PCR primer set, kit and method for rapidly identifying siniperca chuatsi, onychostoma lanchowensis and their hybrid

By designing a PCR primer set and combining it with PCR amplification and electrophoresis detection, the problem of identifying hybrids of Changchun bream and Culter alba was solved, rapid and accurate population identification was achieved, and the scientificity and accuracy of germplasm identification were improved.

CN120624683BActive Publication Date: 2025-10-10ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511127388.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-10-10
Estimated Expiration
2045-08-13

AI Technical Summary

Technical Problem

Existing morphological identification or molecular marker methods cannot effectively identify Changchun bream, Culter alba and their hybrids, especially when the fry stage is fuzzy in morphological characteristics, making it difficult to accurately distinguish between purebreds and hybrids, resulting in loopholes in germplasm safety.

Method used

A specific PCR primer set, including forward primer F and reverse primer R, was designed to achieve rapid identification of Changchun bream, whitefish and their hybrids through PCR amplification and agarose gel electrophoresis.

Benefits of technology

The accurate identification of Changchun bream, whitefish and their hybrids was achieved, which made up for the shortcomings of morphological identification and provided scientifically based population identification conclusions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624683B_ABST
    Figure CN120624683B_ABST
Patent Text Reader

Abstract

The application discloses a PCR primer group, a kit and a method for rapidly identifying Siniperca chuatsi, Parabramis sp. and their hybrid, and belongs to the technical field of molecular biology identification. The PCR primer group comprises a forward primer F and a reverse primer R; the nucleotide sequence of the forward primer F is shown as SEQ ID No:1, and the nucleotide sequence of the reverse primer R is shown as SEQ ID No:2. The identification method comprises the following steps: extracting DNA of Siniperca chuatsi, Parabramis sp. and their hybrid; using the extracted DNA as an amplification template, performing PCR amplification by using the PCR primer group, and detecting the product after the PCR amplification is completed by adopting agarose gel electrophoresis. The kit and the method designed by the PCR primer group achieve rapid identification of Siniperca chuatsi, Parabramis sp. and their hybrid.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology identification, and particularly relates to a PCR primer set, a kit and a method for rapidly identifying Sinibrama taeniata, Culter alburnus and their hybrid. BACKGROUND

[0002] Sinibrama taeniata and Culter alburnus are two freshwater economic fish species, belonging to the genus Sinibrama and Culter, respectively, and widely distributed in the eastern and central regions of China. They are important freshwater economic fish species in inland waters of China.

[0003] Some breeders have carried out hybridization and breeding of Sinibrama taeniata and Culter alburnus in order to cultivate new varieties with better growth performance. However, with the increase of propagation and release activities, the hybridization has caused damage to the wild Sinibrama taeniata and Culter alburnus germplasm resources, leading to vulnerabilities in germplasm safety.

[0004] At present, identification is mainly carried out through molecular markers or morphological identification. For example, Chinese invention patent application No. 2022110837549 discloses a primer set for Sinibrama taeniata microsatellite markers and its application and evaluation method. This method uses high-throughput random sequencing to mine microsatellite markers of Sinibrama taeniata, and uses polymorphic microsatellite markers to evaluate the population genetics characteristics of a Sinibrama taeniata broodstock population, which can realize kinship identification and individual identification. Another example is Chinese invention patent CN201810379963.5, which discloses a method for identifying microsatellite fluorescence multiplex PCR of Culter alburnus. This method uses a microsatellite marker amplification system, saves DNA samples, and has high experimental efficiency, and can be popularized in the identification of Culter alburnus, evaluation of population genetic diversity and genetic structure.

[0005] However, the above methods cannot be applied to the identification of Sinibrama taeniata and Culter alburnus and their hybrids, and the specific reasons are as follows:

[0006] (1) Microsatellite markers are widely distributed molecular markers in the genome, and their main uses in aquaculture species are parentage identification, pedigree analysis and population genetic structure evaluation. The above two patent documents do not disclose that microsatellite markers have the ability to identify hybrids of Sinibrama taeniata and Culter alburnus.

[0007] (2) There are hundreds of thousands of microsatellite sites in the genomes of Sinibrama taeniata and Culter alburnus, and the ratio of sites that can be designed is about 60%. However, the number of shared sites that can be amplified in both species is less than 30%, and the number of candidate sites that can further identify hybrids is less than 5%. Therefore, it is impossible to achieve the identification of hybrids by mining existing microsatellite sites and screening microsatellite markers with hybrid identification ability.

[0008] (3) Due to hybridization, hybrids of Changchun bream and Culter albus can exhibit morphological characteristics of both parents. Adult Changchun bream and hybrids are taller than Culter albus, but this characteristic is not obvious during the fry stage. The mouths of Culter albus and hybrids are both superior, making them difficult to distinguish from Culter albus. During the bloom stage, development is incomplete and morphological characteristics are blurred, further increasing the difficulty of accurately distinguishing purebreds from hybrids.

[0009] Therefore, traditional morphological identification or molecular marker methods are no longer suitable for the identification of new breeding, and technicians are urgently needed to develop corresponding kits or identification methods. Summary of the Invention

[0010] The present invention provides a PCR primer set, a kit and a method for rapidly identifying Changchun bream, Culex chub and their hybrids. The kit and the method designed by the PCR primer set can realize the rapid identification of Changchun bream, Culex chub and their hybrids.

[0011] The object of the present invention is achieved through the following technical solutions:

[0012] A PCR primer set for rapidly identifying bream, whitefish and their hybrids comprises a forward primer F and a reverse primer R; the nucleotide sequence of the forward primer F is shown in SEQ ID No: 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No: 2.

[0013] SEQ ID No: 1 is TGTCTTGCTGTATACTACCAACTGA;

[0014] SEQ ID No: 2 is CCCCTGTGAAAACCCCCTTA.

[0015] Preferably, it is (a1), (a2), (a3) ​​or (a4):

[0016] (a1) Identification of Changchun bream, Culter bream and their hybrids;

[0017] (a2) preparing a kit for identifying bream (Changchun bream), whitefish (Cultus chub) and their hybrids;

[0018] (a3) Detecting whether the DNA sample to be tested originates from Changchun bream, Culex chub and their hybrids;

[0019] (a4) preparing a kit for detecting whether a DNA sample to be tested is derived from Changchun bream, Culex chub and their hybrids.

[0020] As preferred, the kit in (a2) comprises forward primer F, reverse primer R, ddH2O and 2×Taq plus PCR Mix; wherein the concentration of forward primer F is 5-15 µmol, and the concentration of reverse primer R is 5-15 µmol.

[0021] As preferred, the kit in (a2) comprises forward primer F, reverse primer R, ddH2O and 2×Taq plus PCR Mix; wherein the concentration of forward primer F is 10 µmol, and the concentration of reverse primer R is 10 µmol.

[0022] The application also provides a method for rapidly identifying Sinocyclocheilus grahami, Parabramis pekinensis and their hybrid by using the PCR primer set, which comprises the following steps:

[0023] S01, extracting DNA of Sinocyclocheilus grahami, Parabramis pekinensis and their hybrid;

[0024] S02, using the PCR primer set to perform PCR amplification by taking the DNA of step S01 as an amplification template, and detecting the product after the PCR amplification is completed by using agarose gel electrophoresis;

[0025] S03, if the amplification product is a single band of 458-466 bp, it is determined as Sinocyclocheilus grahami;

[0026] if the amplification product is a single band of 176-182 bp, it is determined as Parabramis pekinensis;

[0027] if the amplification product is a double band of 176-182 bp and 458-466 bp, it is determined as the hybrid of the two.

[0028] As preferred, the reaction system of the PCR is: 0.8 µL of forward primer F and reverse primer R each with a concentration of 10 µmol; 0.5 µL of genomic DNA with a concentration of 50 ng·µL -1 ; 10 µL of 2×Taq plus PCR Mix; and finally using ddH2O to make up the reaction system to 20 µL.

[0029] As preferred, the reaction condition of the PCR is: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s; 64℃ annealing for 30 s; 72℃ extension for 50 s; a total of 30 cycles; and finally 72℃ extension for 5 min.

[0030] Compared with the prior art, the technical scheme of the application has the following advantages or beneficial effects:

[0031] 1. Using the PCR primer set provided in this protocol as a template, after PCR amplification, the amplified products can accurately identify Changchun bream, whitefish, or their hybrids, without the need for multiple trials and eliminations, and can quickly and accurately distinguish populations.

[0032] 2. This method can be used to distinguish Changchun bream, whitefish and their hybrids, which makes up for the shortcomings of morphological identification and can obtain population identification conclusions with high accuracy and more scientific basis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a diagram of the PCR electrophoresis detection results in the examples. DETAILED DESCRIPTION

[0034] The following will describe the implementation methods of this application in detail with reference to the accompanying drawings and examples, so that the application can fully understand how technical means are used to solve technical problems and achieve corresponding technical effects, and implement them accordingly. The embodiments of this application and the various features therein can be combined with each other without conflict, and the resulting technical solutions are all within the scope of protection of this application.

[0035] It should be clear that the embodiments described below are only some of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without making any creative work are within the scope of protection of this application.

[0036] Example 1: This example describes in detail the PCR primer set, kit, and method for rapid identification of bream, whitefish, and their hybrids.

[0037] In this embodiment, the common name of the experimental sample corresponding to the whitefish is Culter alba.

[0038] 1. Screening of SSR loci in Culter chub

[0039] The published genome of C. albicans (1.052 GB) with an N50 value of 32.92 Mb was downloaded and mapped to 24 pairs of chromosomes. SSR screening was performed on the whole genome of C. albicans using MISA software. The screening criteria were at least 10 repeats of a mononucleotide, at least 6 repeats of a dinucleotide, at least 5 repeats of a trinucleotide and tetranucleotide, and at least 5 repeats of a pentanucleotide and hexanucleotide, with a distance of less than 100 bp between two SSRs considered as one SSR. A total of 586,919 SSRs were identified in the whole genome of C. albicans, with a total frequency of 544.83 Mb. -1 .

[0040] 2. SSR primer design and e-PCR for Culter chub

[0041] Sequences 250 bp upstream and downstream of each SSR locus were extracted and batch primers were designed using Primer3 software. The amplified fragment length ranged from 80 to 1800 bp, the primer size ranged from 20 to 27 bp, the GC content ranged from 35 to 65%, with an optimum of 50%, and the TM value ranged from 55 to 65°C, with an optimum of 57°C. Three primer pairs were designed for each SSR locus. The number of potential binding sites for the designed primers was determined using e-PCR software. Primers were successfully designed for a total of 376,437 SSR loci.

[0042] 3. Screening of SSR loci for identification of Changchun bream, Culex chub and their hybrids

[0043] Primers obtained from the e-PCR screening of C. albicans were used for electronic PCR amplification of the genome of C. bream (Changchun bream). Results were screened based on binding site 1, resulting in 182,668 primers shared between C. albicans and C. albicans. Twenty-five primer pairs with expected amplification product sizes >80 bp different from those obtained by e-PCR were screened. Common primers were synthesized and initially tested using DNA from C. albicans, C. albicans, and a hybrid. The PCR reaction system consisted of 0.5 µL of genomic DNA (50 ng µL⁻¹), 10 µL of 2× Taq plus PCR Mix (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and 0.8 µL of each of the upstream and downstream primers (10 µmol), with ddH₂O added to 20 µL. PCR reaction conditions included 30 cycles of denaturation at 94°C for 30 seconds, annealing at 64°C for 30 seconds, and extension at 72°C for 50 seconds. Finally, a final extension at 72°C for 5 minutes was performed and the product was stored at 4°C until use. Five microliters of the reaction product was electrophoresed on a 1.5% agarose gel at 120 V for 30 minutes, followed by imaging of the gel. Initial screening identified one SSR locus suitable for identification: repeat core (TA) 12, located on chromosome 1 of Culter alba, with a start site at 6209334 and a stop site at 6209357.

[0044] Forward primer F: TGTCTTGCTGTATACTACCAACTGA (shown in SEQ ID NO: 1), reverse primer R: CCCCTGTGAAAACCCCCTTA (shown in SEQ ID NO: 2). The amplified product was approximately 180 bp in Culex bream and approximately 460 bp in C. bream.

[0045] HPLC-grade primers were further synthesized, and capillary electrophoresis was performed on multiple amplified products. The amplified product type was 460 bp (458-466 bp) in 15 individuals of Changchun bream, and 180 bp (176-182 bp) in 15 individuals of Culex chub.

[0046] Example 2: Accuracy test of identification of Changchun bream, Culex bream and their hybrids

[0047] Sixteen Changchun bream, sixteen Culex chub, and sixteen Culex chub hybrids were collected from the breeding base. Fin rays were cut and genomic DNA was extracted. The DNA was standardized to 50 ng·µL. -1 PCR amplification and electrophoresis were performed using 48 DNA samples. The conditions for PCR amplification, electrophoresis, and gel imaging were the same as those in point 3.

[0048] like Figure 1 The results showed that the amplified product of 16 Changchun bream was a single band of approximately 460 bp, the amplified product of 16 Culter albipris bream was a single band of approximately 180 bp, and the amplified product of the hybrid was a double band of approximately 180 bp and 460 bp. The accuracy of this locus in distinguishing Changchun bream, Culter albipris bream, and their hybrids was 100%.

[0049] The present invention is not limited to the specific embodiments described above. The embodiments described above are merely intended to illustrate the use of the present invention in detail. Functionally equivalent production methods and technical details are also part of the present invention. In fact, based on the above description, those skilled in the art will be able to find different adjustments according to their respective needs, and such adjustments are intended to be within the scope of the appended claims.

Claims

1. A PCR primer set for rapid identification of Changchun bream, Culter bream and their hybrids, characterized in that: It comprises a forward primer F and a reverse primer R; the nucleotide sequence of the forward primer F is shown in SEQ ID No: 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No:

2.

2. The use of the PCR primer set according to claim 1, wherein: is as follows (a1), (a2), (a3) ​​or (a4): (a1) Identification of Changchun bream, Culter bream and their hybrids; (a2) preparing a kit for identifying bream (Changchun bream), whitefish (Cultus chub) and their hybrids; (a3) Detecting whether the DNA sample to be tested originates from Changchun bream, Culex chub and their hybrids; (a4) preparing a kit for detecting whether a DNA sample to be tested is derived from Changchun bream, Culex chub and their hybrids.

3. The use according to claim 2, characterized in that The kit described in (a2) includes a forward primer F, a reverse primer R, ddH2O, and 2×Taq plus PCR Mix; wherein the concentration of the forward primer F is 5-15 µmol, and the concentration of the reverse primer R is 5-15 µmol.

4. The use according to claim 3, characterized in that The kit described in (a2) includes a forward primer F, a reverse primer R, ddH2O, and 2×Taq plus PCR Mix; wherein the concentration of the forward primer F is 10 μmol, and the concentration of the reverse primer R is 10 μmol.

5. A method for rapidly identifying bream, whitefish and their hybrids using the PCR primer set according to claim 1, characterized in that: The following steps are involved: S01, extracting DNA from Changchun bream, Culter alba and their hybrids; S02, using the DNA from step S01 as an amplification template, performing PCR amplification using the PCR primer set, and detecting the PCR amplification product by agarose gel electrophoresis; S03. If the amplified product is a single band of 458-466 bp, it is confirmed to be Changchun bream; If the amplified product is a single band of 176-182 bp, it is confirmed to be Culter brevis; If the amplified product is a double band of 176-182 bp and 458-466 bp, it is determined to be a hybrid of the two.

6. The method according to claim 5, wherein The PCR reaction system is as follows: 0.8 μL of each of the forward primer F and the reverse primer R at a concentration of 10 μmol; 50 ng·μL -1 0.5 µL of genomic DNA; 10 µL of 2×Taq plus PCRMix; and finally, ddH2O was used to make up the reaction system to 20 µL.

7. The method according to claim 5, wherein The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 64°C for 30 s; extension at 72°C for 50 s; 30 cycles in total; and a final extension at 72°C for 5 min.

Citation Information

Patent Citations

  • Microsatellite fluorescence multi-PCR method for testing paternity of culter alburnus basilewsky

    CN108611405A

  • Rapid detection method and molecular marker for fast-growing Culter ilishaeformis

    CN109234412A

  • PCR (Polymerase Chain Reaction) primer group, kit and method for quickly identifying opsariichthys bidens, zacco platypus and hybrid thereof

    CN116790763A