Enhancer regulatory element for dairy cow LTF gene transcription regulatory expression and application of enhancer regulatory element

Abstract

The invention discloses an enhancer regulatory element for dairy cow LTF gene transcriptional regulatory expression and application of the enhancer regulatory element. The sequence of the regulatory element is SEQ ID No.1. By implementing the technical scheme, expression of the LTF gene can be accurately regulated and controlled, the mammary gland function is optimized, and the method has a wide application prospect and particularly has an important practical value in animal breeding and dairy product production.

Description

Technical Field

[0001] The present invention belongs to the field of animal molecular genetics and precision breeding technology, and specifically relates to the identification of specific enhancer regulatory elements of the lactoferrin (LTF) gene (including the eQTL regulatory region at 4660bp upstream, the enhancer enhancer-1 in the intron region at 29248bp downstream, and the enhancer enhancer-2 in the intergenic region at 35913bp downstream) and their application in the genetic improvement of the lactation performance of ruminants. Background Art

[0002] Lactoferrin (LTF) is an important functional protein in mammalian milk, and its expression regulation mechanism has always been a research hotspot in the fields of molecular genetics and animal husbandry breeding. In the existing technology, the study of gene expression regulation mainly focuses on the relationship between sequence variation of the gene itself and gene expression, especially the functional study of expression quantitative trait loci (eQTLs) and regulatory elements. Many studies have used high-throughput sequencing technologies, such as ATAC-seq and RNA-seq, to ​​identify regulatory elements and their variations related to gene expression, especially in agriculture, animal breeding and human disease research. For example, through eQTL analysis and exploration of open chromatin regions, researchers have identified many genetic variations associated with the expression of specific genes, thereby revealing the functional differences in gene regulatory mechanisms (such as regulatory elements of LTF genes) between different species.

[0003] However, existing technologies have some limitations:

[0004] (1) Conservative differences between species: Existing studies have mostly focused on the comparison of gene expression regulation within a single species or between species, while studies on the evolutionary conservation of regulatory elements between different species, especially non-model species, are still relatively lacking. Although some studies have analyzed the regulatory networks of specific genes through cross-species comparisons, most studies lack a comprehensive and in-depth analysis of gene expression regulation, especially for the regulation of complex non-coding regions.

[0005] (2) Complexity of gene expression: Gene expression is regulated by multiple factors, including not only DNA sequence variation but also chromatin spatial structure, transcription factor binding, and cell or tissue specificity. Existing technologies often focus on analyzing a single aspect and lack multi-level, comprehensive integrated analysis, resulting in an incomplete understanding of the mechanisms regulating gene expression.

[0006] (3) Species-specific factors: Although some studies have attempted to compare gene regulatory mechanisms across species, species-specific differences still make it difficult to directly translate cross-species research into practical applications. For example, gene regulatory elements and transcription factor binding sites may differ significantly between species, and directly transferring research results from one species to other species may lead to inaccurate results.

[0007] Therefore, despite some progress in the field of gene expression regulation, existing technologies still face limitations in interspecies comparisons, difficulties in validating the functions of regulatory elements, and a lack of comprehensive mechanistic understanding. To address these issues, this study integrates data from different species, conducts multi-level analyses, and provides a more systematic solution through functional validation. In particular, the in-depth analysis of LTF gene regulatory elements fills some technical gaps in this field. Summary of the Invention

[0008] Based on the above reasons, the present invention proposes an enhancer regulatory element for the transcriptional regulation of the expression of the cow LTF gene and its application. Specifically, in order to achieve the purpose of the present invention, the present invention intends to adopt the following technical solutions:

[0009] One aspect of the present invention relates to an enhancer regulatory element for transcriptional regulation of the expression of the cow LTF gene, the sequence of which is SEQ ID No. 1, specifically:

[0010]

[0011] Another aspect of the present invention relates to a vector containing the enhancer regulatory element for transcriptional regulation and expression of the dairy cow LTF gene.

[0012] In a preferred embodiment of the present invention, the vector comprises pGL4.17[luc2 / Neo] and pcDNA3.1.

[0013] Another aspect of the present invention relates to an enhancer regulatory element for transcriptional regulation of LTF gene expression in dairy cows or the use of the above-mentioned vector in improving LTF gene expression.

[0014] In a preferred embodiment of the present invention, the increasing LTF gene expression refers to increasing LTF gene expression in dairy cows.

[0015] The present invention has the following beneficial effects: By combining eQTL analysis, ATAC-seq data, cross-species comparisons, and functional validation experiments, it reveals the regulatory mechanism of LTF gene expression. By discovering and validating key enhancer regulatory elements upstream and downstream of the LTF gene and their conservation, it provides new ideas and methods for future research on mammary gland-related gene regulation. Furthermore, the present invention reveals for the first time the key role of EHF transcription factors in regulating LTF gene expression, providing a potential molecular target for the regulation of mammary gland function.

[0016] The technical solution of this invention relates to the regulatory mechanism of LTF gene expression. In particular, by discovering and verifying key regulatory elements upstream and downstream of the LTF gene and their conservation across different species, an innovative method for regulating LTF gene expression is proposed. This technical solution can optimize the function of mammary gland-related genes by precisely regulating LTF gene expression, with important applications in animal breeding and dairy production.

[0017] The implementation of the technical solution of the present invention can accurately regulate the expression of the LTF gene and optimize mammary gland function, and has broad application prospects, especially in animal breeding and dairy product production. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the construction of a regulatory element vector containing 20 variant sites. This vector uses pGL4.17[luc2 / Neo] as the backbone vector, which contains a luciferase gene (luc2), one of the most commonly used reporter genes in enhancer experiments. This enhancer sequence was inserted behind the universal strong CMV promoter using a HindIII restriction site to evaluate enhancer activity, including that of enhancers containing variant sites.

[0019] Figure 2Schematic diagram of the construction of vectors encoding two conserved enhancer regulatory elements of the ruminant LTF gene. The two regulatory elements share a common core transcription factor, EHF. The first step is to demonstrate the specific location of EHF on the two regulatory elements. Next, plasmid vectors encoding the transcription factor EHF and the two regulatory elements were constructed. The common transcription factor EHF and the two regulatory elements were transfected together to test transfection efficiency, and the activity of the two enhancer regulatory elements was tested separately. These enhancers were named EHF-enhancer-1, EHF-del-enhancer-1, EHF-enhancer-2, and EHF-del-enhancer-2, respectively.

[0020] Figure 3 :The results of a dual-luciferase vector reporter gene experiment on genetic factors affecting the transcriptional regulation level of the LTF gene-specific expression enhancer regulatory element. The dual-luciferase vector reporter gene detection system was used to evaluate the transcriptional regulatory activity potential of the enhancer regulatory element in two different cell models (HEK-293T and MAC-T cell lines). The results showed that compared with the control group, the reference sequence activity of the regulatory element was significantly increased, and compared with the reference sequence, the enhancer activity of the mutant sequence was significantly reduced. The above results indicate that the genetic variation of this regulatory element precisely regulates the expression of the LTF gene by changing the enhancer activity.

[0021] Figure 4 Results of a dual-luciferase reporter gene experiment targeting a common transcription factor and two conserved enhancer regulatory elements (ERs) for LTF genes in ruminants. In a bovine mammary epithelial cell line (MAC-T), enhancer activity of enhancer-1 and enhancer-2 was significantly increased compared to the control group. Co-transfection of these two regulatory elements with EHF significantly increased their activity, with enhancer-1 activity significantly higher than enhancer-2 activity. DETAILED DESCRIPTION

[0022] To further understand the present invention, the following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0023] Unless otherwise specified, all reagents involved in the embodiments of the present invention are commercially available products and can be purchased through commercial channels.

[0024] (I) Identification of LTF gene-specific expression regulatory elements

[0025] 1.1 Identification of eQTL loci and enhancer regulatory elements in dairy cows

[0026] Milk was collected from 585 lactating dairy cows and isolated cells for RNA-seq sequencing. eQTLs were identified using a second-generation genomic panel. ATAC-seq data from cells isolated from milk from 10 dairy cows were then quality-controlled and aligned, and chromatin access regions were detected. Finally, enhancers and promoters were identified using genomic functional annotation. 484 eQTL loci were detected within 100 KB of the LTF gene, and a key regulatory element (22:52946414-52947911) was identified 4660 bp upstream of the LTF gene. This region contains 20 eQTL loci (22_52946429_C_A, 22_52946430_C_T, 22_52946468_G_A, 22_52946517_G_A, 22_52946581_G_T, 22_52946587_C_G, 22_52946697_T_A, 22_52946715_T_C, 22_52946852_G_T, 22_52946897_T_C, 22_5294686 _T_C, 22_52947103_A_T, 22_52947120_G_C, 22_52947257_A_G, 22_52947372_A_G, 22_52947400_T_G, 22_52947510_A_G, 22_52947610_A_G, 22_52947661_T_A and 22_52947790_C_T), and haplotype clustering analysis found that the 20 sites corresponding to this enhancer regulatory element were highly linked.

[0027] 1.2 Identification of conserved regulatory elements in ruminant LTF

[0028] Milk from lactating cows, buffaloes, goats, sheep, red deer, and humans, as well as mammary tissue from mice, were collected for RNA and ATAC-seq sequencing. After data quality control and alignment, detection of chromatin open regions, and genomic annotation, enhancers and promoters were identified. Starting from the transcription start site of the LTF gene in each species, two positionally conserved enhancer regulatory elements were identified within ±100KB. Further sequence alignment revealed that the identity of these two regulatory elements in each species was >98%, and that the two regulatory elements interacted with each other, promoting LTF gene expression by binding to the shared transcription factor EHF.

[0029] (II) Identification of LTF gene expression enhancer regulatory elements

[0030] 2.1 Construction of regulatory element fluorescence reporter vector

[0031] The cow genome sequence published on the database website NCBI was used as the standard sequence, and sequences 22:52946414-52947911, 22:52981819-52982561, and 22:52988484-5298921 were synthesized and ligated into the vector pGL4.17 (Shanghai Sangon Biotechnology Co., Ltd.).

[0032] 22:52946414-52947911

[0033]

[0034] 22:52981819-52982561

[0035] TAAGGATCAGGTGGCTTTTGGCAATGGTTGCAATGGGCTCAGTTCCAGAGGTGACCTTGATTCTGAGCCACAGAAGCACACTATCTGCCTGTCAGCCAATTGGAAGTTGAAAGTGATACTTAAAAAAAAAAAAAATTGAACATATGCAAGTAAAAGTTTCCCCTTTTAAAAAAGGAAGTAGAAGGCTTCATTCAGCCCCTGTGAACTGTCGGGGAGAACTTCTTGGGAGTGAAGGGCAAAATCACAGGCGGATGATCAAGGGAATCCACCAGCCAGCCAGCATAGAGAACTAGCCACTCTCTTCTGGACCCTTGGTGGGAATAATAATGATAACTTCAAGACTCAGCCAGTTGCTTCCTTCTAAACTGCACCTCTTGTGTCACTGACCCACAGGGACTACCACTTCCTCCCTTGGAGAAGGAAGCGACTGAGGCCAGACATGTAAATTTTGGGATGATCGAGTATAAAGCCAAGAGGTTGGAGAGGAAGTATTTTCTTGAGGGGAGAAGGAGAGAGACA GTGTGACCAGGAAGCCGTATTTGCATACACACAGCGATTTGCATACACACAGGCGGCATGCACACAACTGCATTTCGAATTCAGGAACCTTGAATC

[0036] 22:52988484-52989210

[0037] CAGTAGATAACTTAAGTGGAATGAAAGGCCCATGAAATCTCCTTTTCTGGCTGAAATAAAGTTTCAAAGTCTAACATCACTGTATCCATTGATGCTCAGTCACGTCTGACTCTTGTGACTCCATGGACTATAGTCCATGGAATTCTCCAGGCCAGAATACTGGAGTGGGCAGCTTTTCCCT TCTCCAGGGGATCTTCCCAACCCAGGAATCGAACTGAGATCTCCTGCATTGCAGGCAGATTCTTTACCAACTGAGCTATCAGGGCAGCCCCTGTATCCATTAGCTCATGCTAAGTTATATCAACATCCCAGTGCCTTACATAACAAAGCCACATTCATGGGTCATGGGTCACATTCATGCCT GTCGTGAGTCATCAGAGACTCTGTTGTTCATCTCTTTATTCTGAGACCCAGGCTGAACCATCAGCTCCCACCTAGGGAATGTTGGCTTTTAAACAGGGGAAAATAAAAGAGTTGGAGGCATGACACAATAACTCTTAAAGCTTCCTCCTGGGAGAGGCCATATAATTTCCATTATTTCATC ACCCCAAAACAAGTCAGGAGGTCATAGCATCACTGTGTGTGTATGGGGGAGGGGTCTTTGGTCTCATATCCTTTCACTCTAACCCTGAATTGAGTGTGAACTCTATTTGGTGTCCCTGGTTTTACTTTCTGAAACCCCCAAGTTCCTTAAAATCTTCTAGGAAAGCTCATGGCCTTGCATTC

[0038] (1) The recombinant enhancer regulatory element fluorescent reporter vectors are named reference type and mutant type respectively. The schematic diagram of the fluorescent reporter vector construction is shown in the figure. Figure 1 shown. Figure 1 Schematic diagram of the construction of a regulatory element vector containing 20 variant sites. The pGL4.17[luc2 / Neo] backbone vector contains a luciferase gene (luc2), one of the most commonly used reporter genes in enhancer assays. This enhancer sequence was inserted behind the universal, strong CMV promoter using a HindIII restriction site to evaluate enhancer activity, including that containing the variant sites.

[0039] (2) The fluorescent reporter vectors of the conserved recombinant enhancer regulatory elements were named EHF-enhancer-1, EHF-del-enhancer-1, EHF-enhancer-2, and EHF-del-enhancer-2. The schematic diagram of the fluorescent reporter vector construction is shown in the figure. Figure 2 Figure 1. Schematic diagram of the construction of two conserved enhancer regulatory element vectors for the ruminant LTF gene. The two regulatory elements share a common core transcription factor, EHF. The first step is to demonstrate the specific location of EHF on the two regulatory elements. Next, plasmid vectors for the transcription factor EHF and the two regulatory elements are constructed. The common transcription factor EHF is transfected with the two regulatory elements to test transfection efficiency. These plasmids are named EHF-enhancer-1 and EHF-enhancer-2. Furthermore, the activity of the two enhancer regulatory elements, named EHF-del-enhancer-1 and EHF-del-enhancer-2, is tested.

[0040] 2.2 Dual fluorescence detection of regulatory element functions

[0041] HEK-293T cells (Shanghai Sixin Biotechnology Co., Ltd.) and bovine mammary epithelial cells MAC-T (Shanghai Sixin Biotechnology Co., Ltd.) were cultured at a density of 5 × 10 cells per well. 5 The cells were transferred to 24-well plates and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco). When the cell confluence reached 70%-80%, lipofectamine TMTransfection was performed using Opti-DMEM (3000 Transfection Reagent, Thermo Fisher Scientific). Cells were starved for 1 hour before transfection, and then replaced with complete medium supplemented with 5% serum. Plasmid dosages included 0.4 μg of pGL4.17 plasmid, 0.1 μg of pRL-TK (Renilla luciferase reporter vector, Promega) plasmid, and 0.4 μg of EHF-pcDNA3.1 plasmid per well. Group assignments included: control group (transfected with empty pGL4.17 plasmid and pRL-TK plasmid); experimental group 1 (reference type) (transfected with reference plasmid and pRL-TK); and experimental group 2 (mutant type) (transfected with mutant plasmid and pRL-TK plasmid). For the two regulatory elements identified as conserved in Artiodactyla: the first conserved regulatory element (22:52981819-52982561) was divided into the control group, which was transfected with pGL4.17 empty vector and pRL-TK plasmid; experimental group 1: enhancer-1 was transfected with plasmid enhancer-1 and pRL-TK; experimental group 2: EHF-enhancer-1 was transfected with plasmid EHF-enhancer-1, pRL-TK and EHF-pcDNA3.1. The second conserved regulatory element (22:52988484-5298921) was divided into the control group, which was transfected with pGL4.17 empty vector and pRL-TK plasmid; experimental group 1: enhancer-2 was transfected with plasmid enhancer-2 and pRL-TK, and experimental group 2: EHF-enhancer-2 was transfected with plasmid EHF-enhancer-2, pRL-TK and EHF-pcDNA3.1. Incubate at room temperature for 10 minutes, culture in a 37°C incubator for 8 hours, change the medium, lyse and collect the sample after 48 hours, and use the dual-luciferase reporter kit (TransDetect Double-Luciferase Reporter Assay Kit, Beijing Quanshijin Biological Company) to identify luciferase activity. The experimental results are shown in Figure 2. Figure 3 and Figure 4 As shown. Figure 3 The reference sequence of this element significantly enhanced the regulatory activity compared to the mutant sequence (p<0.001). Figure 4Two conserved enhancer regulatory elements (enhancer-1 and enhancer-2) were identified in the 29,248-bp intronic region (22:52981819-52982561, 742 bp) and the 35,913-bp intergenic region (22:52988484-52989210, 726 bp) downstream of the LTF gene in Artiodactyla. Dual-luciferase reporter gene assays were performed on these two conserved regulatory elements and their shared core transcription factor, EHF. The results showed that the activities of enhancer-1 and enhancer-2 were significantly increased compared to the control group. Furthermore, the activities of LTF-EHF+enhancer-1 and LTF-EHF+enhancer-2 were significantly enhanced compared to LTF-EHF-enhancer-1 and LTF-EHF-enhancer-2. The above results show that the two enhancer regulatory elements conserved in Artiodactyla have significant enhancer activity, mediating the interaction between EFH and LTF and promoting the transcriptional regulation of LTF expression.

[0042] The preferred embodiments of the present invention are described above, but they are not intended to limit the present invention. Those skilled in the art may make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present invention.

Claims

1. An enhancer regulatory element for transcriptional regulation of the expression of the cow LTF gene, whose sequence is SEQ ID No.

1.

2. A vector containing the enhancer regulatory element for transcriptional regulation of the cow LTF gene.

3. The vector according to claim 2, comprising pGL4.17[luc2 / Neo] and pcDNA3.

1.

4. Use of the enhancer regulatory element for transcriptional regulation of the cow LTF gene according to claim 1 in improving the expression of the LTF gene.

5. The use according to claim 4, wherein said increasing LTF gene expression refers to increasing LTF gene expression in dairy cows. Use of the vector according to claim 3 in increasing the expression of the LTF gene.

7. The use according to claim 6, wherein said increasing LTF gene expression refers to increasing LTF gene expression in dairy cows.

Images