRP3 + miR-13a-3p mimics, psi-check2-βGRP3-mutation + miR-13a-3p mimics, psi-check2-βGRP3 + negative control, and psi-check2-βGRP3-mutation + negative control, wherein the negative control consisted of the sense and antisense strands of the sequences shown in SEQ ID NOs: 7-8;

[0045] Cells were transfected using the Lipofectamine 3000 kit, with a transfection amount of 100 ng of the recombinant plasmid and 10 μmol of the miRNA mimics.

[0046] 24 h after transfection, cells were collected and lysed using the Promega dual luciferase assay kit and the differences in luciferase activity among the groups were detected. Figure 2 As shown, in the group transfected with psi-check2-βGRP3 (OfβGRP3-wt), miR-13a-3p mimics could effectively reduce luciferase activity, and in the group with target site mutation (OfβGRP3-mut), its luciferase activity was not affected by miR-13a-3p mimics.

[0047] Example 3: In vivo validation of the interaction between miR-13a-3p mimics and βGRP3

[0048] Fourth-instar larvae of the Asian corn borer were divided into treatment and control groups, with 20 larvae in each group, and three replicates were set up. Fourth-instar larvae of the Asian corn borer were disinfected with 75% ethanol, and the residual alcohol was washed with PBS, and then placed on ice for 10 minutes for freezing paralysis.

[0049] The larvae of the Asian corn borer were injected using a Nanoject III microinjector. The larvae in the treatment group were injected with 1 μL of 20 μM miR-13a-3p mimics obtained in Example 2 or a miR-13a-3p inhibitor as shown in SEQ ID NO: 9, and the larvae in the control group were injected with 1 μL of 20 μM negative control, wherein the negative control consisted of the sense and antisense strands of the sequences shown in SEQ ID NOs: 7-8.

[0050] 24 h after injection, the midgut tissue of the fourth-instar larvae of Asian corn borer was removed and total RNA was extracted using the Trizol method. The genomic DNA-free cDNA was obtained using the Norvegian HiScript QRT SuperMix for qPCR (+gDNA wiper) reverse transcription kit.

[0051] The transcription level of the target gene βGRP3 was detected by qPCR. The qPCR primers, reaction system and reaction conditions were the same as those in Example 1. Three repeated reactions were used to obtain the average Ct value and calculate the relative expression level of the βGRP3 gene.

[0052] The results are as follows Figure 3 As shown by Figure 3 A shows that the transcription level of Of-βGRP3 gene was significantly reduced after the fourth-instar larvae of Asian corn borer were injected with miR-13a-3p mimics; Figure 3 B shows that after injection of the miR-13a-3p inhibitor, the expression level of Of-βGRP3 in the fourth-instar larvae of Asian corn borer was significantly higher than that in the control group. In summary, miR-13a-3p negatively regulates the expression of the βGRP3 gene in vivo.

[0053] Example 4: Effects of miR-13a-3p mimics on insect phenoloxidase activity and Cry1Ac insecticidal activity

[0054] 1. Determination of hemolymph phenoloxidase activity after injection

[0055] Microinjection of Asian corn borer larvae was performed according to the grouping and method described in Example 3.

[0056] (1) 24 h after injection, hemolymph was collected by dissection and diluted 100-fold with enzyme-free water;

[0057] (2) Add 20 μL of diluted sample and 200 μL of Bradford solution to each well of a 96-well ELISA plate and let it stand at room temperature for 2 min. Repeat three times for each treatment and measure the absorbance of the sample at 595 nm.

[0058] (3) Add 20 μL of diluted sample and 150 μL of 2 mM dopamine aqueous solution containing 0.1% cetylpyridinium chloride (CPC) to each well of a 96-well ELISA plate. Repeat three times for each treatment. Measure the absorbance of the sample at 470 nm. Then, shake the plate for 10 minutes and measure the absorbance of the sample at 470 nm again.

[0059] (4) According to the protein concentration standard curve y = 0.0021x + 0.538, R 2 =0.9928, and the protein concentration and specific activity of phenoloxidase (PO) were calculated respectively.

[0060] The results are as follows Figure 4 As shown: Compared with the control group, injection of miR-13a-3p mimics significantly inhibited PO activity in the hemolymph of Asian corn borer.

[0061] 2. Cry1Ac sensitivity determination of Asian corn borer larvae after injection

[0062] Fourth-instar larvae of Asian corn borer were divided into a negative control group, a negative control + Cry1Ac group, a miR-13a-3p mimic group, and a miR-13a-3p mimic + Cry1Ac group. Each treatment group had three replicates, with 20 larvae in each replicate. Microinjection of Asian corn borer larvae was performed according to the method described in Example 3, wherein the negative control consisted of the sense and antisense strands of the sequences shown in SEQ ID NOs: 7-8.

[0063] (1) 24 h after injection, a sublethal dose (LC25) of Cry1Ac was used for feeding treatment: 4 g of artificial feed was added to a 90 mm diameter sterile culture dish for each replicate, 1 mL of 0.347 mg / mL Cry1Ac diluent or sterile ddH2O was added to the feed, and after thorough mixing, 20 fourth-instar larvae of Asian corn borer that had been starved for 6 h were picked up and transferred together to an artificial climate chamber for rearing. The rearing conditions were the same as those described in Example 1. The number of surviving larvae in each group was counted every 12 h. GraphPad Prism (v8.0) software was used for data processing and charting. The survival data after Cry1Ac treatment were analyzed for significance of differences using the log-rank (Mantel-Cox) test. P < 0.05 was considered to be statistically significant.

[0064] The formula of the artificial feed is as follows: 15 g soybean meal, 19 g corn meal, 9 g yeast powder, 7.5 g glucose, 0.5 g sorbic acid, 0.5 g ascorbic acid, 2 g agar, and 120 mL sterilized water.

[0065] The results are as follows Figure 5 As shown in the results, the survival rate of the fourth-instar larvae of Asian corn borer was significantly reduced after injection of miR-13a-3p mimics (P=0.0171), indicating that miR-13a-3p can act as a Bt synergist to significantly enhance the insecticidal activity of Cry1Ac.

Claims

1. A miR-13a-3p mimic, characterized in that The miRNA mimic consists of a sense strand with a sequence as shown in SEQ ID NO: 1 and an antisense strand with a sequence as shown in SEQ ID NO:

2.

2. A biological reagent, characterized in that: The biological reagent contains the miR-13a-3p mimetic or miR-13a-3p according to claim 1.

3. The biological reagent according to claim 2, characterized in that The miR-13a-3p has a nucleotide sequence as shown in SEQ ID NO:

3.

4. Use of the miR-13a-3p mimic according to claim 1 or the biological agent according to any one of claims 2 to 3 in the control of agricultural pests expressing βGRPs genes.

5. The use according to claim 4, characterized in that The agricultural pests are lepidoptera pests.

6. The use according to claim 4, characterized in that The lepidopteran pests include: a. Lepidopteran pests expressing the βGRPs gene of SEQ ID NO: 4; b. A lepidopteran pest expressing a βGRPs gene having at least 70% sequence identity to the sequence shown in SEQ ID NO:

4.

7. The use according to claim 4, characterized in that The application is to enhance the insecticidal activity of Bacillus thuringiensis or Bacillus thuringiensis toxic protein against agricultural pests.

8. The use according to claim 7, characterized in that The Bacillus thuringiensis toxic protein is Cry protein.

9. The use according to claim 4, characterized in that The applying step comprises: introducing the miR-13a-3p mimic according to claim 1 or the biological reagent according to any one of claims 2 to 3 into the body of a lepidopteran pest.

10. The use according to claim 9, characterized in that The methods for introducing the drug into the body of lepidopteran pests include transgenic plant-mediated method, microinjection method, extracellular vesicle delivery method or feeding method.

Images