Application of IL-6 in preparation of medicine for diagnosing and / or treating diabetic vascular calcification

Abstract

The invention relates to the field of biological medicine, in particular to application of IL-6 in preparation of medicine for diagnosing and / or treating diabetic vascular calcification. According to the application disclosed by the invention, at a clinical level, by analyzing the level of the IL-6 in group-entering sample serum and the related type and dose-reaction effect of the vascular calcification of the type 2 diabetes mellitus, the IL-6 and the vascular calcification of the type 2 diabetes mellitus have high correlation in a cell model and a mouse model of the type 2 diabetes mellitus, the vascular calcification of the type 2 diabetes mellitus is inhibited by the high-concentration IL-6, and the vascular calcification of the type 2 diabetes mellitus is inhibited by the high-concentration IL-6. And the low-concentration IL-6 can promote vascular calcification.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular, to the use of IL-6 in preparing a drug for diagnosing and / or treating diabetic vascular calcification. Background Art

[0002] Vascular calcification (VC) is a dynamic vascular disease characterized by the ectopic deposition of calcium phosphate in the form of hydroxyphosphate in the blood vessel wall. The high morbidity and mortality of cardiovascular disease in patients with type 2 diabetes are the leading causes of death and disability. Vascular calcification is considered an independent risk factor for cardiovascular risk. It is a pathological phenomenon in which the mineralization of the blood vessel wall occurs and is closely related to the osteogenic differentiation of vascular smooth muscle cells (VSMCs). According to statistics, the incidence of diabetes combined with abdominal aortic calcification is approximately 16.39%, and the mortality rate is 3.76 times higher than that of diabetic patients without calcification. However, vascular calcification is a complex pathological process involving multiple factors, and its pathogenesis is unclear, resulting in the current lack of early and rapid predictive indicators and effective treatments targeting the cause.

[0003] IL-6 is a pleiotropic cytokine with important functions in regulating metabolic homeostasis. In clinical evaluation, dynamic monitoring of serum IL-6 concentrations serves as an important biological indicator for assessing the severity of inflammatory responses. However, under specific conditions, stress-induced elevation of IL-6 has a protective effect. However, the association between IL-6 and diabetic vascular calcification remains unknown. Summary of the Invention

[0004] The purpose of the present invention is to provide the use of IL-6 in preparing drugs for diagnosing and / or treating diabetic vascular calcification.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Use of a reagent for detecting IL-6 expression levels in the preparation of a drug for diagnosing diabetic vascular calcification.

[0007] In a preferred embodiment, the diabetic vascular calcification is type 2 diabetic vascular calcification.

[0008] In a preferred embodiment, the reagent for detecting the IL-6 expression level is an IL-6 detection kit.

[0009] There are many commercially available ELISA kits or Western Blot detection kits for IL-6 detection kits, or refer to the prior art CN202110618231.9 (An ELISA kit for detecting canine IL-6 and its application).

[0010] In a preferred embodiment, when the IL-6 expression level is greater than 14.31 pg / ml, the possibility of diabetic vascular calcification is low.

[0011] Based on the same inventive concept, the present invention also claims protection for a reagent for diagnosing diabetic vascular calcification, which at least includes a reagent for detecting IL-6 expression level.

[0012] This study analyzed extensive clinical data and found a significant negative dose-response effect between IL-6 levels and the prevalence of diabetic vascular calcification. Furthermore, transcriptome sequencing results demonstrated that high concentrations of IL-6 stimulate vascular smooth muscle cells, inhibiting vascular calcification by activating the PI3K-Akt signaling pathway. This finding provides an important biomarker for early warning of diabetic vascular calcification.

[0013] Use of a reagent for increasing IL-6 expression levels in the preparation of a drug for treating diabetic vascular calcification.

[0014] In a preferred embodiment, the diabetic vascular calcification is type 2 diabetic vascular calcification.

[0015] The present invention uses a large amount of experimental data to prove that low concentrations of IL-6 promote diabetic vascular calcification, while high concentrations of IL-6 inhibit diabetic vascular calcification. This result will provide important direction and feasible technical means for the prevention and treatment of diabetic vascular calcification.

[0016] In a preferred embodiment, the agent for increasing the expression level of IL-6 includes IL-6 protein, a gene for editing IL-6 protein, a recombinant vector containing a gene for editing IL-6 protein, or an upstream protein in the synthetic pathway of IL-6 protein.

[0017] The gene encoding human IL-6 is located on chromosome 7p15-21 and consists of 4 introns and 5 exons.

[0018] The recombinant vector containing the gene for editing IL-6 protein can refer to the prior art CN106367394A (a method for constructing recombinant K562 engineered cells expressing IL-6), the prior art CN110655576A (IL-6 recombinant monoclonal antibody, its preparation method and application), CN114195880A (a method for preparing recombinant IL-6 protein and its application), and CN202110198801.3 (mesenchymal stem cells secreting IL-6 antibodies / CD20 antibodies, construction methods and applications).

[0019] The upstream proteins in the synthesis pathway of IL-6 protein mainly include IL-1b, tumor necrosis factor (TNF-α), IL-1, TNF, IFN-β, PDGF, LPS and PMA.

[0020] In a preferred embodiment, the IL-6 expression level in cells is not less than 200 ng / ml, which inhibits diabetic vascular calcification.

[0021] In a preferred embodiment, the above application includes inhibiting the occurrence and development of vascular calcification in diabetic patients.

[0022] Based on the same inventive concept, the present invention also claims protection for a drug for treating diabetic vascular calcification, which comprises at least one agent for increasing the expression level of IL-6.

[0023] In a preferred embodiment, the drug for treating diabetic vascular calcification further comprises other pharmaceutically useful excipients.

[0024] In a preferred embodiment, the drug for treating diabetic vascular calcification is in the form of an injection.

[0025] At the clinical level, the present invention analyzes the IL-6 levels in the serum of the enrolled samples and the correlation and dose-response effect with type 2 diabetes vascular calcification. Furthermore, in cell models and type 2 diabetes mouse models, IL-6 is highly correlated with type 2 diabetes vascular calcification. High concentrations of IL-6 inhibit type 2 diabetes vascular calcification, while low concentrations of IL-6 promote vascular calcification.

[0026] The present invention proposes for the first time that the expression level of IL-6 can be used as a marker for diagnosing diabetic vascular calcification. By increasing the expression level of IL-6, the present invention can effectively reduce the excessive proliferation, migration and osteogenic transformation of VSMCs, thereby playing a role in treating diabetic vascular calcification. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 To clinically analyze the level of IL-6 in the serum of patients with type 2 diabetes and type 2 diabetic vascular calcification;

[0028] Figure 2 Correlation matrix diagram for analyzing the correlation between IL-6 and vascular calcification and related indicators in type 2 diabetes;

[0029] Figure 3 ROC curve for analyzing the sensitivity of IL-6 and vascular calcification in type 2 diabetes;

[0030] Figure 4 KM survival curve was used to analyze the relationship between IL-6 and the incidence of vascular calcification in patients with type 2 diabetes;

[0031] Figure 5 The accuracy of IL-6 level in predicting vascular calcification in type 2 diabetes was analyzed by ROC curve analysis;

[0032] Figure 6 This is a bar graph analyzing the effects of different IL-6 concentrations on the expression of VSMC calcification marker genes in vitro;

[0033] Figure 7 Transcriptome sequencing was used to analyze the effect of 1 ng / ml IL-6 on VSMC gene expression;

[0034] Figure 8 Transcriptome sequencing was used to analyze the effect of 200 ng / ml IL-6 on VSMC gene expression;

[0035] Figure 9 The Venn diagram was used to analyze the signaling pathways related to VSMC calcification regulated by IL-6;

[0036] Figure 10 This is a staining diagram for animal experiments analyzing the effects of high concentrations of IL-6 on liver and kidney function in type 2 diabetic mice;

[0037] Figure 11 This is a bar graph showing the effect of high concentration of IL-6 on vascular calcification marker genes in type 2 diabetic mice from animal experiments. DETAILED DESCRIPTION

[0038] The present invention is not limited to the following specific embodiments. Based on the disclosure of the present invention, a person skilled in the art may adopt a variety of other specific embodiments to implement the present invention. Any simple changes or modifications made to the design structure and concept of the present invention fall within the scope of protection of the present invention. It should be noted that the embodiments and features of the embodiments of the present invention may be combined with each other unless they conflict.

[0039] Example 1

[0040] 1. Detection method

[0041] Research subjects

[0042] Methods Serum from patients clinically diagnosed with type 2 diabetes and combined with vascular calcification at the First Affiliated Hospital of South China University between January 2022 and December 2024 was selected, including 107 type 2 diabetes control group and 121 type 2 diabetes patients with vascular calcification.

[0043] Eligibility criteria: Age 30-80 years; Type 2 diabetes diagnosed according to the American Diabetes Association criteria for at least 6 months; Clinical diagnosis of (absence of) coronary artery calcification by CT scan within the month prior to enrollment; Severe infection (e.g., sepsis, lung infection, diabetic foot infection) in the month prior to enrollment; Clinically significant systemic disease other than Type 2 diabetes (e.g., tumor, cerebral infarction, uremia); Solid organ surgery; Clinically confirmed hemoglobinopathy or anemia; History of drug or alcohol abuse (defined as >80 g / day for men and >40 g / day for women); Acute cardiovascular event within 6 months; Current or acute illness; History of psychiatric illness that would prevent participants from understanding the nature, scope, and potential consequences of the study.

[0044] IL-6 was performed in the laboratory department of the First Affiliated Hospital of South China University of Technology. The operation was as follows: the IL-6 level in serum was detected by using an IL-6 detection kit (Star Medical Technology (Suzhou) Co., Ltd.), serum and detection reagent were added to reagent well 1 in a ratio of 1:3, and 120 μl of washing solution was respectively aspirated into reagent wells 2 and 3. After scanning or entering the IL-6 operating parameters, the detection was completed by a cyclic enhanced fluorescence analyzer produced by Star Child Medical Technology (Suzhou) Co., Ltd.

[0045] 2. Results Analysis

[0046] like Figure 1 As shown, a total of 69 patients with type 2 diabetes and 162 patients with type 2 diabetes and vascular calcification were included. The median serum IL-6 concentration in patients with type 2 diabetes was 37.5 pg / ml (range, 21.6-72.9 pg / ml), while the average serum IL-6 concentration in patients with type 2 diabetes and vascular calcification was 6.7 pg / ml (range, 3.5-12.7 pg / ml), with a highly significant difference between the two (p < 0.05).

[0047] Example 2

[0048] 1. Detection method

[0049] Clinical data were collected from the samples, including IL-6, type 2 diabetes vascular calcification (T2D VC), gender, age, blood glucose (GLU), glycosylated hemoglobin percentage (HBA1C%), CRP, total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL), low-density lipoprotein (LDL), apolipoprotein A1 (ApoA1), and apolipoprotein B (ApoB). Sample selection was the same as in Example 1. Correlations in these data were analyzed using a correlation coefficient matrix.

[0050] 2. Results Analysis

[0051] like Figure 2As shown, IL-6 is significantly negatively correlated with vascular calcification in type 2 diabetes and with increasing age. Furthermore, IL-6 is not significantly correlated with common serum markers of T2D (glucose (GLU), glycosylated hemoglobin percentage (HBA1C%), CRP, total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL), low-density lipoprotein (LDL), apolipoprotein A1 (ApoA1), and apolipoprotein (ApoB)). However, the incidence of vascular calcification in type 2 diabetes is significantly lower in men than in women.

[0052] Example 3

[0053] 1. Detection method

[0054] Based on the results of correlation coefficient matrix analysis, age indicators significantly correlated with IL-6, and IL-6 and gender indicators significantly correlated with vascular calcification in type 2 diabetes were screened. The accuracy of IL-6, gender, and age in predicting vascular calcification in type 2 diabetes was analyzed using the ROC curve.

[0055] 2. Results Analysis

[0056] The results are as follows Figure 3 As shown, the AUCs for age, sex, and IL-6 were 0.51, 0.56, and 0.90, respectively. Only IL-6 showed significant differences (p = 0.008). At the optimal threshold (Youden index), the sensitivity and specificity were 100%. Compared to type 2 diabetes vascular calcification, which is highly correlated with age and sex, IL-6 has higher sensitivity and predictive value.

[0057] Example 4

[0058] 1. Detection method

[0059] Based on the serum IL-6 levels of patients with type 2 diabetes and type 2 diabetic vascular calcification, the relationship between IL-6 concentration and the incidence of type 2 diabetes was analyzed using KM survival curves. The accuracy of predicting type 2 diabetic vascular calcification based on IL-6 levels was also analyzed using receiver operating characteristic (ROC) curves.

[0060] 2. Results Analysis

[0061] The results are as follows Figure 4 As shown, when the serum concentration of IL-6 is lower than 14.31 pg / ml, the prevalence of vascular calcification in patients with type 2 diabetes is high, reaching 92.8%. However, when the serum concentration of IL-6 is greater than 14.31 pg / ml, the prevalence of vascular calcification in patients with type 2 diabetes is significantly reduced to 36.6%.

[0062] In order to determine the accuracy of predicting type 2 diabetes vascular calcification based on IL-6 levels, the present invention collected samples from patients with type 2 diabetes (33 cases) and type 2 diabetes combined with vascular calcification (57 cases), 90 cases, and detected the IL-6 level in serum using an IL-6 detection kit (Star Medical Technology (Suzhou) Co., Ltd.). The serum and detection reagent were added to reagent well 1 in a ratio of 1:3, and 120 μl of washing solution was respectively drawn into reagent wells 2 and 3. After scanning or inputting the IL-6 operating parameters, the detection was completed by a cyclic enhanced fluorescence analyzer produced by Star Child Medical Technology (Suzhou) Co., Ltd. The serum concentration of IL-6 was 14.31 pg / ml as the dividing line. Patients with vascular calcification below 14.31 pg / ml were judged as type 2 diabetes patients, and those with a concentration above 14.31 pg / ml were judged as type 2 diabetes patients. The results are as follows Figure 5 As shown, the model AUC was 0.826 (95% CI 0.73–0.92), with a sensitivity of 93.4% and a specificity of 71.4% at the optimal threshold (Youden index).

[0063] Example 5

[0064] In vitro experiments were conducted to analyze the effects of IL-6 on mouse vascular smooth muscle cells.

[0065] 1. Detection method

[0066] Vascular smooth muscle cells were stimulated with 0, 1, and 200 ng / ml of IL-6 and cultured at 37°C, 5% CO2 for 48 h. The cells were collected and total RNA was extracted according to the kit instructions (Cornwell, CW0584). The procedure is as follows: resuspend the cell pellet in 1 ml of Trizol, let it stand at room temperature for 5 minutes, then add 0.2 ml of chloroform, shake vigorously for 15 seconds, and let it stand at room temperature for 3 minutes. After centrifugation at 12,000 rpm for 10 minutes, transfer 0.4 ml of the colorless aqueous phase to a new EP tube and add 0.5 volumes of anhydrous ethanol to mix thoroughly. Transfer the resulting solution to an adsorption column and centrifuge at 12,000 rpm at 4°C for 30 seconds. Add 0.5 ml of deproteinization buffer to the column and centrifuge at 12,000 rpm at 4°C for 30 seconds. Repeat this step once more, add 0.5 ml of rinse buffer to the column, centrifuge at 12,000 rpm at 4°C for 30 seconds, and repeat this step once more. Centrifuge at 12,000 rpm at 4°C for 2 minutes, remove the lid, and let it stand at room temperature for 10 minutes. Add 30 μl of RNase-free water, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm at 4°C for 2 minutes. The eluate is the total RNA solution, which is used for concentration determination.

[0067] Total RNA was reverse transcribed into cDNA according to the instructions for the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific (China) Co., Ltd., N8080234). The procedure was as follows: 0.5 μg of RNA was mixed with the kit reagents in the appropriate proportions and incubated at 42°C for 1 hour and then at 70°C for 5 minutes. The resulting liquid was cDNA.

[0068] Next, the cDNA was used for qRT-PCR to analyze the expression of Runx2, Bmp2, αSma, Sm22α, and Gapdh as follows:

[0069] The qPCR reaction was divided into five tubes and PCR was performed simultaneously. The reagent components of each tube were as follows:

[0070] Table 1 Reagent components of the first tube

[0071] Reagent components Volume (μl) 2×TB Green(takara) 5 The above cDNA 0.5 Mouse Runx2 forward primer (10 μM) 0.5 Mouse Runx2 reverse primer (10 μM) 0.5 <![CDATA[ddH2O]]> 3.5

[0072] Table 2 Reagent components of the second tube

[0073] Reagent components Volume (μl) 2×TB Green(takara) 5 The above cDNA 0.5 Mouse Bmp2 forward primer (10 μM) 0.5 Mouse Bmp2 reverse primer (10 μM) 0.5 <![CDATA[ddH2O]]> 3.5

[0074] Table 3 Reagent components of the second tube

[0075] Reagent components Volume (μl) 2×TB Green(takara) 5 The above cDNA 0.5 Mouse αSma forward primer (10 μM) 0.5 Mouse αSma reverse primer (10 μM) 0.5 <![CDATA[ddH2O]]> 3.5

[0076] Table 4 Reagent components of the second tube

[0077] Reagent components Volume (μl) 2×TB Green(takara) 5 The above cDNA 0.5 Mouse Sm22α forward primer (10 μM) 0.5 Mouse Sm22α reverse primer (10 μM) 0.5 <![CDATA[ddH2O]]> 3.5

[0078] Table 5 Reagent components of the third tube

[0079] Reagent components Volume (μl) 2×TB Green(takara) 5 The above cDNA 0.5 Mouse Gapdh forward primer (10 μM) 0.5 Mouse Gapdh reverse primer (10 μM) 0.5 <![CDATA[ddH2O]]> 3.5

[0080] Among them, the sequence of Runx2 is:

[0081]

[0082] The sequence of Bmp2 mRNA is:

[0083]

[0084] The sequence of αSma mRNA is:

[0085]

[0086] The sequence of Sm22α mRNA is as follows:

[0087] ATGGCCAACAAGGGTCCATCCTACGGCATGAGCCGAGAAGTGCAGTCCAAAATTGAGAAGAAGTATGACGAGGAGCTGGAGGAGCGACTAGTGGAGTGGATTGTAGTGCAGTGTGGCCCTGATGTAGGCCGCCCAGATCGTGGGCGCCTGGGCTTCCAGGTGTGGCTGAAGAATGGTGTGATTCTGAGCAAATTGGTGAACAGCCTGTATCCTGAGGGATCGAAGCCAGTGAAGGTGCCTGAGAACCCACCCTCCATGGTCTTTAAGCAGATGGAACAGGTGGCTCAATTCTTGAAGGCAGCTGAAGATTATGGAGTCATCAAGACTGACATGTTCCAGACTGTTGACCTCTATGAAGGTAAGGATATGGCAGCAGTGCAGAGGACTCTAATGGCTTTGGGCAGTTTGGCTGTGACCAAAAACGATGGAAACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGACTTCACAGACAGCCAACTGCAGGAGGGGAAGCACGTCATTGGCCTTCAAATGGGCAGCAACAGAGGAGCCTCGCAGGCTGGCATGACAGGCTATGGGCGACCCCGGCAGATCATCAGTTAG(SEQ ID NO.14).

[0088] The sequence of Gapdh mRNA is as follows:<000​

[0090] The forward primer sequence for amplifying mouse Runx2 was TGTCCGCCACCACTCACTACC (SEQ ID NO.1), and the reverse primer sequence was GGGAACTGATAGGATGCTGACGAAG (SEQ ID NO.2); the forward primer sequence for amplifying mouse Bmp2 was AAGCGTCAAGCCAAACACAAACAG (SEQ ID NO.3), and the reverse primer sequence was GAGGTGCCACGATCCAGTCATTC (SEQ ID NO.4); the forward primer sequence for amplifying mouse αSma was CGTGGCTATTCCTTCGTGACTACTG (SEQ ID NO.5), and the reverse primer sequence was CGTCAGGCAGTTCGTAGCTCTTC (SEQ ID NO.6); the forward primer sequence for amplifying mouse Sm22α was ACTCTAATGGCTTTGGGCAGTTTGG (SEQ ID NO.7), and the reverse primer sequence was CCTCTTATGCTCCTGGGCTTTCTTC (SEQ ID NO.8). Mouse Gapdh was used as the internal reference gene, the forward primer sequence was TGTTTCCTCGTCCCGTAG (SEQ ID NO. 9), and the reverse primer sequence was CAATCTCCACTTTGCCACT (SEQ ID NO. 10).

[0091] The PCR reaction procedure is as follows:

[0092] Stage 1: Pre-denaturation at 94°C for 30 seconds;

[0093] Stage 2: PCR reaction (40 cycles);

[0094] Denaturation at 94°C for 5 seconds;

[0095] Anneal at 60℃ for 30 seconds.

[0096] 2. Results Analysis

[0097] The results are as follows Figure 6 As shown, Runx2 is a promoter gene for osteogenic differentiation of vascular smooth muscle cells, Bmp2 is a marker gene for vascular smooth muscle cell calcification, and αSma and Sm22α are smooth muscle cell marker genes. In vascular smooth muscle cells treated with IL-6, Runx2 and Bmp2 were significantly upregulated by 1.23-fold and 1.24-fold, respectively, at 1 ng / ml, while αSma and Sm22α were significantly altered. At 200 ng / ml, Runx2 was significantly downregulated by 1.33-fold.

[0098] Example 6

[0099] 1. Detection method

[0100] After 48 hours of stimulation with 0, 1, and 200 ng / ml of IL-6, vascular smooth muscle cells were harvested and sent to Shanghai Tianhao Biotechnology Co., Ltd. for transcriptome sequencing. Compared with the control group, 2-fold differentially expressed genes were screened, and related signaling pathways were enriched using KEGG, and co-regulated signaling pathways were analyzed using Venn diagrams.

[0101] 2. Results Analysis

[0102] The results are as follows Figure 7-9 As shown, transcriptome sequencing found that compared with the 0ng / ml IL-6 group, there were 138 genes with 2-fold significant differences in vascular smooth muscle cells treated with 1ng / ml IL-6 (62 downregulated, 76 upregulated); there were 456 genes with 2-fold significant differences in vascular smooth muscle cells treated with 200ng / ml IL-6 (252 downregulated, 204 upregulated). The significantly different genes in each group were compared with the vascular smooth muscle cell transcriptome sequencing GEO data (GSE37558), and KEGG cluster analysis was performed separately. The common signaling pathways were then analyzed using Venn diagrams. The results showed that the PI3K-AKT signaling pathway was a common signaling pathway in the three groups of data. Activation of the PI3K-Akt signaling pathway significantly inhibited vascular calcification. The above results indicate that IL-6 is indeed involved in regulating vascular calcification.

[0103] Example 7

[0104] First, type 2 diabetic mice were constructed. The present invention selected male C57BL / 6J mice aged 8-10 weeks, and after feeding with a high-fat diet (45% fat, Nantong Trophy Feed Technology Co., Ltd.) for 6 weeks, the model mice were determined to have insulin resistance by intraperitoneal glucose tolerance test (IPGTT, glucose 2.0 g / kg) and intraperitoneal insulin tolerance test (IPITT, insulin amount 0.5 U / kg); then, streptozotocin (STZ) was injected intraperitoneally at a dose of 40.0 mg / kg, once a day, for three consecutive days. After one week, the fasting blood glucose was greater than 11.1 mM for two consecutive days and was significantly higher than that of the mice fed with the control diet (10% fat, Nantong Trophy Feed Technology Co., Ltd.), and the type 2 diabetic mice were considered to be successfully modeled.

[0105] 1. Detection method

[0106] Type 2 diabetic mice were injected with 2pg and 10pg of IL-6 via the tail vein, while the control group received an equal amount of PBS twice a week for 8 weeks.

[0107] 2. Results Analysis

[0108] The results are as follows Figure 10As shown, IL-6 injection had no obvious pathological changes in the liver, kidney, and spleen of type 2 diabetic mice.

[0109] Example 8

[0110] 1. Detection method

[0111] Type 2 diabetic mice were injected with the IL-6 construct described in Example 7. After isoflurane anesthesia and ethanol immersion for 5 minutes, the abdominal and thoracic cavities were opened along the midline of the abdomen, and PBS was perfused apically with a 5 ml syringe until the liver turned pale. The viscera were then removed, and the aorta was dissected along the spinal column using a scalpel. The aorta was then microscopically dissected of extravascular adipose tissue. The treated aorta was then placed in 1 ml of Trizol and ground using a tissue grinder. Total RNA was then extracted, cDNA synthesized, and analyzed by qRT-PCR as described above.

[0112] 2. Results Analysis

[0113] The results are as follows Figure 11 As shown, 2pg of IL-6 injection significantly promoted the expression of Runx2, a marker gene for vascular calcification; while 10pg of IL-6 injection significantly inhibited the expression of Runx2. The gold standard for the detection of vascular calcification in clinical practice is to detect it through imaging and other means, but it is unable to detect osteoblastically differentiated vascular wall cells and the extremely small calcified plaques that have been formed. Vascular calcification is an irreversible process, so molecular detection has become an important means of identifying early calcification. Among them, Runx2 is a key promoter gene for VSMC osteogenic differentiation (Li W et al., J Clin Invest. 2022; 132(1):e150051.), and significant upregulation is considered to be an important marker of VSMC osteogenic differentiation (Furmanik M et al., Arterioscler Thromb Vasc Biol. 2021; 41(2):898-914; Zhang S et al., Front Pharmacol. 2022; 13:932092). This concentration-dependent effect suggests that IL-6 may have a bidirectional regulatory effect on the process of vascular calcification in type 2 diabetes: low concentrations promote the pathological process by activating calcification-related genes, while high concentrations exhibit an inhibitory effect.

[0114] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. Application of reagents for detecting IL-6 expression levels in the preparation of drugs for diagnosing diabetic vascular calcification.

2. The use according to claim 1, characterized in that The diabetic vascular calcification is type 2 diabetic vascular calcification.

3. The use according to claim 1, characterized in that The reagent for detecting the IL-6 expression level is an IL-6 detection kit.

4. The use according to claim 1, characterized in that When the IL-6 expression level was greater than 14.31 pg / ml, the possibility of diabetic vascular calcification was low.

5. A reagent for diagnosing diabetic vascular calcification, characterized in that: The method comprises at least one reagent for detecting the expression level of IL-6.

6. Use of reagents that increase IL-6 expression levels in the preparation of drugs for the treatment of diabetic vascular calcification.

7. The use according to claim 6, characterized in that The reagents for increasing the expression level of IL-6 include IL-6 protein, a gene for editing IL-6 protein, a recombinant vector containing a gene for editing IL-6 protein, or an upstream protein in the synthesis pathway of IL-6 protein.

8. The use according to claim 6, characterized in that IL-6 expression level in cells is not less than 200ng / ml, which inhibits diabetic vascular calcification.

9. The use according to claim 6, characterized in that The application includes inhibiting the occurrence and development of vascular calcification in diabetic patients.

10. A drug for treating diabetic vascular calcification, characterized in that: The method comprises at least one agent for increasing the expression level of IL-6.

Images