Non-tissue-culture-dependent pumpkin leaf genetic transformation method

Abstract

The invention provides a non-tissue culture dependent pumpkin leaf genetic transformation method. The method comprises the following steps: 1) taking 20-40-day-old pumpkin seedlings as receptor material plants, and taking leaves of the pumpkin seedlings as explants; 2) carrying out propagation culture on agrobacterium rhizogenes until the concentration OD600 of a bacterial solution is 0.6-1.0, and taking the agrobacterium rhizogenes as an infection solution; (3) soaking the explant in the infection solution for 10 to 25 minutes; and 4) new root system culture. According to the method, pumpkin plant leaves are transformed, material taking and transformation operation are simple, tissue culture is not needed, vacuum dip dyeing is not needed, operation is convenient and fast, needed equipment is simple, the period is short, efficiency is high, popularization is easy, and the method has wide development and application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of pumpkin planting and molecular breeding, in particular to a pumpkin leaf genetic transformation method which is not dependent on tissue culture. Background Art

[0002] Pumpkin (Cucurbita moschata) is a herbaceous plant of the genus Cucurbita in the Cucurbitaceae family. Global pumpkin production reached 103 million tons in 2023 (FAOSTAT, http: / / www.fao.org / faostat / en / #home). my country, as the primary pumpkin producer, ranks first in the world in both sown area and production. Pumpkin is highly nutritious, rich in vitamins, minerals, and health-promoting ingredients, with antioxidant, anti-tumor, and antibacterial properties. With its unique fruit shape and rich color, pumpkin is often used in landscaping and landscape design, enjoying high ornamental value. Furthermore, pumpkin has a well-developed root system and strong stress resistance, making it a popular rootstock for melons to improve the yield and quality of grafted seedlings. Since 2017, the whole genome sequencing of major cultivated pumpkin varieties has been completed, ushering in the post-genomic stage of pumpkin genetic research. However, the current lack of a stable genetic transformation system for pumpkin has limited the study of gene function and the development of genetic improvement technologies. Therefore, establishing a stable and efficient genetic transformation system is crucial for pumpkin genetics and breeding research.

[0003] Creating new varieties through genetic engineering is an important method that needs to be broken through in the process of improving pumpkin varieties in China. At present, the main methods of applying genetic engineering to the genetic transformation of pumpkin in China include ovary injection method (Zhang Yanchao et al. Research on genetic transformation of pumpkin by ovary injection method [J]. Chinese Vegetables, 2011(16):27-31), gene gun method (Li Zhenxia et al. Construction of pumpkin genetic transformation system mediated by gene gun method [J]. Journal of Northwest Agriculture, 2005,14(4):97-99) and Agrobacterium-mediated method (Fu Hongbing, Cui Chongshi et al. Establishment of pumpkin genetic transformation system mediated by Agrobacterium-mediated [J]. Acta Botanica Sinica, 2010,45(4):472-478). However, none of the three methods have been able to establish an efficient pumpkin genetic transformation system. Previous researchers used Indian pumpkin as the test material to explore the effects of factors such as pre-culture time, Agrobacterium liquid concentration, infection time, co-culture time, antibiotic concentration in screening culture medium, and acetosyringone concentration on the production of resistant buds during genetic transformation of Indian pumpkin cotyledons and cotyledonary nodes. They found that when the pre-culture time was 36 h and the OD value of Agrobacterium liquid was 0. 600When the pH value was 0.3-0.5, the infection time was 10 min, and the co-cultivation time was 2 d, the resistant bud rate of the Indian pumpkin explants was the highest, but no transgenic regenerated plants of the Indian pumpkin were effectively obtained (Lu Xiaoxiao. Optimization of in vitro regeneration and genetic transformation system of Indian pumpkin [D]. Xinxiang, Henan: Henan Institute of Science and Technology, 2017; Zhang Yuyuan. Construction of in vitro regeneration system of pumpkin cotyledonary nodes and transformation of salt-tolerant StNHX1 gene [D]. Xinxiang, Henan: Henan Institute of Science and Technology, 2015).

[0004] Agrobacterium rhizogenes is a Gram-negative bacterium of the genus Agrobacterium, family Rhizobiaceae. The T-DNA contained in its Ri plasmid can be inserted into the plant cell genome and transcribed and translated, inducing the production of transgenic hairy roots that are fast-growing, physiologically, biochemically, and genetically stable. Currently, research on A. rhizogenes-mediated genetic transformation of pumpkin primarily focuses on inducing transgenic roots from explants through tissue culture under sterile conditions. However, this method is time-consuming and labor-intensive, with low transformation efficiency and poor stability, limiting molecular breeding and genetic research on important economic traits in pumpkin.

[0005] Agrobacterium rhizogenes-mediated genetic transformation under non-tissue culture conditions has been reported in herbaceous plants such as soybean, as well as woody plants such as Carya serrata, citrus, and Phoebe chinensis. However, in pumpkin, only seedlings and stem segments have been reported, and genetic transformation of pumpkin leaves under non-tissue culture conditions has not been reported. Using leaves as explants offers the advantages of sufficient experimental material, easy access, and the ability to generate multiple transgenic explants from a single seedling.

[0006] Based on this, this study aims to establish a non-tissue culture-dependent pumpkin leaf genetic transformation system mediated by Agrobacterium rhizogenes, and explore the effects of different infection methods, Agrobacterium strains, leaf positions and plant age on the genetic transformation efficiency, so as to construct a non-tissue culture-dependent pumpkin leaf genetic transformation method. Summary of the Invention

[0007] The invention provides a pumpkin leaf genetic transformation method which does not rely on tissue culture.

[0008] The specific technical solutions are as follows:

[0009] A method for genetic transformation of pumpkin leaves that does not rely on tissue culture comprises the following steps:

[0010] 1) Using 20-40 day old pumpkin seedlings as recipient plants, and taking their leaves as explants;

[0011] 2) Agrobacterium rhizogenes is cultured to a bacterial concentration of OD 600 =0.6-1.0, as infection solution;

[0012] 3) soaking the explant in the infection solution for 10-25 minutes;

[0013] 4) Cultivation of new root system.

[0014] There are many factors that affect pumpkin regeneration, including explant type, genotype, and seedling age. For example, the literature records the regeneration ability of Indian pumpkin explants of different seedling ages, and found that the regeneration rate of cotyledons with a seedling age of 4 days was as high as 82% during in vitro culture. When the explant seedling age was greater than 4 days, its regeneration ability decreased significantly. For example, the literature records the research on the regeneration system of Chinese pumpkin, and found that the regeneration effect was best when the explant seedling age was 4-5 days, and when the seedling age was greater than 5 days or less than 4 days, its regeneration ability decreased. However, the present application found that using 20-40 day old pumpkin seedlings as the recipient material plants, taking their leaves as explants, and immersing and infecting them through Agrobacterium rhizogenes mediation, co-cultivation can reveal transgenic positive hairy roots, and the proportion of positive transgenic roots can be as high as 88.2%, which is relatively time-consuming.

[0015] In certain embodiments, the soaking time can be 10-16 minutes, 15-23 minutes, 22-25 minutes, or 15 or 25 minutes. Preferably, it is 15 minutes. The duration of Agrobacterium infection of the explant directly affects the transformation frequency and the degree of explant necrosis. An appropriate infection time is essential for a good transformation system. The present application has found through screening that the proportion of positive hairy roots is highest when the explant is soaked and infected for 15 minutes.

[0016] In some embodiments, the leaf is selected from the group consisting of the first leaf, the second leaf, and the third leaf. Screening of the explants of the present invention revealed that the proportion of positive hairy roots varied with the position of the leaves, with the proportion of positive hairy roots being the highest at the second leaf, the third leaf, and the first leaf.

[0017] In certain embodiments, the Agrobacterium rhizogenes is selected from one or more of K599, C58C1, MSU440, ArQual, and Ar1193. The present application screened Agrobacterium rhizogenes and found that different Agrobacterium rhizogenes strains had different proportions of positive hairy roots, with the highest to lowest proportions being K599, ArQual, Ar1193, MSU440, and C58C1.

[0018] In certain embodiments, the pumpkin varieties are selected from one or both of 'Jintian No. 1' honey pumpkin and 'Xiangyu'.

[0019] In certain specific embodiments, the leaf is the second leaf from the bottom, the pumpkin seedling is 30 days old, the variety of the pumpkin seedling is Jintian No. 1, the root-inducing Agrobacterium is K599, and the positive hairy root ratio can reach 89.58%.

[0020] In certain embodiments, the infection solution is prepared by:

[0021] 1) Agrobacterium rhizogenes was inoculated into LB liquid medium containing kanamycin sulfate and streptomycin and cultured until the bacterial concentration was OD 600 =0.6-1.0;

[0022] 2) Separate the bacterial solution into solid and liquid to obtain a precipitate, and resuspend the precipitate in a resuspension solution to an OD of 600 =0.6-1.0, as the infection solution.

[0023] In certain specific embodiments, based on the total volume of the LB liquid medium, the concentration of kanamycin sulfate is 60 mg·L -1 The concentration of streptomycin is 30 mg·L -1 .

[0024] In certain specific embodiments, the temperature of the enrichment culture is 28-30°C.

[0025] In certain specific embodiments, the solid-liquid separation is performed by centrifugation, the rotation speed of the centrifugation condition is 4000-6000 rpm, and the centrifugation time is 5-15 min.

[0026] In certain specific embodiments, the resuspension solution is 2-morpholineethanesulfonic acid (MES) buffer, and the 2-morpholineethanesulfonic acid (MES) buffer contains: 7-13 mmol·L -1 MES, 7-13 mmol·L -1 MgCl2, 80-120 μmol·L -1 Acetosyringone.

[0027] In certain embodiments, the newly emerged root system is cultured in a seedling growth medium comprising peat, vermiculite and perlite.

[0028] In certain more specific embodiments, the mass ratio of peat, vermiculite and perlite is 1:1:1.

[0029] In certain more specific embodiments, the culture conditions are: temperature 20-25°C, a cycle of 12 hours of light and 12 hours of darkness, humidity 50-70%, and a light intensity of 150-200 μmol·m -2 ·s -1 Preferably, the temperature is 25°C / 20°C (day / night), humidity is 60%, light is 12h / dark is 12h, and the light intensity is 200μmol·m -2 ·s -1 .

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1) The method of the present invention can see transgenic positive hairy roots after about 15 days of co-cultivation, and the proportion of positive transgenic roots can be as high as 89.58%, which is time-consuming.

[0032] 2) The present invention uses pumpkin plant leaves for transformation. The material collection and transformation operations are simple, no tissue culture is required, and no vacuum infiltration is required. The operation is convenient and fast, the required equipment is simple, the cycle is short, the efficiency is high, and it is easy to promote, and has broad development and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a flowchart for pumpkin leaf infestation.

[0034] Figure 2 Results of hairy root detection on the leaves of the honey-based pumpkin cultivar 'Jintian No. 1'. A shows a positive hairy root detected using a portable fluorescent protein excitation light source; B and C show calli produced by infected pumpkin leaves observed under brightfield and fluorescence light, respectively; D and E show hairy roots produced by infected pumpkin leaves observed under brightfield and fluorescence light, respectively. Scale bar: 2 mm. In panel F, M represents GL2000 marker; 1-2 represent negative controls; 3 represents positive controls; 4-5 represent pumpkin leaf hairy root DNA. In panel G, M represents GL2000 marker; 1-2 represent negative controls; 3 represents positive controls; 4-5 represent pumpkin leaf hairy root cDNA. DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with specific embodiments. The following are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto.

[0036] Example 1

[0037] 1.1 Plant materials

[0038] The research materials are 'Jintian No. 1' honey pumpkin and 'Xiangyu', 'Crocodile', 'Duangan Black Chestnut' and 'Xuri' pumpkins, which can all be purchased on the market.

[0039] 1.2 Vector construction and preparation of Agrobacterium rhizogenes

[0040] The 35S::GFP-pCAMBIA1300 plasmid was transformed into Agrobacterium rhizogenes strains K599, C58C1, MSU440, ArQual, and Ar1193 to construct a binary expression vector, in which the eGFP gene driven by the cauliflower mosaic virus (CaMV) 35S promoter was used as a reporter gene.

[0041] 1.3 Preparation of Agrobacterium rhizogenes infection solution

[0042] Inoculate a single colony of K599, C58C1, MSU440, ArQual, or Ar1193 rhizogenes transformed with the exogenous vector in step 1.2 in a 60 mg·L -1 Kanamycin sulfate and 30 mg·L -1 The culture was shaken in LB liquid medium containing streptomycin at 28°C until the OD 600 The value is 0.6~1.0, at 4℃, 5000rpm·min -1 The cells were collected by centrifugation for 10 min under the following conditions, the supernatant was discarded, and the bacterial mass at the bottom was resuspended in 2-morpholinoethanesulfonic acid (MES) buffer: 10 mmol·L -1 MES, 10 mmol·L -1 MgCl2, 100 μmol·L -1 Acetosyringone was added and the pH was adjusted to 5.2 to prepare an Agrobacterium rhizogenes infection medium. The composition of the LB liquid medium was as follows: 10 g NaCl, 5 g yeast extract, and 10 g peptone per liter.

[0043] 1.4 Construction and optimization of genetic transformation system

[0044] The third leaf of the 30-day-old 'Jintian No. 1' honey pumpkin seedling was cut obliquely as an explant and the OD value of the Agrobacterium rhizogenes infection solution prepared in step 1.3 was set to 600 The value is 0.6-1.0 for infection, as follows.

[0045] (1) Vacuum treatment: Soak the cut of the pumpkin leaf petiole in the Agrobacterium rhizogenes infection solution and use a vacuum pump to vacuum for 1 min, 5 min, and 10 min respectively.

[0046] (2) Direct immersion treatment: The cut of the pumpkin leaf petiole was immersed in the infection solution of Agrobacterium rhizogenes for 5 min, 15 min, and 25 min respectively.

[0047] The pumpkin leaves infected by (1) and (2) were respectively inserted into moist seedling medium so that the seedling medium completely covered the infected part. They were cultured in a greenhouse in the dark and covered with a transparent seedling cover to keep them moist. After 15 days, the treated parts were observed to see whether hairy roots were induced. A portable fluorescent excitation light source was used to screen the positive explants containing green fluorescent signals and the number of positive explants was counted ( Figure 1 The greenhouse conditions were 25°C / 20°C (day / night), 60% humidity, 12 h light / 12 h dark, and a light intensity of 200 μmol·m -2 ·s -1 ; The seedling medium is a mixed soil formed by peat, vermiculite and perlite in a weight ratio of 1:1:1.

[0048] The factors that may affect the transformation efficiency (assessed by the proportion of positive hairy roots) in the observation experiment were selected. Leaves at the first, second, and third leaf positions and pumpkin seedlings at three, five, and seven weeks of age (corresponding to the 21st, 35th, and 49th days after sowing, respectively) were taken to screen out the optimal conditions for inducing the production of positive hairy roots in the leaves of the 'Jintian No. 1' honey pumpkin. The purpose is to optimize the existing genetic transformation system and improve the transformation efficiency.

[0049] 1.5 Identification and statistical analysis of positive roots

[0050] Using a portable fluorescent protein excitation light source, we screened for positive pumpkin leaf hairy roots that emitted green fluorescence and counted their number. The positive hairy root ratio = (number of positive root explants / total number of infected explants) × 100%. We randomly selected pumpkin leaf hairy roots that emitted green fluorescence, cryogenically treated them in liquid nitrogen, and thoroughly ground them. Genomic DNA and RNA were extracted from these pumpkin leaf hairy roots using a plant DNA quick extraction kit. GFP gene fragments from the hairy root DNA and cDNA were amplified using specific primers:

[0051] Upstream primer: ATGGTGAGCAAGGGCGAGGAGCTGTTCACC;

[0052] Downstream primer: TTACTTGTACAGCTCGTCCATGCCGTGAGTGATCC.

[0053] After PCR, 1% agarose gel electrophoresis was performed to verify the presence of target bands and to identify positive hairy roots at the DNA and RNA levels.

[0054] 1.6 Experimental Results

[0055] 1.6.1 Induction of hairy roots in pumpkin leaves by Agrobacterium rhizogenes

[0056] Direct immersion and vacuum extraction were used to infect for different times to investigate the effects of different infection methods on the conversion rate. The results are shown in Table 1.

[0057] Table 1 Effects of different infection methods and infection times on leaf transformation

[0058]

[0059]

[0060] As can be seen from Table 1, the conversion rate is direct immersion for 15 minutes (62.50%) > direct immersion for 5 minutes (56.25%) > direct immersion for 25 minutes (53.13%) > vacuum pumping for 1 minute (43.75%) > vacuum pumping for 5 minutes (34.38%) > vacuum pumping for 10 minutes (21.88%); this shows that the overall infection efficiency of direct immersion is higher than that of vacuum pumping treatment, among which the conversion rate of infection by direct immersion for 15 minutes is the highest, so the subsequent experiments adopted the method of direct immersion for 15 minutes.

[0061] 1.6.2 Optimization of the pumpkin leaf genetic transformation system

[0062] The effects of different Agrobacterium rhizogenes strains, pumpkin leaf positions and seedling ages on transformation efficiency were investigated to obtain the optimal genetic transformation conditions, as follows.

[0063] 1) The effects of different Agrobacterium rhizogenes strains on transformation efficiency were investigated. The results are shown in Table 2.

[0064] Table 2 Effects of different strains on pumpkin leaf transformation efficiency

[0065]

[0066] As can be seen from Table 2, the transformation efficiency of different Agrobacterium rhizogenes strains is K599 (81.82%) > ArQual (76.19%) > Ar1193 (71.43%) > MSU440 (45.00%) > C58C1 (10.00%). The transformation rates of K599, ArQual and Ar1193 strains are higher, among which K599 strain has the highest transformation efficiency.

[0067] 2) To explore the effects of different pumpkin leaf positions, seedling ages, and strains on transformation efficiency, this study designed a 4-factor 3-level orthogonal experiment L9 (3 4 ), see Table 3, the infection was carried out by immersion method for 15 minutes, and the test results are shown in Table 4.

[0068] Table 3 Transformation efficiency of pumpkin leaves L9 (3 4 ) Orthogonal experimental factors and levels

[0069]

[0070] As shown in Table 4, the factors affecting the transformation efficiency of pumpkin leaves are A>D>C>B, i.e., Agrobacterium rhizogenes strain>leaf position>seedling age>bacterium solution OD. 600 The optimal transformation conditions screened out were A1B2C2D2, i.e., using Agrobacterium rhizogenes strain K599, OD 600 The conversion efficiency under these conditions can reach 89.58%.

[0071] Table 4 Analysis of orthogonal test results of pumpkin leaf transformation efficiency

[0072]

[0073] As shown in Table 4, the proportion of positive hairy roots was the highest when the second leaf, 30-day-old pumpkin seedlings, 'Jintian No. 1' pumpkin seedling variety, and K599 Agrobacterium rhizogenes were selected as the optimal transformation conditions.

[0074] 1.6.3 Verification of the hairy root transformation system

[0075] The plants obtained in Table 1 were verified, and positive hairy roots were observed in all of them. The following observation results are based on the plant K599, 30 days old, with the second leaf removed, as an example.

[0076] 1) Screening pumpkin leaf hairy roots that emit green fluorescence using a portable handheld fluorescence instrument ( Figure 2 A).

[0077] 2) Use fluorescent stereomicroscope to further confirm the positive hairy roots ( Figure 2 B~E).

[0078] 3) Extract DNA from pumpkin leaf hairy roots, amplify the GFP gene fragment by PCR, and obtain the target band of corresponding size ( Figure 2 F).

[0079] 4) Total RNA was further extracted from the hairy roots of pumpkin leaves and reverse transcribed into cDNA. Target bands of corresponding sizes were also obtained by PCR amplification ( Figure 2 G).

[0080] This verified at different levels that the exogenous genes were successfully transferred into the hairy roots produced by pumpkin leaves.

[0081] Example 2 Application of the genetic transformation system in other pumpkin varieties

[0082] To determine the applicability of this genetic transformation method to other pumpkin varieties, we infected 'Jintian No. 1', 'Xiangyu', 'Crocodile', 'Duangan Black Li', and 'Xuri' pumpkins using the optimal transformation conditions determined in the previous experiments (i.e., immersion infection of different pumpkin varieties with the second-leaf-to-bottom, 30-day-old pumpkin seedlings, Jintian No. 1 variety, and Agrobacterium rhizogenes K599, using the same optimal transformation conditions as described in Example 1).

[0083] Table 5 Comparison of transformation efficiency of leaves of different varieties

[0084]

[0085] As shown in Table 5, the results showed that the exogenous GFP gene was successfully introduced into the four pumpkin varieties. Among them, the transformation rate of the 'Jintian No. 1' pumpkin reached 70.83%, the positive hairy root ratio of the 'Crocodile' pumpkin transformed plants reached 76.47%, and the positive hairy root ratios of the 'Xiangyu', 'Duangan Black Li' and 'Xuri' pumpkin transformed plants were 37.50%, 9.38% and 3.13%, respectively. This shows that this genetic transformation system has a high positive hairy root ratio in the 'Jintian No. 1' and 'Xiangyu' pumpkins.

Claims

1. A method for genetic transformation of pumpkin leaves that does not rely on tissue culture, characterized in that: The following steps are involved: 1) Using 20-40 day old pumpkin seedlings as recipient plants, and taking their leaves as explants; 2) Agrobacterium rhizogenes is cultured to a bacterial concentration of OD 600 =0.6-1.0, as infection solution; 3) soaking the explant in the infection solution for 10-25 minutes; 4) Cultivation of new root system.

2. The method according to claim 1, wherein: The leaves are selected from the group consisting of one leaf, two leaves, and three leaves.

3. The method according to claim 1, wherein: The Agrobacterium rhizogenes is selected from one or more of K599, C58C1, MSU440, ArQual and Ar1193.

4. The method according to claim 1, wherein: The pumpkin varieties are selected from one or both of 'Jintian No. 1' and 'Xiangyu'.

5. The method according to claim 1, wherein: The preparation method of the infection solution is: 1) Agrobacterium rhizogenes was inoculated into LB liquid medium containing kanamycin sulfate and streptomycin and cultured until the bacterial concentration was OD 600 =0.6-1.0; 2) Separate the bacterial solution into solid and liquid to obtain a precipitate, and resuspend the precipitate in a resuspension solution to an OD of 600 =0.6-1.0, as the infection solution.

6. The method according to claim 5, wherein: Based on the total volume of LB liquid culture medium, the concentration of kanamycin sulfate is 60 mg·L -1 The concentration of streptomycin is 30 mg·L -1 ; And / or, the temperature of the expansion culture is 28-30°C; And / or, the solid-liquid separation is centrifugation, the rotation speed of the centrifugation condition is 4000-6000 rpm, and the centrifugation time is 5-15 min; And / or, the resuspension solution is 2-morpholineethanesulfonic acid (MES) buffer, and the 2-morpholineethanesulfonic acid (MES) buffer contains: 7-13 mmol·L -1 MES, 7-13mmol·L -1 MgCl2 and 80-120 μmol·L -1 Acetosyringone.

7. The method according to claim 1, wherein: The new root system is cultured in a seedling medium, which comprises peat, vermiculite and perlite.

8. The method according to claim 7, wherein: The mass ratio of the peat, vermiculite and perlite is 1:1:1; And / or, the culture conditions are: temperature 20-25°C, light 12 hours, dark 12 hours cycle, humidity 50-70%, light intensity 150-200 μmol·m -2 ·s -1 .

Images