Recombinant bacterium for improving yield of alpha-bisabolol as well as preparation method and application of recombinant bacterium
By constructing a recombinant strain expressing artichoke α-bisabolol synthase and optimizing fermentation conditions, the problems of low α-bisabolol yield and poor organic solvent tolerance in traditional methods were solved, achieving efficient and environmentally friendly biosynthesis with a yield of 56.53 g/L.
Patent Information
- Application Number
- CN202511770218.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-02-13
AI Technical Summary
Traditional plant extraction and chemical synthesis methods cannot meet the market demand for α-bisabolol, and the host microorganisms are intolerant to organic solvents during the biphasic extraction and fermentation process, resulting in a decrease in yield.
A recombinant strain was constructed, and the α-bisabolol synthase CcBOS gene and related enzyme system of artichoke were overexpressed. Fermentation conditions were optimized, and α-bisabolol was efficiently synthesized through Escherichia coli BL21(DE3).
The yield of α-bisabolol was increased to 56.53 g/L, which is higher than the highest yield reported in existing literature (72.3%), and the tolerance to organic solvents was enhanced, giving it the advantage of green and environmentally friendly production.
Smart Images

Figure CN121518359A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a recombinant strain that increases the yield of α-bisabolol, its preparation method, and its application. Background Technology
[0002] Bisabolol, molecular formula C 15 H 26 O is a monocyclic sesquiterpene alcohol extracted from plants such as chamomile. It has two configurations, α and β, and is a colorless or pale yellow oily liquid at room temperature with a density of approximately [insert density here]. Alpha-bisabolol possesses high stability and is naturally non-toxic. It exhibits anti-inflammatory, antibacterial, soothing, and skin-brightening effects. It can reduce tissue edema and inflammatory responses caused by inflammatory mediators by inhibiting the release of inflammatory factors; activate the proliferation of keratinocytes in the skin, enhance the function of the sebum film, promote the repair of the skin barrier, and maintain water-oil balance, thereby enhancing the skin's defense capabilities; it has natural antioxidant activity, which can eliminate free radicals induced by ultraviolet rays and environmental factors, reducing damage to the skin and slowing down skin aging; it can inhibit the growth of bacteria (such as Staphylococcus aureus) and fungi, reducing the risk of skin infections, and has an adjunctive therapeutic effect on skin conditions such as acne and eczema. Therefore, alpha-bisabolol is widely used in skincare products, pharmaceuticals, and food, especially in the high-end skincare market, where it has become one of the preferred ingredients for consumers seeking healthy and natural skincare. Its market prospects are broad, with a global market value reaching US$24.6 billion in 2023 and showing a continuous growth trend.
[0003] Traditional plant extraction methods are increasingly unable to meet market demand for α-bisabolol; while chemical synthesis of α-bisabolol requires specialized equipment, involves complex steps, high energy consumption, and is prone to pollution. With the development of genetic engineering and synthetic biology, it has become possible to synthesize terpenoids using engineered microorganisms. However, some host microorganisms (such as *Escherichia coli*) exhibit intolerance to organic solvents (such as dodecane) during biphasic extraction fermentation, leading to reduced cell density and yield. Summary of the Invention
[0004] The purpose of this invention is to increase the yield of α-bisabolol and enhance the host's tolerance to organic solvents.
[0005] This invention provides a recombinant bacterium that increases the yield of α-bisabolol. The recombinant bacterium is obtained by overexpressing the following genes: acetyl-CoA acyltransferase / HMG-CoA reductase mvaE, HMG-CoA synthase mvaS, 2-methylcitrate dehydratase prpD, mevalonate kinase ERG12, mevalonate-5-phosphate kinase ERG8, mevalonate-5-bisphosphate decarboxylase ERG19, isopentenyl diphosphate isomerase idi, farnesyl diphosphate synthase ispA, and artichoke α-bisabolol synthase CcBOS.
[0006] To further specify, the originating bacterium is BL21(DE3).
[0007] To further specify, the α-bisabolol synthase CcBOS gene of artichoke is shown in SEQ ID No: 1.
[0008] This invention provides a method for increasing the yield of α-bisabolol. A recombinant vector overexpressing the α-bisabolol synthase CcBOS gene of artichoke is co-expressed with a recombinant vector overexpressing the acetyl-CoA acyltransferase / HMG-CoA reductase mvaE gene, the HMG-CoA synthase mvaS gene, the 2-methylcitrate dehydratase prpD gene, the mevalonate kinase ERG12 gene, the mevalonate-5-phosphate kinase ERG8 gene, the mevalonate-5-bisphosphate decarboxylase ERG19 gene, the isopentenyl diphosphate isomerase idi gene, and the farnesyl diphosphate synthase ispA gene in *Escherichia coli* to obtain recombinant microbial cells, which are then fermented.
[0009] To further specify, the method for obtaining farnesyl pyrophosphate is as follows: the starting microorganism for the recombinant microbial cells is BL21(DE3).
[0010] This invention provides a method for constructing the above-mentioned recombinant bacteria, characterized in that the steps are as follows: 1) Construction of plasmid pET28a-CcBOS-ispA-idi: The vector fragment pET28a-ispA-idi containing the ispA gene and the idi gene, and the CcBOS gene fragment were amplified by PCR, respectively. The pET28a-CcBOS-ispA-idi plasmid was constructed by seamless cloning. 2) Construction of plasmid pACYC-mvaE-mvaS-prpD: The prpD gene fragment was amplified by PCR and ligated between the BglII and XhoI sites of the vector pACYC-mvaE-mvaS by enzyme digestion and ligation to obtain the pACYC-mvaE-mvaS-prpD plasmid. 3) Plasmid transformation: The plasmid pTrcLower-∆IDI containing the ERG12, ERG8, and ERG19 genes was co-transformed with the plasmids pET28a-CcBOS-ispA-idi and pACYC-mvaE-mvaS-prpD constructed above into competent Escherichia coli cells to obtain recombinant bacteria that synthesize α-bisabolol.
[0011] This invention provides an application of the above-mentioned recombinant bacteria in increasing the yield of α-bisabolol.
[0012] This invention provides a method to increase the yield of α-bisabolol by adding the above-mentioned recombinant bacteria to a fermenter for fermentation.
[0013] Further restrictions were placed on the fermentation conditions: 30°C, fermentation time: 119 hours.
[0014] Further specifying, after the recombinant bacteria are cultured in a primary seed culture medium and a secondary seed culture medium in sequence, the resulting seed liquid is inoculated into the fermenter culture medium for batch fed fermentation to obtain α-bisabolol.
[0015] Beneficial effects: 1. Based on the previously constructed high-yield terpene platform, this invention obtained a recombinant strain with high α-bisabolol production by introducing α-bisabolol synthase from artichoke; the strain's tolerance to the extractant dodecane was enhanced by overexpressing the 2-methylcitrate dehydratase prpD gene; and the fermentation technology was further optimized. The yield of α-bisabolol reached 56.53 g / L after 119 h of fermentation in a 5 L fermenter, which is the highest yield of α-bisabolol produced by biosynthesis to date, exceeding the highest yield reported in the literature (32.8 g / L) by 72.3%.
[0016] 2. The method of this invention has the advantages of short growth and fermentation cycle, low cultivation cost, and simple genetic operation, which reduces the risk of microbial contamination caused by long fermentation cycle and further improves the yield of α-bisabolol by biological method. The α-bisabolol produced has the advantages of high purity and non-toxicity. Compared with plant extraction and chemical synthesis, it is a greener, more environmentally friendly and sustainable production method, which is more conducive to promoting the industrialization process of α-bisabolol by biological method. Attached Figure Description
[0017] Figure 1 This describes the synthetic route of α-bisabolol. Figure 2 . is the pET28a-CcBOS-ispA-idi plasmid map; Figure 3 . is the pACYC-mvaE-mvaS-prpD plasmid map; Figure 4The graph shows the yield of α-bisabolol from a 5 L fermenter, with the x-axis representing fermentation time (h) and the y-axis representing α-bisabolol yield (g / L). Figure 5 The x-axis represents the yield of α-bisabolol during shake-flask fermentation, with the x-axis representing recombinant strains containing different bisabolol synthases and the y-axis representing the yield of α-bisabolol (g / L). Figure 6 The x-axis represents the yield of α-bisabolol fermented in a 5 L fermenter (for strains that do not additionally overexpress prpD), with fermentation time (h) on the x-axis and α-bisabolol yield (g / L) on the y-axis. Detailed Implementation
[0018] The plasmids pACYCDuet-1, pTrcHIS2b, pET28a, Escherichia coli BL21(DE3) competent cells, primers and reagents used in the examples can all be obtained commercially or by conventional means known to those skilled in the art.
[0019] in: The ClonExpress II One Step Cloning Kit was purchased from Novizan, product number: C112.
[0020] DNA polymerase premix PrimeSATR Max Premix, restriction endonuclease Bgl II and Xho Both I and T4 DNA ligase were purchased from TaKaRa.
[0021] Primers were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd.
[0022] E. coli trans 1-T1 and BL21(DE3) were purchased from Beijing TransGen Biotech Co., Ltd.
[0023] Cm represents chloramphenicol; Kan represents kanamycin; Amp represents ampicillin. The strain provided in this invention is *Escherichia coli* (…). Escherichia coli BL21(DE3) contains the plasmids pACYC-mvaE-mvaS-prpD, pTrcLower-ΔIDI, and pET28a-CcBOS-ispA-idi. The first plasmid was constructed using an enzyme digestion and ligation method, and the third plasmid was constructed using a seamless cloning method.
[0024] The synthetic route for α-bisabolol constructed in this invention is shown in the appendix. Figure 1As shown, this pathway consists of genes mvaE, mvaS, ERG12, ERG8, ERG19, idi, ispA, CcBOS, and the MEP pathway of E. coli itself. Among these, acetyl-CoA acyltransferase / HMG-CoA reductase... mvaE A gene is a single copy, and it can catalyze two reactions.
[0025] Example 1. Method for constructing a recombinant strain that produces high levels of α-bisabolol.
[0026] 1) Construction of plasmid pET28a-CcBOS-ispA-idi: Using plasmid pET28a-AaFS-ispA-idi (described in CN111607546A, "A Genetically Engineered Bacterium Producing High Farnesene and Its Construction Method and Application") as a template, the vector sequence pET28a-ispA-idi (sequence shown in SEQ ID NO.3) was amplified using upstream primer 28a-IspAIDI-F (sequence shown in SEQ ID NO.3) and downstream primer npET28a-R (sequence shown in SEQ ID NO.4), excluding the AaFS fragment. α-Bisabolol synthase from artichokes. CcBOS The gene was optimized based on the codon bias of *E. coli*, synthesized by the company (the synthesized sequence is shown in SEQ ID NO.1), and cloned into the pUC57-simple vector to obtain the plasmid pUC57-CcBOS. Using plasmid pUC57-CcBOS as a template, amplification was performed using the upstream primer GA-CcBOS-F (sequence shown in SEQ ID NO.5) and the downstream primer GA-CcBOS-R (sequence shown in SEQ ID NO.6). CcBOS Gene fragments.
[0027] SEQ ID NO.3: 28a-IspAIDI-F: AGGAGGTTAATTGGATGGACTTTCCGCAG; SEQ ID NO.4: npET28a-R: GGTATATCTCCTTCTTAAAGTTAAAC; SEQ ID NO. 5: GA-CcBOS-F: ttaagaaggagatataccATGAGTAACTTTTTAGTGTCTACCTGC; SEQ ID NO.6: GA-CcBOS-R: ccatccaattaacctcctTTAAATAAGCGGATGAACAAGAAGAG; The PCR system is as follows:
[0028] The PCR products were subjected to agarose gel electrophoresis, and the approximately 6756 bp pET28a-ispA-idi vector fragment and the approximately 1707 bp fragment were recovered from the gel. CcBOS Fragments. The concentration of the gel-recovered product was determined. Two fragments were ligated using the ClonExpress II One Step Cloning Kit. The fragment ratios and amounts of each component were calculated according to the instructions. The ligation reaction was carried out at 37°C for 30 min. An appropriate amount of product was then thermally shocked for conversion. trans 1-T1 competent cells were plated on LB agar plates (Kan) and incubated overnight at 37°C. The next day, colony counts were observed on the plates. Single colonies were picked and transferred to LB liquid medium (Kan), incubated at 37°C until a high concentration was achieved, and colony PCR or plasmid extraction and restriction enzyme digestion were performed for identification. The samples were then sent for sequencing to obtain the plasmid pET28a-CcBOS-ispA-idi. Figure 2 ).
[0029] SEQ ID NO.1
[0030] 2) Construction of plasmid pACYC-mvaE-mvaS-prpD The plasmid pACYC-mvaE-mvaS-prpD was constructed using an enzyme digestion and ligation method. First, primers prpD-BglII-F and prpD-XhoI-R were used, with BL21(DE3) bacterial culture as a template, to amplify plasmids containing ligation enzymes at both ends. Bgl II and Xho I restriction site prpD Gene fragments. Then, restriction endonucleases are used. Bgl II and Xho I. Double enzyme digestion prpD The gene fragment and vector plasmid pACYC-mvaE-mvaS (described in the article "Metabolic engineering of Escherichia coli for high-specificity production of isoprenol and prenol as next generation of biofuels, Biotechnology for Biofuels," obtained by ligating the mvaE and mvaS genes into the vector pACYCDuet-1) were digested using the following enzyme digestion system: gel recovery product / plasmid 40 μL / 20 μL; 10× buffer 5 μL; Bgl II 2.5 μL; Xho I 2.5 μL; H2O 20 μL; total volume 50 μL, digestion at 37℃ for 2 h; The enzyme digestion products were subjected to agarose gel electrophoresis, and the approximately 7522 bp pACYC-mvaE-mvaS vector fragment and the approximately 1452 bp fragment were recovered separately. prpD The fragments and recovered products were ligated using T4 DNA ligase. The ligation system was as follows: 4 μL vector; 4.5 μL insert fragment; 1 μL 10× buffer; 0.5 μL T4 DNA ligase; total volume 10 μL. The reaction was carried out at room temperature for 2 h and then overnight at 4°C. All the connecting products were converted trans 1-T1 competent cells were plated on LB agar plates (Cm) and incubated overnight at 37°C. The next day, colony counts were observed on the plates. Single colonies were picked and transferred to LB liquid medium (Cm) and incubated at 37°C until a high concentration was achieved. Colony PCR identification or plasmid extraction and restriction enzyme digestion identification were performed, and the samples were sent for sequencing to obtain the plasmid pACYC-mvaE-mvaS-prpD (…). Figure 3 ).
[0031] prpD-BglII-F:gaagatctaATGTCAGCTCAAATCAACAACATCC(SEQ ID NO.13)) prpD-XhoI-R:ccgctcgagTTAAATGACGTACAGGTCGAGATACTC(SEQ ID NO.14) prpD Page ID:SEQ ID NO.15 3) Plasmid transformation: The correctly sequenced plasmids pET28a-CcBOS-ispA-idi and pACYC-mvaE-mvaS-prpD, along with the yeast isopentenyl diphosphate isomerase ScIDI gene knocked out in the pTrcLower vector, yielded the plasmid pTrcLower-ΔIDI containing the ERG12, ERG8, and ERG19 genes (described in CN111607546A A genetically engineered bacterium producing high farnesene and its construction method and application). This plasmid was then co-transformed with... E. coli BL21(DE3) competent cells were plated on LB agar plates containing the corresponding three antibodies (Amp, Kan, and Cm), with the final concentrations of Cm, Amp, and Kan in the LB agar being 34 mg / L, 100 mg / L, and 50 mg / L, respectively. The cells were incubated at 37°C until single colonies appeared, thus obtaining the recombinant bacteria that synthesize α-bisabolol.
[0032] The recombinant strain that synthesizes α-bisabolol was obtained using the above construction method, and overexpressed acetyl-CoA acyltransferase / HMG-CoA reductase. mvaE Genes, HMG-CoA synthase mvaS Gene, 2-methylcitrate dehydratase prpD Gene, mevalonate-5-phosphate kinase ERG8 Gene, mevalonate kinase ERG12 Gene, mevalonate-5-bisphosphate decarboxylase ERG19 Genes, isopentenyl diphosphate isomerase idi Genes, farnesyl diphosphate synthase ispA Genes and α-bisabolol synthase gene CcBOS .
[0033] Example 2. Application of the recombinant bacteria constructed in Example 1 in the fermentation synthesis of α-bisabolol in a fermenter.
[0034] In this embodiment, gas chromatography was used for the quantitative detection of α-bisabolol. An Agilent DB-5MS (30 m × 0.25 mm × 0.25 μm) capillary column was used. The column temperature program was as follows: initial temperature of 80℃ for 1 min, increased to 250℃ at a rate of 10℃ / min and held for 1 min, then increased to 300℃ at a rate of 30℃ / min and held for 1 min. A standard curve was prepared using α-bisabolol standards for quantification.
[0035] In this embodiment, the primary seed culture medium is LB medium, which consists of 10 g / L NaCl, 10 g / L peptone, 5 g / L yeast extract, and the remainder is water.
[0036] The secondary seed culture medium (fermentation medium) consists of: 20 g / L glucose, 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 0.06 g / L MgSO₄, and 1 mL / L trace element solution, wherein the trace element solution contains (NH₄)₆Mo₇O₇. 24 The concentrations of the following components are: 0.37 g / L of 4H₂O, 0.29 g / L of ZnSO₄·7H₂O, 2.47 g / L of H₃BO₃, 0.25 g / L of CuSO₄·5H₂O, and 1.58 g / L of MnCl₂·4H₂O.
[0037] The fermenter culture medium is based on the secondary seed culture medium, with the trace element solution changed to 1.5 mL / L, and 1 g / L betaine and 3 g / L ammonium sulfate added. Furthermore, the carbon source is not limited to glucose; other carbon sources such as biomass hydrolysate can be used.
[0038] The composition of the feed medium is: 70% glucose (final mass concentration).
[0039] Taking fermentation in a fermenter as an example, the application of the recombinant bacteria constructed in Example 1 in the synthesis of α-bisabolol is described.
[0040] A single colony of the recombinant bacteria containing CcBOS obtained in Example 1 was inoculated into 5 mL of LB medium containing the corresponding antibiotics (Cm / Amp / Kan) and cultured at 37°C and 200 rpm for 8–12 h to obtain the primary seed culture. 1 mL of the primary seed culture was transferred to 100 mL of fermentation medium and cultured overnight at 37°C and 200 rpm for 8–12 h to obtain the secondary seed culture. 2 L of fermentation medium was prepared in a 5 L fermenter. The pH was calibrated with a standard solution using a pH electrode. The temperature electrode, pH electrode, and dissolved oxygen electrode were wrapped in aluminum foil and autoclaved together at 115°C for 30 min. After sterilization, air, condensate, the temperature electrode, pH electrode, and dissolved oxygen electrode were connected, and the temperature was adjusted to 37°C. After the temperature stabilizes, add 2 mL of antibiotics (1 / 1000), 3 mL of trace elements (1.5 mL / L), and glucose (20 g / L). Introduce 200 mL of the secondary seed culture into the fermenter, setting the pH to 6.9 and the fermentation speed to be correlated with dissolved oxygen. The initial sugars are consumed in approximately 8-13 hours. Feed is then added at a rate of 7%, and the fermentation time is adjusted according to OD. 600When the temperature is between 35 and 40°C, set it to 30°C. After the temperature stabilizes (cooling process takes about 1 hour), add IPTG to a final concentration of 0.1 mM, and add 400 mL (20%) of dodecane as the extraction agent. Adjust the feed rate, aeration rate, and rotation speed according to changes in fermentation parameters, and discharge the fermenter after 119 hours. Take samples every 12 hours to measure OD. 600 The yield of α-bisabolol. (See attached image.) Figure 4 As shown, after 119 h of fermentation, the yield of α-bisabolol reached 56.53 g / L, which is higher than the highest yield of α-bisabolol reported in the literature for fermenter-level synthesis (32.8 g / L). (Zhang N, Huang Z, Li H, Li C, Xu J. 2025. Reprogramming) Komagataella phaffii for arobust chassis toward efficient de novo biosynthesis of (-)-α-bisabolol . Journal of Agricultural and Food Chemistry. 73:8381-8390) was 72.3% higher.
[0041] Comparative Example 1. 1) Contains pyrethrum ( Tanacetum cinerariifolium ) or Atractylodes lancea ( Atractylodes lancea Construction of the plasmids pET28a-TcBOS-ispA-idi and pET28a-AlBOS-ispA-idi for myrrh synthase: The α-bimethanil synthase TcBOS gene (synthesized sequence as shown in SEQ ID NO. 7) from pyrethrum and the α-bimethanil synthase AlBOS gene (synthesized sequence as shown in SEQ ID NO. 8) from Atractylodes lancea were optimized according to the codon preference of Escherichia coli, synthesized by the company, and cloned into the pUC57-simple vector to obtain plasmids pUC57-TcBOS and pUC57-AlBOS. Using plasmids pUC57-TcBOS and pUC57-AlBOS as templates, the TcBOS gene fragment was amplified using upstream primer GA-TcBOS-F (sequence as shown in SEQ ID NO. 9) and downstream primer GA-TcBOS-R (sequence as shown in SEQ ID NO. 10), respectively. The AlBOS gene fragment was amplified using upstream primer GA-AlBOS-F (sequence as shown in SEQ ID NO. 11) and downstream primer GA-AlBOS-R (sequence as shown in SEQ ID NO. 12). Then, the plasmids were ligated into the vector pET28a-ispA-idi using the same method described above, to obtain plasmids pET28a-TcBOS-ispA-idi and pET28a-AlBOS-ispA-idi.
[0042] 2) Plasmid transformation: Plasmids pET28a-TcBOS-ispA-idi or pET28a-AlBOS-ispA-idi were co-transformed with the yeast isopentenyl diphosphate isomerase ScIDI gene knocked out from the pTrcLower vector to obtain plasmids pTrcLower-ΔIDI (described in CN111607546A A genetically engineered bacterium producing high farnesene and its construction method and application) and pACYC-mvaE-mvaS-prpD containing ERG12, ERG8 and ERG19 genes. E. coli BL21(DE3) competent cells were plated on LB agar plates containing the corresponding three antibodies (Amp, Kan, and Cm), with the final concentrations of Cm, Amp, and Kan in the LB agar being 34 mg / L, 100 mg / L, and 50 mg / L, respectively. The cells were incubated at 37°C until single colonies appeared, thus obtaining recombinant bacteria that synthesize α-bisabolol.
[0043] SEQ ID NO.7 SEQ ID NO.8 SEQ ID NO.9: GA-TcBOS-F: ttaagaaggagatataccATGCTGCGCAAAATTAGCTG; SEQ ID NO.10: GA-TcBOS-R:ccatccaattaacctcctTTACACAATCATCGGCTGCA; SEQ ID NO.11: GA-AlBOS-F: ttaagaaggagatataccATGGAACAGGATCTGATTCGC; SEQ ID NO.12: GA-AlBOS-R:ccatccaattaacctcctTTACAGCGGATGCACAAACA.
[0044] Comparative Example 2. Application of the recombinant bacteria constructed in Comparative Example 1 in the synthesis of α-bisabolol by shake-flask fermentation.
[0045] In this embodiment, gas chromatography was used for the quantitative detection of α-bisabolol. An Agilent DB-5MS (30 m × 0.25 mm × 0.25 μm) capillary column was used. The column temperature program was as follows: initial temperature of 80℃ for 1 min, increased to 250℃ at a rate of 10℃ / min and held for 1 min, then increased to 300℃ at a rate of 30℃ / min and held for 1 min. A standard curve was prepared using α-bisabolol standards for quantification.
[0046] The seed culture medium described in this embodiment is LB medium, which consists of 10 g / L NaCl, 10 g / L peptone, 5 g / L yeast extract, and the remainder is water.
[0047] The fermentation medium consists of: 20 g / L glucose, 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 0.06 g / L MgSO₄, and 1 mL / L trace element solution, wherein the trace element solution contains (NH₄)₆Mo₇O₇. 24 The concentrations of the following components are: 0.37 g / L of 4H₂O, 0.29 g / L of ZnSO₄·7H₂O, 2.47 g / L of H₃BO₃, 0.25 g / L of CuSO₄·5H₂O, and 1.58 g / L of MnCl₂·4H₂O.
[0048] Taking shake-flask fermentation as an example, the application of the recombinant bacteria constructed in Comparative Example 1 in the synthesis of α-bisabolol is described.
[0049] Single colonies of the recombinant bacteria obtained in Example 1 and Comparative Example 1 were inoculated into 5 mL of LB medium containing the corresponding antibiotics (Cm / Amp / Kan) and cultured at 37°C and 200 rpm for 8–12 h to obtain seed culture. 0.5 mL of the seed culture was transferred to 50 mL of fermentation medium and cultured at 37°C and 200 rpm until OD = 0.6–0.9. Then, IPTG inducer was added to a final concentration of 0.1 mM and 10 mL of n-dodecane, and the culture was continued at 30°C and 200 rpm. Samples were taken every 24 hours to determine cell density and farnesene yield. The yield from shake-flask fermentation is shown in the attached figure. Figure 5 As shown, the recombinant bacteria containing CcBOS achieved an α-bisabolol yield of 4.92 g / L after 48 h of fermentation, while the recombinant bacteria containing TcBOS and AlBOS achieved yields of 0.43 g / L and 0.29 g / L, respectively. These results indicate that the in vivo fermentation catalytic efficiency of CcBOS is significantly higher than that of TcBOS and AlBOS.
[0050] Comparative Example 3. Plasmid transformation: Plasmid pET28a-CcBOS-ispA-idi and the yeast isopentenyl diphosphate isomerase ScIDI gene knocked out in the pTrcLower vector were used to obtain plasmids pTrcLower-ΔIDI (described in CN111607546A A genetically engineered bacterium with high farnesene production and its construction method and application) and pACYC-mvaE-mvaS (described in the article "Metabolic engineering of Escherichia coli for high-specificity production of isoprenol and prenol as next generation of biofuels, Biotechnology for Biofuels", obtained by ligating the mvaE and mvaS genes into the vector pACYCDuet-1) containing ERG12, ERG8 and ERG19 genes. These were co-transformed into E. coli BL21(DE3) competent cells and plated on LB agar plates containing the corresponding triple antibodies (Amp, Kan and Cm), with a final Cm concentration of 34 g / L in the LB medium. The final concentrations of Amp and Kan in LB medium were 100 mg / L and 50 mg / L, respectively. The mixture was cultured at 37°C until single colonies appeared, thus obtaining recombinant bacteria that synthesize α-bisabolol (without additional overexpression of prpD).
[0051] A single colony of the recombinant bacteria obtained above was inoculated into 5 mL of LB medium containing the corresponding antibiotics (Cm / Amp / Kan) and cultured at 37°C and 200 rpm for 8–12 h to obtain the primary seed culture. 1 mL of the primary seed culture was transferred to 100 mL of fermentation medium and cultured overnight at 37°C and 200 rpm for 8–12 h to obtain the secondary seed culture. 2 L of fermentation medium was prepared in a 5 L fermenter. The pH was calibrated with a standard solution using a pH electrode. The temperature, pH, and dissolved oxygen electrodes were wrapped in aluminum foil and autoclaved together at 115°C for 30 min. After sterilization, air, condensate, temperature, pH, and dissolved oxygen electrodes were connected, and the temperature was adjusted to 37°C. After the temperature stabilized, 2 mL of each antibiotic (1 / 1000), 3 mL of trace elements (1.5 mL / L), and glucose (20 g / L) were added. 200 mL of the secondary seed culture was then inoculated into the fermenter, and the pH was set to 6.9, with the rotation speed and dissolved oxygen levels correlated. The initial sugar is consumed in about 8-13 hours. Feed is then added at a rate of 7%, and the OD (Octopic Sugar) is allowed to develop. 600 When the temperature is between 35 and 40°C, set it to 30°C. After the temperature stabilizes (cooling process takes about 1 hour), add IPTG to a final concentration of 0.1 mM, and add 400 mL (20%) of dodecane as the extraction agent. Adjust the feed rate, aeration rate, and rotation speed according to changes in fermentation parameters, and discharge the fermenter after 119 hours. Take samples every 12 hours to measure OD. 600 The yield of α-bisabolol. (See attached image.) Figure 6 As shown, after adding the extractant dodecane, the cell density tended to decrease, resulting in a slower product accumulation rate. After 102 h of fermentation, the yield of α-bisabolol reached 21.56 g / L.
Claims
1. A recombinant strain for increasing α-bisabolol production, characterized in that, The recombinant bacteria were obtained by overexpressing the following genes: acetyl-CoA acyltransferase / HMG-CoA reductase mvaE, HMG-CoA synthase mvaS, 2-methylcitrate dehydratase prpD, mevalonate kinase ERG12, mevalonate-5-phosphate kinase ERG8, mevalonate-5-bisphosphate decarboxylase ERG19, isopentenyl diphosphate isomerase idi, farnesyl diphosphate synthase ispA, and artichoke α-bimethanol synthase CcBOS.
2. The recombinant bacteria according to claim 1, characterized in that, The originating strain was BL21(DE3).
3. The recombinant bacteria according to claim 1, characterized in that, The α-bisabolol synthase CcBOS gene of artichoke is shown in SEQ ID NO.
1.
4. A method for increasing the yield of α-bisabolol, characterized in that, Recombinant microbial cells were obtained by co-expressing a recombinant vector overexpressing the α-bisabolol synthase CcBOS gene of artichoke with recombinant vectors overexpressing the acetyl-CoA acyltransferase / HMG-CoA reductase mvaE gene, HMG-CoA synthase mvaS gene, 2-methylcitrate dehydratase prpD gene, mevalonate kinase ERG12 gene, mevalonate-5-phosphate kinase ERG8 gene, mevalonate-5-bisphosphate decarboxylase ERG19 gene, isopentenyl diphosphate isomerase idi gene, and farnesyl diphosphate synthase ispA gene in Escherichia coli, and then fermented.
5. The method according to claim 4, characterized in that, The method for obtaining farnesyl pyrophosphate is as follows: the starting microorganism for recombinant microbial cells is BL21(DE3).
6. The method for constructing the recombinant bacteria according to any one of claims 1-3, characterized in that, The steps are as follows: 1) Construction of plasmid pET28a-CcBOS-ispA-idi: The vector fragment pET28a-ispA-idi containing the ispA gene and the idi gene, and the CcBOS gene fragment were amplified by PCR, respectively. The pET28a-CcBOS-ispA-idi plasmid was constructed by seamless cloning. 2) Construction of plasmid pACYC-mvaE-mvaS-prpD: PCR amplification of the prpD gene fragment, followed by ligation into the vector pACYC-mvaE-mvaS using enzyme digestion and ligation methods. Bgl II and Xho Between the I sites, the pACYC-mvaE-mvaS-prpD plasmid was obtained; 3) Plasmid transformation: The plasmid pTrcLower-∆IDI containing the ERG12, ERG8, and ERG19 genes, together with the plasmid pET28a-CcBOS-ispA-idi constructed in step 1) and the plasmid pACYC-mvaE-mvaS-prpD constructed in step 2), were transformed into competent Escherichia coli cells to obtain recombinant bacteria that synthesize α-bisabolol.
7. The use of the recombinant bacteria according to any one of claims 1-3 in increasing the yield of α-bisabolol.
8. A method for increasing the yield of α-bisabolol, characterized in that, The recombinant bacteria described in any one of claims 1-3 are added to a fermenter for fermentation.
9. The method according to claim 8, characterized in that, Fermentation conditions: 30℃, fermentation time: 119 hours.
10. The method according to claim 9, characterized in that, After the recombinant bacteria were cultured in primary and secondary seed culture media, the resulting seed liquid was inoculated into the fermenter culture medium for fed-batch fermentation to obtain α-bisabolol.
Citation Information
Patent Citations
Genetically engineered bacterium for high yield of farnesene and construction method and application thereof
CN111607546A