Method for enhancing methyl mercury degrading capacity of phytoplankton, recombinant phytoplankton and preparation method thereof

Abstract

The invention provides a method for enhancing methyl mercury degradation capacity of phytoplankton, and belongs to the field of biotechnology. The method for enhancing the methyl mercury degrading capacity of the phytoplankton comprises the step of enabling the phytoplankton to overexpress a methyl mercury lyase gene merB. The organic mercury lyase coded by the merB gene, namely the MerB protein, can decompose high-toxicity methyl mercury into low-toxicity Hg and methane (CH), so that the tolerance of phytoplankton expressing the merB gene to the methyl mercury can be enhanced. Meanwhile, the phytoplankton can enrich methyl mercury in the water environment, the phytoplankton serves as a primary producer in a food chain and is a source of substances and energy, the content of methyl mercury can be reduced from the source by reducing the methyl mercury in the phytoplankton, and therefore the ecological health risk that the methyl mercury is transmitted along the food chain is reduced. The mercury metabolic pathway of phytoplankton is enhanced through genetic engineering, and an efficient and sustainable method is provided for bioremediation of mercury pollution.

Description

Technical Field

[0001] The present invention relates to the technical field of recombinant microorganisms, and in particular to a method for enhancing the ability of phytoplankton to degrade methylmercury. Background Art

[0002] Mercury is a global pollutant that poses significant ecological and health risks. While environmental mercury pollution is a serious issue, efforts to regulate mercury levels are accelerating, and significant reductions in mercury emissions are being achieved. However, in addition to anthropogenic sources, mercury releases from natural processes such as volcanic eruptions, forest fires, and ocean evaporation are a significant contributor. Addressing mercury pollution requires reducing the potential exposure to residents through its accumulation and transfer along the food chain, a significant challenge.

[0003] Mercury exists in the environment in the form of inorganic or organic mercury, with different forms varying significantly in toxicity. Methylmercury is one of the most toxic forms of mercury, primarily produced by anaerobic methylating microorganisms. It can enter the human body through consumption of contaminated fish or rice, posing health risks. Methylmercury pollution in the natural environment is primarily controlled through biological and abiotic pathways. Abiotic methylmercury remediation, primarily through dredging and in-situ capping, is costly and, after remediation, mercury remains in the highly toxic form. Due to its high accumulation and biomagnification, it can pose subsequent environmental health risks.

[0004] Therefore, a more effective and safer method of controlling mercury pollution is needed. Summary of the Invention

[0005] In view of this, in order to at least partially solve at least one of the above-mentioned technical problems, the present invention provides a method for enhancing the ability of phytoplankton to degrade methylmercury.

[0006] According to an embodiment of one aspect of the present invention, a method for enhancing the ability of phytoplankton to degrade methylmercury is provided, which comprises the step of causing the phytoplankton to overexpress the methylmercury lyase gene merB.

[0007] According to another embodiment of the present invention, a recombinant phytoplankton is provided, wherein the recombinant phytoplankton comprises a methylmercury lyase gene merB having a base sequence as shown in SEQ ID No. 1 and a promoter operably linked to the merB gene sequence, wherein the promoter comprises P petE and / or P rbcL .

[0008] According to another embodiment of the present invention, there is provided a method for preparing phytoplankton capable of degrading methylmercury, comprising:

[0009] a. Constructing an expression vector comprising a merB gene sequence and a promoter operably linked to the merB gene sequence, optionally, the promoter is P petE and / or P rbcL , which were amplified from the cyanobacterium Synechocystis sp. PCC6803;

[0010] b. introducing the expression vector into a host cell such as a phytoplankton host cyanobacteria;

[0011] c. Take positive colonies for colony PCR and sequence verification to obtain recombinant phytoplankton.

[0012] According to another embodiment of the present invention, an expression vector is provided, comprising a methylmercury lyase gene merB having a base sequence as shown in SEQ ID No. 1 and a promoter operably linked to the merB gene sequence, wherein the promoter comprises P petE and P rbcL .

[0013] According to another embodiment of the present invention, a methylmercury degrading agent is provided, comprising the above-mentioned recombinant phytoplankton.

[0014] According to another embodiment of the present invention, a method for degrading methylmercury is provided, comprising applying recombinant phytoplankton or a methylmercury degrading agent to an environment to be treated. Optionally, the environment to be treated comprises an aquatic environment or an aquatic environment such as a rice field or a mine, including organisms involved therein.

[0015] According to embodiments of the present invention, the organomercury lyase (MerB protein) encoded by the merB gene can break down highly toxic methylmercury into less toxic Hg²⁺. Therefore, phytoplankton expressing the merB gene can enhance their tolerance to methylmercury. Through genetic recombination, a recombinant phytoplankton strain capable of degrading methylmercury was successfully constructed, enhancing the microbial ability to degrade methylmercury and reducing methylmercury levels in fish, thereby increasing the potential application of phytoplankton in the management of methylmercury pollution. Furthermore, phytoplankton itself can enrich methylmercury in the aquatic environment. As primary producers in the food chain, they serve as a source of material and energy. Reducing methylmercury in phytoplankton can reduce methylmercury levels at the source, thereby reducing the ecological health risks of methylmercury transmission along the food chain. By enhancing the mercury metabolic pathways of phytoplankton through genetic engineering, not only does it improve methylmercury degradation efficiency, but it also enhances the organism's environmental adaptability and ecological safety, providing an efficient and sustainable approach for the bioremediation of mercury pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The above and other objects, features and advantages of the present invention will become more apparent through the following description of the embodiments of the present invention with reference to the accompanying drawings, in which:

[0017] Figure 1 This is a comparison of the results of methylmercury degradation by the recombinant strain and the wild-type strain of the present invention;

[0018] Figure 2 This is a comparison chart of the results of methylmercury degradation in lake water by an embodiment of the present invention. A shows the degradation of methylmercury in lake water, and B shows the degradation of methylmercury in lake water with copper sulfate added.

[0019] Figure 3 This is a diagram showing the effect of the recombinant strain 6803-PLB in the present invention on degrading methylmercury in lake water;

[0020] Figure 4 This is a graph showing changes in mercury content in silver carp using the recombinant strain 6803-PLB as a food source for the silver carp according to an embodiment of the present invention. A shows changes in methylmercury concentration, and B shows changes in total mercury concentration. DETAILED DESCRIPTION

[0021] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the present invention. In the following detailed description, for ease of explanation, many specific details are set forth to provide a comprehensive understanding of embodiments of the present invention. However, it is apparent that one or more embodiments may also be implemented without these specific details. In addition, in the following description, descriptions of known structures and technologies are omitted to avoid unnecessary confusion of the concept of the present invention.

[0022] The terms used herein are only for describing specific embodiments and are not intended to limit the present invention. The term "comprising" used herein indicates the existence of features, steps, operations, but does not exclude the existence or addition of one or more other features.

[0023] When expressions such as “at least one of A, B, and C, etc.” are used, they should generally be interpreted in accordance with the meaning commonly understood by those skilled in the art (for example, “a system having at least one of A, B, and C” should include but is not limited to systems having A alone, B alone, C alone, A and B, A and C, B and C, and / or A, B, and C, etc.). When expressions such as “at least one of A, B, or C, etc.” are used, they should generally be interpreted in accordance with the meaning commonly understood by those skilled in the art (for example, “a system having at least one of A, B, or C” should include but is not limited to systems having A alone, B alone, C alone, A and B, A and C, B and C, and / or A, B, and C, etc.).

[0024] The term "homology" refers to the level of similarity or percent identity between polynucleotide sequences in terms of percent nucleotide positional identity (i.e., sequence similarity or identity). As used herein, homology also refers to the concept of similar functional properties between different polynucleotide molecules; for example, promoters with similar functions may have homologous cis-elements. Polynucleotide molecules are homologous when they hybridize specifically under specific conditions to form duplex molecules. Under these conditions, referred to as stringent hybridization conditions, a polynucleotide molecule can be used as a probe or primer to identify another polynucleotide molecule that shares homology.

[0025] The term "promoter" refers to a polynucleotide molecule that is located upstream or 5' of the translation start codon of the open reading frame (or protein coding region) in its natural state and is involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.

[0026] The term "operably linked" refers to the connection of a first polynucleotide molecule (e.g., a promoter) to a second transcribable polynucleotide molecule (e.g., a gene of interest), wherein the polynucleotide molecules are arranged such that the first polynucleotide molecule affects the function of the second polynucleotide molecule. Preferably, the two polynucleotide molecules are part of a single contiguous polynucleotide molecule, and more preferably, are adjacent. For example, a promoter is operably linked to a gene of interest if it regulates or mediates transcription of the gene of interest within a cell.

[0027] The term "transformation" is a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0028] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0029] The term "recombinant host cell strain" or "host cell" refers to a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector, such as a plasmid, or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0030] During the process of implementing the present invention, it was discovered that some microorganisms can convert highly toxic methylmercury into a less toxic inorganic form of mercury through their own metabolic processes. This form conversion process is mainly mediated by the methylmercury lyase protein MerB. The methylmercury lyase protein MerB can break the C-Hg bond and convert methylmercury into inorganic mercury. However, the merB gene, as an auxiliary gene, is located downstream of the mer operon, and its expression level is unstable, resulting in differences in the microbial methylmercury degradation effect. In addition, for the use of the merB gene for mercury pollution control, plants or Escherichia coli are mostly used as model microorganisms to degrade methylmercury. Their limited biomass or lack of practical implementation possibilities result in limited methylmercury degradation. As a source of matter and energy for aquatic ecosystems, phytoplankton has a large biomass and is a key link in the entry of methylmercury into the food chain, posing health risks. Currently, there is a lack of records of using recombinant phytoplankton to treat methylmercury, especially methylmercury that is transmitted through the food chain and poses health risks.

[0031] Specifically, according to an embodiment of one aspect of the present invention, a method for enhancing the ability of phytoplankton to degrade methylmercury is provided, which includes the step of causing phytoplankton to overexpress the methylmercury lyase gene merB.

[0032] According to embodiments of the present invention, the organomercury lyase (MerB protein) encoded by the merB gene can break down highly toxic methylmercury into less toxic Hg²⁺. Therefore, phytoplankton expressing the merB gene can enhance their tolerance to methylmercury. Through genetic recombination, a recombinant phytoplankton strain capable of degrading methylmercury was successfully constructed, enhancing the microbial ability to degrade methylmercury and reducing methylmercury levels in fish, thereby increasing the potential application of phytoplankton in the management of methylmercury pollution. Furthermore, phytoplankton itself can enrich methylmercury in the aquatic environment. As primary producers in the food chain, they serve as a source of material and energy. Reducing methylmercury in phytoplankton can reduce methylmercury levels at the source, thereby reducing the ecological health risks of methylmercury transmission along the food chain. By enhancing the mercury metabolic pathways of phytoplankton through genetic engineering, not only does it improve methylmercury degradation efficiency, but it also enhances the organism's environmental adaptability and ecological safety, providing an efficient and sustainable approach for the bioremediation of mercury pollution.

[0033] Specifically, the degradation rate of the recombinant phytoplankton of the present invention for 1 ng / mL of methylmercury in BG11 culture medium is 83.1-85.0% within 24 hours.

[0034] According to an embodiment of the present invention, the base sequence of the methylmercury lyase gene merB is shown in SEQ ID No. 1; the phytoplankton includes eukaryotic algae and / or prokaryotic algae, preferably cyanobacteria.

[0035] According to the embodiments of the present invention, cyanobacteria or blue-green algae with phytoplankton properties are photosynthetic autotrophic organisms with mature large-scale production processes, which can produce a large number of bacteria for treating methylmercury pollution.

[0036] The base sequence of the methylmercury lyase gene merB is SEQ ID No. 1:

[0037] .

[0038] According to another embodiment of the present invention, a recombinant phytoplankton is provided, comprising a methylmercury lyase gene merB having a base sequence as shown in SEQ ID No. 1 and a promoter operably linked to the merB gene sequence, wherein the promoter comprises P petE and / or P rbcL .

[0039] According to an embodiment of the present invention, in a mercury pollution emergency scenario, the copper-inducible promoter P petECan respond quickly to changes in copper ion concentration; strong constitutive promoter P rbcL It can continuously drive merB gene expression without relying on environmental signals, and can maintain basic methylmercury degradation activity without waiting for induction conditions to be triggered, thus avoiding repair delays. It is particularly suitable for large-scale repair in open environments (such as lakes and rivers) and reduces the cost of human intervention. petE and P rbcL The compatibility allows the subsequent introduction of other repair genes (such as mercury reductase merA) to construct a multi-gene collaborative repair system.

[0040] Alternatively, the methylmercury lyase gene merB and the promoter operably linked to the merB gene sequence are achieved by constructing a plasmid. Preferably, the plasmid is a pUC18 vector plasmid.

[0041] According to an embodiment of the present invention, the phytoplankton is a prokaryotic cyanobacteria, and the recombinant phytoplankton includes P petE Synechocystis sp. PCC 6803 △slr0168::PpetE-merB-Sp promoter r Deposited in China Center for Type Culture Collection with accession number 20251153 and P rbcL Synechocystis sp. PCC 6803 △slr0168::PrbcL-merB-Sp promoter r It was deposited in China Center for Type Culture Collection with the accession number CCTCC M 20251152.

[0042] Specifically, the present invention uses the Synechocystis sp. PCC 6803 genome (GenBank accession number: BA000022.2), promoter P petE (Gene ID: 954711), promoter P rbcL (Gene ID: 954171), the above promoter can be used directly for connection, or the promoters PpetE and PrbcL can be amplified by designing primers PpetE-F / R or PrbcL-F / R, which is not limited in the present invention.

[0043] Strain name: Synechocystis sp. PCC 6803 △slr0168::PpetE-merB-Sp r

[0044] Strain ID: 20251153

[0045] Storage time: May 21, 2025

[0046] Collection Center: China Center for Type Culture Collection (CCTCC)

[0047] Storage address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province

[0048] CCTCC M 20251153

[0049] Strain name: Synechocystis sp. PCC 6803 △slr0168::PrbcL-merB-Sp r

[0050] Strain ID: 20251152

[0051] Storage time: May 21, 2025

[0052] Collection Center: China Center for Type Culture Collection (CCTCC)

[0053] Storage address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province

[0054] CCTCC M 20251152

[0055] According to another embodiment of the present invention, a method for preparing phytoplankton that degrades methylmercury is provided, comprising the following steps a to c:

[0056] a. Constructing an expression vector comprising a merB gene sequence and a promoter operably linked to the merB gene sequence, optionally, the promoter is P petE and / or P rbcL , which were amplified from the cyanobacterium Synechocystis sp. PCC6803;

[0057] b. introducing the expression vector into a host cell such as a phytoplankton host cyanobacteria;

[0058] c. Take positive colonies for colony PCR and sequence verification to obtain recombinant phytoplankton.

[0059] According to the embodiments of the present invention, cyanobacteria were selected as hosts. They possess efficient photosynthetic carbon fixation, naturally transform exogenous DNA, and have established mature genetic manipulation tools (such as the CRISPR activation system and adaptive evolution techniques), and high-density culture has been achieved, providing a foundation for large-scale production of engineered bacteria for mercury degradation. By introducing a promoter-linked expression vector into cyanobacteria, recombinant phytoplankton for mercury degradation can be quickly, easily, and large-scale produced.

[0060] In some specific embodiments of the present invention, the expression vector can be introduced into the host cell by natural transformation, chemical transformation, electroporation, CRISPR-Cas system, etc., and the present invention does not impose specific limitations on this.

[0061] According to another embodiment of the present invention, an expression vector is provided, comprising a methylmercury lyase gene merB having a base sequence as shown in SEQ ID No. 1 and a promoter operably linked to the merB gene sequence, wherein the promoter comprises P petE and P rbcL .

[0062] According to another embodiment of the present invention, applicable treatment environments include water environments, rice fields, mine wastewater, etc.

[0063] According to another embodiment of the present invention, the methylmercury concentration in the environment is in the range of 0.001 to 10 ng / mL, and the strain concentration is 10 7 / mL or higher.

[0064] According to another embodiment of the present invention, based on the 6803-PEB strain, the copper ion concentration range is

[0065] According to another embodiment of the present invention, a methylmercury degrading agent comprising recombinant phytoplankton is provided.

[0066] According to an embodiment of the present invention, the formulation of the microbial agent may be in a variety of forms, including but not limited to liquid, emulsion, suspension, powder, granule, wettable powder or water-dispersible granule, etc., and may also include other auxiliary ingredients such as carriers for preparing the microbial agent, such as cross-linking agents, adhesives, etc.

[0067] According to another embodiment of the present invention, a method for degrading methylmercury is provided, comprising applying recombinant phytoplankton or a methylmercury degrading agent to an environment to be treated. Optionally, the environment to be treated comprises an aquatic environment or an aquatic environment such as a rice field or a mine, including the organisms involved therein.

[0068] According to an embodiment of the present invention, the method for degrading methylmercury further includes: allowing an organism to ingest the recombinant phytoplankton to reduce the methylmercury content in the organism. According to an embodiment of the present invention, the recombinant phytoplankton can rapidly degrade methylmercury in culture medium compared to wild-type phytoplankton; it has a better degradation effect on methylmercury in actual water bodies; feeding it to fish can reduce the accumulation of methylmercury and total mercury in the fish, and reduce the accumulation and transfer of mercury along the food chain through the food chain. The recombinant phytoplankton of the present invention can be used to reduce methylmercury in the environment and in organisms, such as water bodies and fish.

[0069] Specifically, filter-feeding fish in water bodies, such as silver carp and bighead carp, can directly consume phytoplankton, thereby reducing the accumulation of methylmercury and total mercury in the fish's bodies; or zooplankton in water bodies can directly consume phytoplankton as secondary consumers, such as copepods as fish bait, and reconstituted phytoplankton can reduce the mercury load in their bodies and block the amplification effect of the food chain; or shellfish and benthic organisms in water bodies, such as filter-feeding shellfish (clams, oysters, etc.) can filter water and consume phytoplankton, which can synergistically purify the water and reduce their own mercury enrichment; benthic insect larvae (such as chironomid larvae) can feed on settled algae debris, becoming an important intermediate link in the fish food chain, etc.

[0070] The present invention will be further explained below with reference to specific examples. Unless otherwise stated in the following examples, conventional commercial reagents are used.

[0071] Example 1 Construction of a recombinant strain capable of degrading methylmercury

[0072] (1) The merB gene sequence (SEQ ID NO.1) was combined with the promoter P petE and P rbcL The exchange site slr0168 was connected to the pUC18 vector plasmid by homologous recombination, wherein the promoter and site genes were amplified from Synechocystis sp. PCC 6803 using primers;

[0073] (2) The primers used in the present invention are shown in Table 1 below:

[0074] Table 1. Primer sequences

[0075] Sequence ID (SEQ ID No.) Primer Sequence 2 pUC18-R ACCGAGCTCGAATTCGTAATC 3 pUC18-F ACCCGGGGATCCTCTAGAGTC 4 slr0168-N-F ACTCTAGAGGATCCCCGGGTGGATCCTGGGCTTCGGCT 5 slr0168-N-R TTTTTATTTTAATTCCCATATAACCATCAAAGCCA 6 <![CDATA[Sp r -F]]> TATGGGAATTAAAATAAAAAAGGGGACCTCTAGGG 7 <![CDATA[Sp r -PpetE-R]]> TTTTTATTTTAAATAAAAAAGGGGACCTCTAGGG 8 PpetE-F TTTTTTATTTAAAATAAAAAAGGGGACCTCTAGGG 9 PpetE-R CGAGCTTCATAAATAAAAAAGGGGACCTCTAGGG 10 merB-F TTTTTTATTTATGAAGCTCGCCCCATATATTTTAG 11 merB-R CGCTCAGCTGTCACGGTGTCCTAGATGACATGG 12 slr0168-C-PpetE-F GACACCGTGACAGCTGAGCGCCGGTCGC 13 slr0168-C-R ATTACGAATTCGAGCTCGGTGGATC1CATCAAAAAAGGCTTCCCG 14 <![CDATA[Sp r -PrbcL-R]]> ACTTCATCGGAAATAAAAAAGGGGACCTCTAGGG 15 PrbcL-R TTTTTTATTTCCGATGAAGTGGTGGAGC 16 PrbcL-F CGAGCTTCATGGTCAGTCCTCCATAAACATTG 17 PrbcL-merB-F AGGACTGACCATGAAGCTCGCCCCATATATTTTAG 18 Test1 CGGTGGATGACCTTTTGAATGAC 19 Test2 GGGAATTAGCTTGCATGCC 20 Test3 AGAGGTCCCCTTTTTTATTTACCCCTGATTAGCTTTGCGG 21 Test4 CACCATTTCCAAAGGAGTACTGTCCAACACTGTGCC

[0076] (3) The gene sequence of the MerB protein used in the present invention is shown in SEQ ID NO: 1;

[0077] Step 2. Construction of recombinant cyanobacteria capable of degrading methylmercury

[0078] Synechocystis PCC 6803 was selected as a model organism for cyanobacteria, and the constructed plasmid was introduced by natural transformation. The specific transformation steps are as follows:

[0079] (1) Cyanobacteria PCC 6803 was cultured in advance until the absorbance at OD730 nm was around 0.5;

[0080] (2) Centrifuge the strain at 3000 g for 10 min, remove the supernatant, add fresh BG11 medium to wash twice, and then resuspend in fresh BG11 medium to make the OD 730 About 2.5;

[0081] (3) Take 0.5 mL of the above bacterial solution and place it in a sterile EP tube. Add about 10 μg of plasmid and mix gently. Keep it in the dark for 6 h, shaking it gently every 3 h.

[0082] (4) Use a micropipette to draw up the mixed bacterial solution and apply it to a nitrocellulose membrane attached to an antibiotic-free BG11 agar plate. Restore the culture at 25°C and 2500 lux for 24 h.

[0083] (5) Transfer the nitrocellulose membrane spotted with the bacterial solution to a solid plate containing 40 μg / mL of BG11. Transformants will be visible after about 1-2 weeks. Continue to observe daily and remove any evaporated liquid in time to prevent contamination by other bacteria.

[0084] (6) Pick about 12 single colonies and perform colony PCR to verify the molecular weight. Select the plasmid with the correct molecular weight and sequence it at Sangon Biotech Company. Then transfer it to fresh BG11 medium for culture.

[0085] According to two different promoters P petE and P rbcL The recombinant strains prepared were named Synechocystis sp. PCC 6803 △slr0168::PpetE-merB-Sp r (6803-PEB) and Synechocystis sp. PCC 6803 △slr0168::PrbcL-merB-Sp r (6803-PLB).

[0086] Example 2 Testing the ability of recombinant strains to degrade methylmercury in culture medium

[0087] Step 1. Prepare the recombinant strain seed solution

[0088] (1) The recombinant strains 6803-PEB and 6803-PLB constructed in Example 1 were streaked from the plate medium and added to 20 mL of fresh BG11 liquid medium. 40 μg L -1 Spectinomycin antibiotic, culture at 25°C, 160 rpm, 2500 Lux to logarithmic phase;

[0089] (2) Take the bacterial suspension in (1) above and transfer it to fresh BG11 medium at a 1% inoculum volume, and add 40 μg / L -1 Spectacular antibiotics, culture at 25°C, 160 rpm, 2500 Lux to OD730 = 0.4;

[0090] (3) Take the bacterial suspension in (2) above, centrifuge at 3000 rpm for 10 min, discard the supernatant, and resuspend the bacteria in a certain amount of fresh BG11 medium to obtain the seed solution of the recombinant cyanobacterium strain that degrades methylmercury for testing;

[0091] Step 2. Functional testing of the recombinant strain to degrade methylmercury in the culture medium

[0092] (1) Take 1 mL of recombinant strain seed solution, add 0.01 mL of 1 mg / L mercury standard solution and add fresh BG11 to make the volume to 10 mL, so that the final concentration of the strain is 1×10 7 cells / mL, methylmercury concentration 1 ng / mL.

[0093] (2) After exposure to the BG11 system for 24 hours, the strain was centrifuged at 9055 g for 10 minutes to separate the bacterial cells and the supernatant, and the methylmercury content in each of them was determined. The methylmercury in the culture medium was determined by digestion with potassium bromide / sulfuric acid / copper sulfate and extraction with dichloromethane. The digestion of the bacterial cells was carried out according to the U.S. Environmental Protection Agency's standard method for methylmercury test EPA1630, using potassium hydroxide / methanol for room temperature digestion. The methylmercury in the digested sample was derivatized with sodium tetraethylborate reagent and then captured by TENAX tube and determined by cold atomic fluorescence spectrometry. At the same time, the wild-type cyanobacterium Synechocystis sp. PCC 6803 was used as a control group to evaluate the methylmercury degradation effect of the recombinant strain. The results are shown in Figure 2. Figure 2 shown.

[0094] Figure 1 This is a comparison of the results of methylmercury degradation by the recombinant strains and wild-type strains of the present invention. The degradation effect of methylmercury in medium BG11 by the recombinant strains 6803-PEB and 6803-PLB, inoculation amount: 1×10 7 cells / mL, degradation time: 24 hours, initial methylmercury concentration: 1 ng / mL.

[0095] according to Figure 1 As can be seen, the degradation and removal efficiencies of the recombinant cyanobacterial strains 6803-PEB and 6803-PLB were 83.1%, and 85.0%, respectively, indicating that both recombinant cyanobacteria could degrade methylmercury. The control strain group removed more than 103.6% of the methylmercury, indicating that methylmercury is absorbed by the bacteria after addition to the solution. MerB, an intracellular protein, facilitates its uptake and degradation by the recombinant strains.

[0096] 3) Determination of the ability of recombinant strains 6803-PEB and 6803-PLB to degrade methylmercury in lake water. Methylmercury concentration: 1 ng / mL; degradation time: 24 hours; inoculum size: 1×10 7 cells / mL, the results are as followsFigure 2 shown.

[0097] Figure 2 This is a comparison chart of the results of methylmercury degradation in lake water by an embodiment of the present invention. A shows the degradation of methylmercury in lake water, and B shows the degradation of methylmercury in lake water with copper sulfate added.

[0098] according to Figure 2 As can be seen, after a 24-hour exposure period, strain 6803-PLB degraded 86.7% of the MeHg in the lake water. Strain 6803-PEB achieved a MeHg degradation efficiency of approximately 69.7%, significantly lower than that of strain 6803-PEB against MeHg in culture medium. However, after adding 700 nmol / L of copper sulfate to the lake water, the MeHg degradation efficiency of strain 6803-PEB increased to 86.5%. The MeHg degradation efficiency of strain 6803-PLB was unaffected by copper ion concentration. These experimental results demonstrate that both strains 6803-PLB and 6803-PEB can effectively degrade MeHg in natural waters, with the degradation efficiency of strain 6803-PEB being affected by copper ion concentration.

[0099] 4) Determination of the ability of the recombinant strain 6803-PLB to degrade different concentrations of methylmercury in lake water. Degradation time: 24 hours; inoculum dose: 1×10 7 cells / mL, the results are as follows Figure 3 shown.

[0100] Figure 3 This is a diagram showing the effect of the recombinant strain 6803-PLB in the present invention on degrading methylmercury in lake water.

[0101] according to Figure 3 As can be seen, strain 6803-PLB achieved a degradation rate of 79.0% for MeHg concentrations as low as 0.001 ng / mL in lake water, and 88.1% to 93.1% for MeHg concentrations between 0.01 and 1 ng / mL. However, at 10 ng / mL, the strain's degradation efficiency was limited, reaching a degradation rate of 67.4%. This is likely due to the toxicity of high concentrations of MeHg to the strain, which can affect its growth. Meanwhile, the wild-type strain showed no significant reduction in MeHg, with the remaining MeHg content ranging from 88.2% to 99.8%. These experimental results demonstrate that strain 6803-PLB can still effectively degrade MeHg at various concentrations in natural waters.

[0102] Example 3 Evaluation of the effect of the recombinant strain 6803-PLB on reducing mercury accumulation in fish

[0103] The evaluation of the effect of the recombinant cyanobacterium strain 6803-PLB on mercury accumulation in fish in this example includes the following steps:

[0104] Step 1. Fish domestication

[0105] (1) Silver carp purchased from Qiqiang Fishery Group were domesticated. In the first stage, the fry were not fed, so that the silver carp gradually adapted to the laboratory environment. During this stage, except for the first three days when the fry had obvious defecation, there was almost no obvious feces observed afterwards. The second stage was the cyanobacteria feeding and domestication stage (5 days). Six fry of uniform size were selected and transferred to a fish tank (50 cm×26 cm×30 cm) containing 3 L of aerated water. During this stage, 30 mL of algae solution (algae solution concentration was 1×10 9 / mL), the defecation of the fry can be observed 2 to 4 hours after adding the algae solution, proving that they have taken the algae as food.

[0106] (2) Feeding silver carp with MeHg-exposed algae solution. After 1 ng / mL of MeHg was added to 6803-PLB or wild-type cyanobacteria and exposed for 24 hours, 30 mL of algae solution was directly added to the fish tank to feed the fry. At this time, the algae concentration in the water was 10 7 After 14 days of feeding, the silver carp were removed and rinsed with ultrapure water for about 3 minutes. After freeze-drying at -40°C, the body length and weight of the silver carp were measured and recorded. The fish were then ground using a grinder for analysis of MeHg and total mercury in the fish. The results are as follows: shown.

[0107] Figure 4 This is a graph showing changes in mercury levels in silver carp when the recombinant strain 6803-PLB was used as a food source. A shows changes in methylmercury concentration, and B shows changes in total mercury concentration. The exposure period was 14 days, the methylmercury concentration in the bacterial solution was 1 ng / mL, and the strain concentration was 3×10 9 Each group contained 6 fish.

[0108] according to Figure 4 Figure 4 As can be seen, the MeHg content in the fish fed with the 6803-PLB strain was 38.9 ± 3.0 μg / kg, while the MeHg content in the fish fed with the wild-type strain was 107 ± 9.4 μg / kg. Compared with the group fed with the wild-type strain, the MeHg content in the fish fed with the 6803-PLB strain was reduced by 63.6%. The total mercury content in the fish fed with the 6803-PLB strain was 73.1 ± 10.7 μg / kg, while the MeHg content in the fish fed with the wild-type strain was 132 ± 13.4 μg / kg. Compared with the group fed with the wild-type strain, the total mercury content in the fish fed with the 6803-PLB strain was reduced by 55.4%.

[0109] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for enhancing the ability of phytoplankton to degrade methylmercury, comprising the step of causing the phytoplankton to overexpress the methylmercury lyase gene merB.

2. The method according to claim 1, wherein: The base sequence of the methylmercury lyase gene merB is shown in SEQ ID No. 1; The phytoplankton includes eukaryotic algae and / or prokaryotic algae, preferably cyanobacteria.

3. Reconstruction of phytoplankton, The recombinant phytoplankton comprises a methylmercury lyase gene merB whose base sequence is shown in SEQ ID No. 1 and a promoter operably connected to the merB gene sequence, wherein the promoter comprises P petE and / or P rbcL .

4. The recombinant phytoplankton according to claim 3, wherein the phytoplankton is a prokaryotic cyanobacteria, and the recombinant phytoplankton comprises P petE Synechocystis sp. PCC 6803 △slr0168::PpetE-merB-Sp promoter r Deposited in China Center for Type Culture Collection with the accession number CCTCC M 20251153 and / or P rbcL Synechocystis sp. PCC 6803 △slr0168::PrbcL-merB-Sp promoter r It is deposited in China Center for Type Culture Collection with the accession number CCTCC M 20251152.

5. A method for preparing recombinant phytoplankton for degrading methylmercury, comprising: a. Constructing an expression vector comprising a merB gene sequence and a promoter operably linked to the merB gene sequence, optionally, the promoter is P petE and / or P rbcL , which were amplified from the cyanobacterium Synechocystis sp. PCC 6803; b. introducing the expression vector into a host cell such as a phytoplankton host cyanobacteria; c. Take positive colonies for colony PCR and sequence verification to obtain recombinant phytoplankton.

6. An expression vector comprising a methylmercury lyase gene merB having a base sequence as shown in SEQ ID No. 1 and a promoter operably linked to the merB gene sequence, wherein the promoter comprises P petE and P rbcL .

7. A methylmercury degrading agent comprising the recombinant phytoplankton according to any one of claims 3 to 4.

8. A method for degrading methylmercury, comprising applying the recombinant phytoplankton according to any one of claims 3 to 6 or the methylmercury degrading agent according to claim 7 to an environment to be treated, wherein the environment to be treated comprises an aquatic environment or an aquatic environment such as a rice field or a mine, including the organisms involved therein.

9. The method according to claim 8, further comprising: The organism is allowed to ingest the recombinant phytoplankton to reduce the methylmercury content in the organism.

Images