COMPOSITIONS COMPRISING SEQUENCE-SPECIFIC ENDOribonucleASES AND METHODS OF USE

Abstract

The present disclosure provides compositions comprising sequence-specific endo ribonuclease enzymes and methods of use thereof in RNA analysis, RNA synthesis, and fingerprint analysis of RNA molecules. In particular, the present disclosure relates to compositions and samples comprising a ToxN endonuclease that recognizes and 5 cleaves single-stranded RNA and optimized conditions for obtaining cleavage.

Description

Technical Field

[0001] The present disclosure provides compositions comprising sequence-specific endoribonucleases and methods of using the same in RNA analysis and RNA synthesis. Specifically, the present disclosure relates to compositions comprising ToxN endoribonucleases (ToxIN subfamily of type III toxin-antitoxin systems). ToxN endoribonucleases recognize and cleave single-stranded ribonucleic acid (RNA) molecules. Background Art

[0002] Endoribonucleases are a group of enzymes that cleave internal phosphodiester bonds between adjacent RNA nucleotides in single-stranded RNA or double-stranded RNA (depending on the enzyme). Endoribonucleases can be sequence-specific (e.g., restriction endoribonucleases) or sequence-independent.

[0003] Some endoribonucleases are known, such as RNase H (ribonuclease H), which is a family of sequence-independent endoribonucleases that catalyze the cleavage of RNA in RNA / DNA hybrid substrates.

[0004] Endoribonucleases have several applications in molecular biology research, such as RNA removal during DNA extraction and recombinant protein purification, cDNA synthesis, RNA fingerprinting, and detection of RNA modifications (e.g., 5′ capping of mRNA).

[0005] Therapeutic RNA molecules (such as mRNA molecules encoding antigens for vaccine production) represent an emerging class of drugs. Successful protein expression from transfected mRNA depends not only on transfection efficiency but also on mRNA stability and translation efficiency. The 5' cap structure and 3' poly (A) tail are important features for achieving high translation efficiency. Therefore, there is a great need for an effective method for measuring the 5' capping efficiency of mRNA or other RNA modifications.

[0006] Analytical methods such as gel electrophoresis, ion-pair reversed-phase high-performance liquid chromatography (IP RP HPLC), or mass spectrometry (MS) are commonly used to analyze RNA modifications.

[0007] However, the identification of capping integrity of long RNA molecules (i.e., RNA molecules longer than 5-10 ribonucleotides) is problematic because capping results in only a small change in molecular weight of approximately 600 Da, which is roughly equivalent to one ribonucleotide. Due to poor resolution, this small change in molecular weight hinders direct downstream gel- or mass spectrometry (MS)-based analysis of long mRNA molecules.

[0008] Alternative capping molecules lead to different products that exhibit only small changes in molecular weight: for example, Cap-1 or Cap-0, 5'-triphosphate, 5'-diphosphate, unmethylated G-cap, inverted cap.

[0009] To overcome the poor resolution of existing analytical tools, RNA samples, especially those containing long RNA molecules, need to be cut into shorter fragments before further analysis.

[0010] Currently standard methods for RNA cleavage are endoribonuclease-based cleavage using enzymes with high cleavage frequencies such as RNase I, RNase H-based methods, ribozyme-based methods, or DNAzyme-based methods.

[0011] Endoribonucleases with a high cleavage frequency, such as RNase I, cleave single-stranded RNA after every G. Such enzymes are not optimal for some RNA analysis methods because they result in a high degree of fragmentation.

[0012] RNase H, which cleaves RNA / DNA hybrids, relies on specific DNA hybridization (AU2016297778), and even when the DNA probe is properly hybridized, RNase H-based methods suffer from nonspecific and incomplete cleavage of the target RNA. Therefore, RNase H-based methods require optimization of conditions for each hybridized RNA-DNA oligonucleotide pair to achieve complete and specific digestion of the RNA.

[0013] The Csy4 endoribonuclease relies on a guide RNA (RNA) to recognize and cleave its RNA target sequence.

[0014] Recently, it has been described that ribozymes can also be applied to sequence-specific cleavage of mRNA, Vlatkovic et al., Ribozyme assays for quantifying the capping efficiency of in vitro transcribed mRNA, Pharmaceutics, 2022, Vol. 14, No. 2, p. 328, and WO2015101416.

[0015] However, ribozymes rely on RNA synthesis and need to be used in 1-10 times excess of the substrate concentration to be analyzed. Ribozymes are catalytic RNA molecules and are therefore more expensive to produce and more difficult to use due to their lack of stability.

[0016] DNA enzymes are catalytically active DNA oligonucleotides, similar to ribozymes. The most abundant class of deoxyribozymes is ribonucleases, which catalyze the cleavage of phosphodiester bonds of ribonucleotides. Hengesbach, M. et al., Use of DNAzymes for site-specific analysis of ribonucleotide modification, RNA, 2008, Vol. 14, No. 1, pp. 180-187.

[0017] Despite the existence of endoribonucleases, there remains a need to provide further endoribonucleases that allow for efficient and simplified methods for RNA analysis or RNA synthesis, thereby overcoming one or more disadvantages of endoribonucleases and prior art methods.

[0018] The inventors have surprisingly and for the first time shown that sequence-specific endoribonucleases from the ToxIN subfamily of type III toxin-antitoxin systems specifically cleave single-stranded RNA at their recognition sites in the presence of specific concentrations of monovalent salts, i.e., in the absence of monovalent salts or in the presence of low to moderate concentrations of monovalent salts, the nonspecific catalytic activity of the enzyme (also called star-activity) is reduced.

[0019] The inventors also unexpectedly determined for the first time that the catalytic activity of the endoribonuclease of the ToxIN subfamily of the type III toxin-antitoxin system is inhibited by a certain concentration of divalent metal cations (which is contrary to other endoribonucleases), that is, the enzyme tolerates a certain low concentration of divalent metal cations, but its enzymatic activity is inhibited at higher concentrations.

[0020] The inventors also unexpectedly determined for the first time that the non-specific catalytic activity (i.e., its star activity) of the ToxN endoribonuclease subfamily is reduced or abolished at low concentrations of divalent metal cations. Thus, the ToxN endoribonuclease family is independent of divalent metal cations for its catalytic activity.

[0021] The present inventors have also shown that it is not necessary to remove divalent metal cations from the reaction mixture containing ToxN endoribonuclease, but rather that sequence-specific catalytic activity can be obtained in the presence of divalent metal cation chelators such as EDTA or EGTA. This is a significant advantage because RNA samples are typically stored in buffers containing EDTA to prevent degradation by RNases.

[0022] In the case of other well-known endoribonucleases, such sequence-specific catalytic activity was not observed at certain concentrations of monovalent salts, and non-specific RNA cleavage was reduced in the absence or at low concentrations of divalent metal cations.

[0023] Divalent metal cations are known to stabilize the three-dimensional structure of RNA and proteins.

[0024] Without being bound by theory, RNA cleavage can be more complete in the absence or in the presence of low concentrations of divalent metal cations because such reaction conditions destabilize the three-dimensional structure of the RNA, thereby improving the accessibility of the ToxN endoribonuclease to its target site in the RNA molecule and reducing the amount of enzyme required for complete digestion.

[0025] In addition, as mentioned above, this type of endoribonuclease has the advantage of digesting single-stranded RNA at a specific site without the need for hybridization DNA probes or RNA guide oligomers (oligo, oligonucleotides). Compared with catalytic nucleic acids such as ribozymes or DNA enzymes that require 1-10 times of excess RNA substrate concentration, the ToxN endoribonuclease family is also more effective and more stable.

[0026] The advantages of ToxN endoribonucleases over other well-known endoribonucleases make this family of endoribonucleases particularly useful in in vitro methods for analyzing RNA molecule modifications, such as the efficiency of 5' capping and poly(A) tail generation of synthetically transcribed RNA molecules. Also provided herein are uses of ToxN in methods for RNA fingerprinting and for generating precursor RNA molecules from rolling circle transcription (RCT). Summary of the Invention

[0027] In a first aspect, a composition comprising an isolated ToxN endoribonuclease or an enzymatically active fragment thereof is provided, wherein the concentration of the monovalent salt in the composition is ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt.

[0028] The ToxN endoribonuclease described herein comprises the pFam domain PF13958.

[0029] In one embodiment of the first aspect, the composition comprises an alkali metal salt at a concentration of about ≤75 mM, such as about ≤55 mM, such as about 20 mM to about 75 mM, such as about 20 mM to about 55 mM.

[0030] In one embodiment of the first aspect, the composition is a solution applied to a sample comprising at least one polyribonucleic acid (RNA) molecule.

[0031] In one embodiment of the first aspect, the sample has a volume of about ≥ 0.1 μl.

[0032] In one embodiment of the first aspect, the volume of the sample is from about 0.1 μl to about 500 μl, preferably from about 0.1 μl to about 300 μl, preferably from about 0.1 μl to about 250 μl, preferably from about 0.1 μl to about 200 μl, more preferably from about 0.1 μl to about 150 μl, more preferably from about 0.1 μl to about 100 μl, more preferably from about 0.1 μl to about 75 μl, more preferably from about 0.1 μl to about 50 μl.

[0033] In one embodiment of the first aspect, the monovalent salt of the composition or sample is an inorganic salt comprising an alkali metal ion.

[0034] Therefore, the monovalent salt is preferably an alkali metal salt.

[0035] In one embodiment of the first aspect, the alkali metal ion of the salt is selected from Na + , K + 、Li + , Rb + 、Cs + and Fr. + or any combination thereof.

[0036] In one embodiment of the first aspect, the alkali metal ion is selected from Na + , K + 、Li + and Rb + .

[0037] In one embodiment of the first aspect, the anion of the salt comprising an alkali metal ion is preferably selected from fluoride (F), chloride (Cl), bromide (Br), iodine (I), sulfate, phosphate or hydroxide or any suitable combination thereof.

[0038] In one embodiment of the first aspect, the alkali metal salt is selected from NaCl, KCl, Na2SO4, K2SO4, KOH, NaOH, Na-phosphate, K-phosphate, or any suitable combination.

[0039] In one embodiment of the first aspect, the composition is substantially free of divalent metal cations.

[0040] The divalent metal cation is preferably Mg 2+ or Mn 2+ .

[0041] In one embodiment of the first aspect, the composition is substantially free of divalent metal cations, ie, the concentration of divalent metal cations in the composition is about ≤ 3 mM, preferably about ≤ 2 mM, more preferably about ≤ 1 mM.

[0042] In one embodiment of the first aspect, the composition is substantially free of divalent metal cations, i.e., the ratio of the concentration of divalent metal cations to the concentration of divalent ion chelating agent in the composition is such that the concentration of free divalent metal cations present in the composition is about ≤ 3 mM, preferably about ≤ 2 mM, more preferably about ≤ 1 mM.

[0043] In one embodiment of the first aspect, the composition comprises the divalent ion chelator at a concentration of about ≤ 10 mM.

[0044] The divalent ion chelator is preferably EDTA or EGTA.

[0045] In one embodiment of the first aspect, the isolated ToxN enzyme is a ToxN enzyme from Escherichia coli (E. coli).

[0046] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or an enzymatically active fragment thereof comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 30% identity to SEQ ID No. 1.

[0047] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or an enzymatically active fragment thereof comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 70% identity to SEQ ID No. 1.

[0048] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or an enzymatically active fragment thereof comprises the amino acid sequence of SEQ ID No. 1, or an amino acid sequence that is at least 75%, 80%, 85%, 90%, 92%, 94%, 95%, 98% or 99% identical to SEQ ID No. 1.

[0049] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or enzymatically active fragment thereof comprises an amino acid sequence of an endoribonuclease having an amino acid sequence selected from the group consisting of:

[0050] - SEQ ID No. 6 or an amino acid sequence having at least 70% identity thereto,

[0051] - SEQ ID No. 7 or an amino acid sequence at least 70% identical thereto,

[0052] - SEQ ID No. 8 or an amino acid sequence having at least 70% identity thereto, or

[0053] - SEQ ID No. 13 or an amino acid sequence at least 70% identical thereto.

[0054] In one embodiment of the first aspect, the ToxN endoribonuclease has an amino acid sequence that is at least 75%, preferably at least 80%, 85%, 90% or 95%, such as at least 98% or 99% or 99.5% identical to SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 13.

[0055] In other embodiments of the first aspect, the ToxN endoribonuclease consists of an amino acid sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, and SEQ ID No. 13. Enzymatically active fragments thereof are also provided.

[0056] The isolated ToxN endoribonuclease disclosed herein does not complex with ToxI RNA.

[0057] In other embodiments of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 30% identity, such as 70% identity, to SEQ ID No. 1, wherein

[0058] - The concentration of the monovalent salt in the composition or sample is preferably about ≤ 100 mM, about ≤ 75 mM, about ≤ 55 mM, more preferably about 20 mM to about 75 mM, more preferably about 20 mM to about 55 mM.

[0059] In other embodiments of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 30% identity, such as at least 70% identity, to SEQ ID No. 1, wherein

[0060] - the concentration of the monovalent salt in the composition or sample is preferably about ≤ 100 mM, about ≤ 75 mM, about ≤ 55 mM, more preferably about 20 mM to about 75 mM, more preferably about 20 mM to about 55 mM;

[0061] And among them

[0062] - the composition or sample is substantially free of free divalent metal cations, wherein the divalent metal cation is preferably Mg 2+ or Mn 2+ , and wherein the divalent metal cation is provided as an inorganic salt, such as as MgCl2 or MnCl2.

[0063] In other embodiments of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 30% identity, such as at least 70% identity, to SEQ ID No. 1, wherein

[0064] - the concentration of the monovalent salt in the composition or sample is preferably about ≤ 100 mM, about ≤ 75 mM, about ≤ 55 mM, more preferably about 20 mM to about 75 mM, more preferably about 20 mM to about 55 mM;

[0065] And among them

[0066] - The concentration of free divalent metal cations is about ≤ 1 mM, the divalent metal cation is preferably Mg 2+ or Mn 2+ , and wherein the divalent metal cation is provided as an inorganic salt, such as as MgCl2 or MnCl2.

[0067] In other embodiments of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 30% identity, such as at least 70% identity, to SEQ ID No. 1, wherein

[0068] - the concentration of the monovalent salt in the composition or sample is preferably about ≤ 100 mM, about ≤ 75 mM, about ≤ 55 mM, more preferably about 20 mM to about 75 mM, more preferably about 20 mM to about 55 mM;

[0069] And among them

[0070] - the composition or sample comprises a ratio of divalent metal cation concentration to divalent ion chelator concentration in the composition or sample such that the concentration of free divalent metal cations present in the sample or composition is about ≤ 1 mM and the concentration of divalent ion chelator is about ≤ 10 mM

[0071] - The divalent metal cation is preferably Mg 2+ or Mn 2+, and is provided as an inorganic salt, such as MgCl2 or MnCl2, and

[0072] - The divalent ion chelator is preferably EDTA or EGTA.

[0073] In a second aspect, a method for cleaving a single-stranded RNA molecule in a sample is provided, wherein the method comprises the following steps:

[0074] a. providing a sample comprising at least one single-stranded RNA molecule comprising a ToxN endoribonuclease cleavage site; and

[0075] b. contacting ToxN endoribonuclease or an enzymatically active fragment thereof with at least one RNA molecule in the sample under conditions that allow cleavage of at least a portion of the RNA molecule present in the sample, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt.

[0076] In one embodiment of the second aspect, the single-stranded RNA molecule in step a) is a concatemer comprising multiple copies of a precursor of any one of mRNA, siRNA, circular RNA precursor, microRNA or ribozyme, and wherein the concatemer RNA molecule comprises a cleavage site for ToxN endoribonuclease between each copy of the precursor of any one of mRNA, siRNA, circular RNA, microRNA or ribozyme.

[0077] In one embodiment of the second aspect, the cleavage step is typically an incubation that allows cleavage of at least a portion of the RNA molecules present in the sample.

[0078] In one embodiment of the second aspect, the compositions and samples comprising ToxN are as described in the first aspect and its embodiments.

[0079] In one embodiment of the second aspect, incubation occurs at about 10°C to about 50°C, such as about 10°C to 30°C, preferably about 15°C.

[0080] In one embodiment of the second aspect, the incubation time allowing cleavage of at least a portion of said RNA molecules present in the sample is from about 1 minute to about 2 hours, such as from about 5 minutes to about 1.5 hours, such as from about 15 minutes to about 1 hour.

[0081] In a third aspect, a method for preparing a single-stranded circular RNA molecule is provided, wherein the method comprises the following steps:

[0082] a. Providing a sample comprising at least one single-stranded RNA molecule, wherein the RNA molecule comprises a ToxN endoribonuclease cleavage site;

[0083] b. contacting ToxN endoribonuclease with at least one single-stranded RNA molecule under conditions that allow digestion of at least a portion of at least one RNA molecule present in the sample, thereby producing at least one RNA molecule comprising a 3'-PO4 end and a 5'-OH end, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt, and

[0084] c. contacting at least one of the cleaved RNA molecules with RtcB ligase under conditions permissive for ligation, thereby generating a circular RNA.

[0085] In one embodiment of the third aspect, the compositions and samples comprising ToxN are as described in the first aspect and its embodiments.

[0086] In another aspect, a method for synthesizing siRNA is provided. The method comprises the following steps:

[0087] a. Providing a sample comprising at least one rolling circle transcribed concatemeric RNA molecule, wherein the rolling circle transcribed concatemeric RNA molecule comprises cleavage sites for two different ToxN endoribonucleases, ToxN-A and ToxN-B, having different recognition sites, wherein the recognition site of ToxN-B is located between tandem repeats, and the recognition sequence of ToxN-A is located within the tandem repeats;

[0088] b. contacting the sample with a ToxN-B endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the RNA molecules present in the sample, thereby generating a single repeat sequence that forms a hairpin structure based on their sense-antisense sequence information; contacting the formed hairpin structure with a second ToxN-A enzyme that cleaves the RNA in the loop structure to form a double-stranded RNA molecule, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and

[0089] c. The overhang of the resulting portion containing the ToxN recognition site is removed by using a standard single-strand specific ribonuclease such as RNase T1, thereby generating double-stranded siRNA.

[0090] In one embodiment of the other aspects, the compositions and samples comprising ToxN are as described in the first aspect and embodiments thereof.

[0091] In a fourth aspect, a method for determining the 5'-capping efficiency of an RNA molecule is provided, wherein the method comprises the following steps:

[0092] a. Providing a sample comprising at least one single-stranded mRNA molecule, the single-stranded mRNA molecule comprising a ToxN endoribonuclease cleavage site in the 5'UTR of the mRNA;

[0093] b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the single-stranded RNA molecule to produce at least one 5'-terminal RNA fragment and at least one 3'-terminal RNA fragment; wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and

[0094] c. Isolating and detecting the RNA fragments from step b) and determining the presence of a 5'-capping modification at the 5' end of the 5' terminal RNA fragments.

[0095] In one embodiment of the fourth aspect, the 5' terminal RNA fragment has a length of about 2 to about 100 ribonucleotides, preferably 5 to 50, more preferably 5 to 10 ribonucleotides.

[0096] In one embodiment of the fourth aspect, the compositions and samples comprising ToxN are as described in the first aspect and embodiments thereof.

[0097] In a fifth aspect, a method for determining the length distribution of poly (A) tails of RNA molecules is provided, wherein the method comprises the following steps:

[0098] a. Providing a sample comprising at least one single-stranded mRNA molecule comprising a ToxN endoribonuclease cleavage site upstream of the mRNA poly (A) tail;

[0099] b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the single-stranded RNA molecule to produce at least one 5' terminal RNA fragment and at least one 3' terminal RNA fragment, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and

[0100] c. Isolating and detecting the RNA fragments from step b) and determining the length of the poly(A) tail at the 3' end of the 3' terminal RNA fragments.

[0101] In one embodiment of the fifth aspect, the compositions and samples comprising ToxN are as described in the first aspect and its embodiments.

[0102] In a sixth aspect, a method for RNA fingerprint analysis is provided, wherein the method comprises the following steps:

[0103] a. providing a sample comprising at least one single-stranded RNA molecule having an unknown sequence;

[0104] b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the RNA molecule, thereby obtaining a plurality of RNA fragments, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and

[0105] c. Isolating and detecting the fragmented RNA molecules from step b, thereby obtaining a fingerprint of the RNA molecules with unknown sequence, and comparing the obtained fingerprint with the fingerprint from the RNA molecules with known sequence.

[0106] In one embodiment of the sixth aspect, the compositions and samples comprising ToxN are as described in the first aspect and its embodiments.

[0107] In a seventh aspect, a method for analyzing a multivalent RNA composition is provided, wherein the method comprises the following steps:

[0108] a. providing a sample comprising a multivalent RNA composition comprising a first RNA species and a second RNA species, wherein at least one position of the first RNA species and the second RNA species comprises a cleavage site for a ToxN endoribonuclease;

[0109] b. contacting the sample from step a) with a ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the first RNA species and the second RNA species, thereby releasing a plurality of first RNA fragments and second RNA fragments from the first RNA species and the second RNA species, wherein the concentration of the monovalent salt in the sample is about ≤ 150 mM, such as about ≤ 100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and

[0110] c. Isolating and detecting the presence and / or amount of the released first RNA fragment and second RNA fragment.

[0111] In one embodiment of the sixth and seventh aspects, the RNA molecule is selected from the group consisting of mRNA, RNA virus, immunogenic RNA molecule, viroid, long non-coding RNA and ribozyme.

[0112] In one embodiment of the above method, the separation and detection steps are based on the different molecular weight, charge or length of the RNA fragments.

[0113] In one embodiment of the above method, the separation and detection steps are selected from gel electrophoresis, capillary gel electrophoresis (CGE), PAGE, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, IP RP HPLC and LC-UV.

[0114] In one embodiment of the seventh aspect, the compositions and samples comprising ToxN are as described in the first aspect and its embodiments.

[0115] In an eighth aspect, a kit is provided, comprising:

[0116] a. A composition according to the first aspect and embodiments thereof; and

[0117] b. a second composition comprising a second enzyme selected from the group consisting of: an RNA polymerase, an RNA ligase for ligating single-stranded RNA molecules, a pyrophosphatase, a phosphatase, a kinase, or any other nucleic acid or ribonucleic acid modifying enzyme, and at least one additional ToxN endoribonuclease having a different recognition site than the ToxN endoribonuclease of a). BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Figure 1 : DNA sequence of ToxIN from Escherichia coli (SEQ ID NO: 3), encoding the amino acid sequence SEQ ID NO: 1 (sequence with gray shading, also referred to herein as ET-N1); antitoxin repeat sequence transcribed into ToxI (sequence within the black box) (SEQ ID NO: 4); terminator (sequence within the dotted line).

[0119] Figure 2 : Analysis of ToxN (ET-N1) endoribonuclease activity spectrum: A: MW DNA ladder, B: 120nM ToxN, C: 60nM ToxN, D: 30nM ToxN; E: 15nM ToxN, F: 8nM ToxN, G: 4nM ToxN, H: 2nM ToxN, I: 0nM ToxN.

[0120] Figure 3: Analysis of ToxN (ET-N1) endoribonuclease activity spectrum: (1) 50 mM Tris-HCl pH 7.0, (2) 50 mM Tris-HCl pH 7.5, (3) 50 mM Tris-HCl pH 8.0, (4) 50 mM Tris-HCl pH 9.0; (A) MW DNA molecular weight standard; (B) control, no ToxN; (C) 0 mM NaCl; (D) 25 mM NaCl; (E) 50 mM NaCl, (F) 75 mM NaCl; (G) 100 mM NaCl; (H) 125 mM NaCl; (I) 150 mM NaCl, (J) 175 mM NaCl.

[0121] Figure 4a :ToxN (ET-N1) endoribonuclease activity spectrum analysis: (A): MW DNA molecular weight standard, (B): w / o ToxN, (C): 0mM MgCl2, (D): 1mM MgCl2; (E): 2mM MgCl2, (F): 3mM MgCl2, (G): 4mM MgCl2, (H): 5mM MgCl2, (I): 6mM MgCl2, (J): 7mM MgCl2

[0122] Figure 4b : ToxN (ET-N1) endoribonuclease activity profile analysis: Lanes 1 to 6: 10mM MgCl2, 5mM MgCl2, 3mM MgCl2, 1mM MgCl2, 0mM MgCl2, no enzyme added; Lanes 7 to 12: 10mM MnCl2, 5mM MnCl2, 3mM MnCl2, 1mM MnCl2, 0mM MnCl2, no enzyme added.

[0123] Figure 5 :ToxN (ET-N1) endoribonuclease activity spectrum analysis: (A): MW DNA molecular weight standard, (B): w / oToxN, (C): ToxN, (D): 5mM MgCl2, (E): 5mM EDTA, (F): 5mM DTT 5mM, (G): 5mM MgCl2, 5mMEDTA, (H): 5mM MgCl2, 10mM EDTA, (I): 5mM MgCl2, 5mM EDTA, 5mM DTT, (J): 5mM MgCl2, 10mMEDTA, 5mM DTT

[0124] Figure 6:ToxN (ET-N1) endoribonuclease activity spectrum analysis: (A): MW DNA molecular weight standard, (B): w / oToxN, (C): 5 minutes, (D): 10 minutes; (E): 15 minutes, (F): 20 minutes, (G): 30 minutes, (H): 40 minutes, (I): 50 minutes, (J): 60 minutes.

[0125] Figure 7 :ToxN (ET-N1) endoribonuclease activity spectrum analysis: (A): MW DNA molecular weight standard, (B): w / oToxN, (C): 6℃, (D): 7℃; (E): 10℃, (F): 13℃, (G): 17℃, (H): 22℃, (I): 27℃.

[0126] Figure 8 :ToxN (ET-N1) endoribonuclease activity spectrum analysis: (A): MW DNA molecular weight standard, (B): w / oToxN, (C): 25℃, (D): 25.2℃; (E): 26℃, (F): 27℃, (G): 29℃, (H): 31℃, (I): 33℃, (J): 33.6℃, ​​(K): 34℃, (L): 35℃, (M): 35.7℃, (N): 36℃.

[0127] Figure 9a : shows the concept of using ToxN endoribonuclease to determine the 5'-capping efficiency of mRNA transcripts.

[0128] Figure 9b : Depicts capping analysis of a 40-base IVT (in vitro translation) construct prepared using the commercial "CleanCap" kit. Dark grey triangles indicate 13-base (uncapped) and 14-base (capped) fragments following cleavage with E. coli ToxN1. Additional bands marked with white triangles are caused by RNA initiation slippage. Lane 1: DNA marker: bands 50, 20, 15, 8, and 6 bases; Lane 2: Capped IVT cleaved with E. coli ToxN1; Lane 3: Uncapped IVT cleaved with E. coli ToxN1; Lane 4: Uncut capped IVT; Lane 5: Uncut uncapped IVT. The plasmid was linearized with HindIII. The 40-base nucleotide mRNA has a ToxN1 (ET-N1) cleavage site 10 bases after the 5' end, resulting in two fragments of 13 and 27 bases, respectively. Successful capping can be manifested by a shift of the band to a higher molecular weight.

[0129] Figure 9c: Depicts capping analysis of IVT (in vitro translation) constructs. Gel images (left): Lane 1: ET-N1 enzyme and uncapped RNA oligomer (GEM3Zf); Lane 2: ET-N1 enzyme and capped RNA oligomer (GEM3Zf); Lane 3: Uncapped RNA oligomer (GEM3Zf) without enzyme; Lane 4: Capped RNA oligomer (GEM3Zf) without enzyme. The middle gel image is an excerpt from the left gel image. The right image shows quantification of capped (<<, p1) and uncapped (p2) mRNA fragments.

[0130] Figure 9d : Depicts capping analysis of IVT (in vitro translation) constructs. Lane 1: ET-N1 enzyme and uncapped RNA oligomer (GEM3Zf); Lane 2: ET-N1 enzyme and capped RNA oligomer (GEM3Zf); Lane 3: uncapped RNA oligomer (GEM3Zf) with / without enzyme; Lane 4: capped RNA oligomer (GEM3Zf) with / without enzyme.

[0131] Figure 10a Figure 1: The concept for mRNA fingerprint analysis of an unknown viral strain in a sample. S1, S2, and S3: RNA samples isolated from three different RNA viruses with unique distributions of ToxN recognition sites. V: RNA sample isolated from an unknown RNA virus. Analysis of the fragment distribution by electrophoresis confirmed that the unknown virus (V) is a type (S2).

[0132] Figure 10b : shows RNA fingerprint analysis by simultaneous digestion of two 20-nucleotide RNA substrates. ( and ). The FAM-labeled products differ by only one nucleotide, resulting in product bands of 15 and 14 nucleotides, respectively. Lane 1: Uncut MOD-UTR; Lane 2: Cut MOD-UTR; Lanes 3-6: Mixtures of MOD-UTR and Dist1 at ratios of 8:2, 6:4, 4:6, and 2:8; Lane 7: Cut Dist1; Lane 8: Uncut Dist1. Only the FAM-labeled product is visible.

[0133] Figure 10c :Describes the Figure 10b The band intensity of the FAM-labeled oligonucleotide is analyzed by the ratio of substrates in the mixture.

[0134] Figure 11: The concept of RNA production by rolling circle transcription (RCT) is shown. (1) DNA plasmid for mRNA production, (2) single-stranded plasmid, (3) RNA polymerase initiation site with ToxN recognition site, (4) RNA amplification once circularization is complete, (5) RNA will continue to amplify RNA, (6) long RNA strand with multiple copies of the target mRNA, (7) RNA is cleaved by ToxN endoribonuclease to obtain multiple copies of the mRNA. This process can be carried out simultaneously with RNA polymerase to continuously produce new mRNA.

[0135] Figure 12 Figure 2 shows a concatemer RNA sequence transcribed by rolling circle transcription to produce siRNA. The transcribed sequence contains ToxN recognition sequences for two different ToxN enzymes, ToxN-A and ToxN-B. The ToxN-B endoribonuclease digests the RNA between the concatemer RNA sequences. The concatemer RNAs hybridize to form a hairpin structure. The ToxN-A enzyme cleaves the RNA at its recognition site within the hairpin loop. The 5' and 3' ends of the concatemer RNA are then digested with a single-stranded specific RNase to remove the remainder of the ToxN recognition sequence, thereby producing the siRNA.

[0136] Figure 13 : Shows concatemers generated by IVT of Mango aptamers digested with EcoToxN1 (ET-N1) at decreasing enzyme concentrations. Lane 1: no enzyme; Lane 2: 95 nM EcoToxN1; Lane 3: 47 nM; Lane 4: 23 nM; Lane 5: 12 nM; Lane 6: 6 nM; Lane 7: 2 nM; Lane 8: 1 nM.

[0137] Figure 14 : Analysis of endoribonuclease activity profiles of EcoToxN1 (ET-N1), EcoToxN5 (ET-N5) and BtuToxN (BT-N1). Lane 1: RNA oligomer molecular weight standard; Lane 2: ET-N1 and Q1 RNA oligomer containing ET-N1 recognition site; Lane 3: Q1 RNA oligomer, w / o enzyme; Lane 4: ET-N5 and RS2 RNA oligomer containing ET-N5 recognition site; Lane 5: RS2 RNA oligomer, w / o enzyme; Lane 6: ET-N5 and RS3 RNA oligomer containing ET-N5 recognition site; Lane 7: RS3 RNA oligomer, w / o enzyme; Lane 8: UTR-sequence without ET-N5 recognition site; Lane 9: UTR-sequence, w / o enzyme; Lane 10: RS3 RNA oligomer with BT-N1 recognition site; Lane 11: RS3 oligomer, w / o enzyme. DETAILED DESCRIPTION

[0138] Unless otherwise defined herein, all technical and scientific terms used have the same meanings as commonly understood by one of ordinary skill in the fields of genetics, biochemistry, and molecular biology.

[0139] When numerical limitations or ranges are described herein, the endpoints are included. Additionally, all values ​​and subranges within the numerical limitations or ranges are specifically included as if expressly written.

[0140] All methods and materials similar or equivalent to those described herein can be used to practice or test the present invention, wherein suitable methods and materials are described herein. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, this specification (including definitions) will take precedence.

[0141] In the following description, various embodiments and implementations of the present invention are set forth to provide a more complete understanding of the present invention to those skilled in the art. The specific details described in the context of various implementations and with reference to the accompanying drawings are not intended to be considered as limiting.

[0142] definition:

[0143] “ polyribonucleotides "Polyribonucleotide" refers to a polymeric form of ribonucleotides. In some aspects, a polyribonucleotide consists solely of ribonucleotides. In other aspects, a polyribonucleotide includes ribonucleotides and one or more modified ribonucleotides, but does not include any deoxyribonucleotides. In other cases, a polyribonucleotide includes ribonucleotides and may include one or more modified ribonucleotides and one or more deoxyribonucleotides (including modified deoxyribonucleotides).

[0144] the term" RNA "," RNA, and "polyribonucleotide" are used interchangeably and refer to a polymeric form of ribonucleotides of any length.

[0145] “ Separated "Isolated" refers to a protein or nucleic acid (if naturally occurring) that is in an environment different from that in which it may naturally occur. "Isolated" is meant to include a sample that is substantially enriched for the protein or nucleic acid of interest and / or in which the protein or nucleic acid of interest has been partially or substantially purified. When the protein or nucleic acid does not occur in nature, "isolated" means that the protein or nucleic acid has been separated from its environment by synthetic or recombinant methods.

[0146] Endoribonuclease Cleavage of single-stranded or double-stranded RNA. The endoribonucleases described in this patent application cleave single-stranded RNA.

[0147] the term" RNA digestion "or" RNA cleavage ” are used interchangeably and refer to the hydrolysis of phosphodiester bonds within the polyribonucleotide backbone of a sample.

[0148] RNA digestion method is included in at least a portion of the single-stranded RNA present in the sample under the conditions of allowing digestion, and the sample comprising the single-stranded RNA is contacted with ToxN endoribonuclease.ToxN endoribonuclease is sequence-specific and, under the sufficient time and reaction conditions of allowing enzyme to function, will digest polyribonucleotides completely at their target site.The digestion of at least a portion of the single-stranded RNA present in the sample can be expressed as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% with numbers.Selectively, 100% single-stranded RNA present in the sample is digested, that is, all RNA molecules present in the sample are digested completely at their target site.

[0149] Endoribonucleases can cleave sequences similar to their target recognition sequences. This nonspecific activity is called " Star activity " and should preferably be avoided. In addition to the primary cleavage site, recognition and cleavage of secondary cleavage sites also give rise to star activity. The secondary cleavage sites differ from the primary recognition site by one or more ribonucleotides. Star activity is characterized by the appearance of additional bands in gel electrophoresis in addition to the fully digested band pattern resulting from specific cleavage.

[0150] the term" touch ,” “mixed,” “applied to,” “apply,” “added to,” and “added” have their ordinary meanings and are used interchangeably herein.

[0151] If terms, features, values ​​and ranges, etc. are used in conjunction with terms such as about, approximately, usually, substantially, essentially, at least, etc., the present invention also covers the exact terms, features, values ​​and ranges, etc. (i.e., "about 3" should also cover the exact 3, or "substantially free" should also cover "free / without").

[0152] the term" At least one ” should be understood as “one or more” and, thus, the term includes both embodiments containing one or more components.

[0153] ToxN is a family of endoribonucleases from the subfamily ToxIN of the type III toxin-antitoxin (TA) system. The toxin (ToxN) is a protein / enzyme, while the antitoxin (ToxI) is composed of multiple RNA repeats. The ToxN endoribonuclease described herein has a pFam domain PF13958. The toxic effects of the protein are neutralized by a specific antitoxin RNA sequence (ToxI). The toxin and each antitoxin repeat are assembled into a circular complex (complex, complex), wherein the antitoxin forms a pseudoknot structure. This RNA antitoxin is tightly bound to the toxin to form a heterotetrameric or heterohexameric ring, a unique self-closing RNA-protein complex, in which the toxin and antitoxin are alternately arranged in a 1:1 ratio, i.e., the ToxIN complex. The identification and functional characterization of the structure of the ToxN-antitoxin (RNA) complex from Escherichia coli are described in Manikandan, P. et al., Identification, functional characterization, assembly and structure of ToxIN type III toxin-antitoxin complex from E. coli, Nucleic acid research, 2022, Vol. 50, No. 3, pp. 1687-1700.

[0154] "ToxN" (endo-ribonuclease), "ToxI" (antitoxin RNA molecule / ToxN inhibitor), and "ToxIN" (heteromeric protein / RNA complex of ToxN and ToxI).

[0155] The DNA sequence encoding the ToxN endoribonuclease from Escherichia coli (NCBI accession number: PDB:7D8O_A) is neutralized by the RNA antitoxin ToxI and together they form an inactive ToxIN complex, e.g. Figure 1 and shown in SEQ ID NO:3.

[0156] The number of ribonucleotides in the recognition sequence of ToxN endoribonuclease can change. The recognition sequence can be 2 to 20 ribonucleotides. Preferably, the recognition sequence is 3 to 15 ribonucleotides, more preferably 4 to 10 ribonucleotides, 4 to 9 ribonucleotides or 4 to 6 ribonucleotides.

[0157] Non-limiting examples of ToxN endoribonucleases comprising the pFam domain PF13958 and their recognition sequences are shown in Table 1 below:

[0158] Table 1

[0159]

[0160] The type III toxin-antitoxin system includes at least three subfamilies of enzymes, the CptIN subfamily and the TenpIN subfamily, see Blower, TR et al., “Identification and classification of bacterial Type III toxin-antitoxin systems encoding in chromosomal and plasmid genomes”, Nucleic acid research, 2012, Vol. 40, No. 13, pp. 6158-6173.

[0161] According to the pFam classification, the endoribonuclease disclosed by the sequence CBK89509.1 does not belong to the ToxN subfamily. CBK89509.1 is classified into an alternative subfamily of the type III TA system, the CptIN subfamily.

[0162]

[0163] As mentioned above, the inventors unexpectedly and for the first time showed that in the presence of a specific concentration of monovalent salt, the sequence-specific endoribonuclease ToxN from the type III toxin-antitoxin system specifically cleaves single-stranded RNA at its recognition site, i.e., at a specific concentration of monovalent salt, the non-specific catalytic activity of the enzyme (also called star activity) is reduced or disappears.

[0164] The present inventors have also surprisingly determined for the first time that the presence of low concentrations or the absence of divalent metal cations (preferably Mg 2+ or Mn 2+ ), the nonspecific catalytic activity of ToxN (i.e., its star activity) is reduced or eliminated. Free divalent cations should be understood as not being bound to divalent ion chelators, such as EDTA or EGTA. Divalent cation concentrations exceeding a certain concentration can also inhibit the catalytic activity of ToxN. Without being bound by theory, divalent metal cations such as Mg present in the composition or sample 2+ or Mn 2+ Can bind to RNA, thereby inhibiting ToxN from accessing its target site.

[0165] The inventors have also surprisingly shown that divalent metal cations do not need to be removed from compositions or samples comprising ToxN endoribonuclease, but rather sequence-specific catalytic activity can be maintained by divalent cation chelators such as EDTA or EGTA.

[0166] In the context of divalent ion chelators, Essentially free of divalent metal cations " refers to the divalent cations (preferably Mg 2+ or Mn 2+ The ratio of the concentration of ) to the concentration of the divalent ion chelator (e.g., EDTA or EGTA) is 3:1 to 1:10, such as (e.g., Mg 2+ or Mn 2+ : EDTA or EGTA). This means that the ToxN enzyme tolerates low concentrations of divalent metal cations present in the sample that are not bound to the divalent ion chelator without losing its catalytic activity.

[0167] This has the advantage that the metals used in upstream applications and requiring divalent metal cations (such as Mg 2+ or Mn 2+ ) enzyme for optimal enzymatic activity, can be inactivated by the addition of a divalent ion chelator (e.g., EDTA or EGTA), and no subsequent purification step is required prior to the addition of ToxN, because ToxN catalytic activity and specificity are maintained when the composition or sample is substantially free of free divalent cations (i.e., the divalent cations are not bound to the divalent ion chelator).

[0168] Another advantage is that EDTA or EGTA present in the sample does not need to be removed, since the catalytic activity and specificity of the ToxN enzyme are not significantly affected by the presence of divalent ion chelators (such as EDTA or EGTA).

[0169] Compositions comprising isolated ToxN do not comprise the ToxIN complex.

[0170] The composition or sample comprising the isolated ToxN endoribonuclease or an enzymatically active fragment of ToxN may not comprise a monovalent salt.

[0171] The composition or sample comprising the isolated ToxN endoribonuclease or an enzymatically active fragment of ToxN may not comprise free divalent metal cations.

[0172] The ToxN endoribonuclease may be ToxN endoribonuclease from Escherichia coli or an enzymatically active fragment thereof.

[0173] It is to be understood that the expression "enzymatically active fragments thereof" of ToxN endoribonuclease refers to ToxN endoribonuclease wherein the endoribonuclease catalytic activity is retained in the truncated form.Example 3 provides a suitable assay for measuring endoribonuclease activity.

[0174] The ToxN endoribonuclease is preferably a ToxN having the amino acid sequence of SEQ ID NO: 1 (NCBI Accession No.: PDB: 7D8O_A), or an amino acid sequence having at least about 70% identity to SEQ ID NO: 1. An example of a sequence having at least 70% sequence identity to SEQ ID NO: 1 is the sequence of SEQ ID NO: 6. SEQ ID NO: 6 has 81.4% sequence identity to SEQ ID NO: 1.

[0175] The ToxN endoribonuclease may be a ToxN having the amino acid sequence of SEQ ID NO: 1 (NCBI accession number: PDB: 7D8O_A), or an amino acid sequence having at least about 30% identity to SEQ ID NO: 1. Examples of sequences having at least 30% sequence identity to SEQ ID NO: 1 are sequences having SEQ ID NO: 7 (30.95% identity), SEQ ID NO: 8 (32.5% identity), and SEQ ID NO: 13 (40.88% identity).

[0176] The ToxN endoribonuclease may be a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein ToxN comprises an amino acid sequence that is at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 98% or 99% identical to SEQ ID No. 1.

[0177] "At least about 30%" means that the sequence identity to SEQ ID No. 1 may be at least 29%, 29.5% or 29.9%.

[0178] "At least about 70%" means that the sequence identity to SEQ ID No. 1 may be at least 69%, 69.5% or 69.9%.

[0179] The ToxN endoribonuclease may consist of the amino acid sequence of SEQ ID No. 1. Enzymatically active fragments thereof are also provided.

[0180] An endoribonuclease having an amino acid sequence that is at least 30% identical to SEQ ID No. 1 can be obtained from a prokaryotic organism.

[0181] An endoribonuclease having an amino acid sequence at least 70% identical to SEQ ID No. 1 can be obtained from a prokaryotic organism.

[0182] Thus, in another aspect there is provided a composition comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, said ToxN endoribonuclease having an amino acid sequence selected from the group consisting of

[0183] (a) SEQ ID No. 6 or an amino acid sequence having at least 70% identity thereto,

[0184] (b) SEQ ID No. 7 or an amino acid sequence having at least 70% identity thereto,

[0185] (c) SEQ ID No. 8 or an amino acid sequence having at least 70% identity thereto, or

[0186] (d) SEQ ID No. 13 or an amino acid sequence at least 70% identical thereto.

[0187] In one embodiment, the ToxN endoribonuclease has an amino acid sequence that is at least 75%, preferably at least 80%, 85%, 90% or 95%, for example, at least 98% or 99% or 99.5% identical to SEQ ID No. 1, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 13. In other embodiments, the ToxN endoribonuclease consists of an amino acid sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8 and SEQ ID No. 13. Enzymatically active fragments thereof are also provided.

[0188] Variants of SEQ ID No. 1, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, and SEQ ID No. 13 include amino acid sequences in which one or more amino acids in the amino acid sequence are conservatively substituted. Preferably, such substitutions are silent substitutions, wherein the modified form of the ToxN endoribonuclease of the present invention has the same enzymatic activity as the unmodified form.

[0189] As used herein, when referring to "sequence identity" of a protein, an amino acid sequence that has at least X% identity to a second amino acid sequence means that X% represents the number of amino acid residues in the first sequence that are identical to the amino acid residues in the second sequence with which they match, relative to the total length of the second amino acid sequence, when the two sequences are optimally aligned using a global alignment. Using Clustal Omega (a multi-protein sequence alignment tool from EMBL-EBI) with default settings, the two sequences are optimally aligned when X is maximized.

[0190] Preferably, the composition is a solution, preferably an aqueous solution. As used herein, the term " solution ” refers to a liquid mixture in which one or more minor components (solutes) are uniformly distributed throughout the major component (solvent). Typically, the minor components (solutes) of the solution are soluble in the major component (solvent).

[0191] Preferably, the main component (ie solvent, ie liquid phase) is water. Preferably, the solution comprises water. The solution of the present invention comprises at least ToxN endoribonuclease or an enzymatically active fragment thereof as a minor component.

[0192] In a preferred embodiment, this solution is the reagent for being applied to the sample that comprises one or more RNA molecules.This reagent is applied to sample so that the one or more ribonucleotides that exist in the ToxN endoribonuclease digestion sample in the described reagent.Preferably, this sample comprises multiple ribonucleotide.In this embodiment, this solution comprises ToxN endoribonuclease or its enzymatic activity fragment.

[0193] The term "sample" refers to a composition comprising single-stranded RNA molecules.

[0194] The composition also comprises a buffer. Suitable buffers are well known in the art and any such buffer can be used. It is within the ability of those skilled in the art to identify a suitable buffer.

[0195] The buffer range of the buffer is about pH 5.5 to about pH 9, preferably about pH 6.5 to about pH 9, preferably about pH 7 to about pH 9, more preferably about pH 7 to about pH 8.5.

[0196] The buffer may be Tris, HEPES or phosphate buffer.Preferably, the buffer is present in the composition or sample at a concentration of 1 mM to 200 mM, preferably 10 mM to 200 mM, preferably 20 mM to 150 mM, more preferably 25 mM to 100 mM.

[0197] If present, preferably Tris-HCl is present at a concentration of 25 mM to 150 mM, more preferably 40 mM to 100 mM, more preferably about 50 mM.

[0198] The sample may have a volume of >0.1 μl. Preferably, the volume of the sample of the present invention is from about 0.1 μl to about 500 μl, such as from about 0.1 μl to about 300 μl, such as from about 0.1 μl to about 250 μl, such as from about 0.1 μl to about 200 μl, such as from about 0.1 μl to about 150 μl, such as from about 0.1 μl to about 100 μl, such as from about 0.1 μl to about 75 μl, such as from about 0.1 μl to about 50 μl.

[0199] The skilled person is able to determine the appropriate concentration of enzyme to include in the sample and reaction mixture to preferably obtain digestion of all RNA molecules in the sample, and at the same time avoid non-specific digestion and star activity.

[0200] The reaction mixture may contain other components that may be present because they were added earlier in the workflow and are tolerated during the reaction assay, such as DTT, nucleotides, S-adenosylmethionine (SAM), or other enzymes. DTT is a reducing agent that stabilizes disulfide bonds within the enzyme, thereby stabilizing the enzyme structure.

[0201] As described above, the composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof preferably comprises a monovalent salt at a specific concentration.

[0202] The monovalent salt present in the composition or sample may be selected from inorganic salts containing alkali metal ions, wherein the alkali metal ions are selected from Na + , K + 、Li + , Rb + 、Cs + and Fr. + or any combination thereof.

[0203] Thus, preferably, the monovalent salt is an alkali metal salt.

[0204] Preferably, the alkali metal ion of the salt is selected from Na + , K + 、Li + and Rb + .

[0205] The anion of the salt comprising an alkali metal ion is preferably selected from fluoride (F), chloride (Cl), bromide (Br), iodine (I), sulfate, phosphate or hydroxide or any suitable combination thereof.

[0206] Preferably, the alkali metal salt is NaCl, KCl, Na2SO4, K2SO4, KOH, NaOH, Na-phosphate, K-phosphate or any suitable combination.

[0207] Thus, preferably, a composition or sample comprising a certain concentration of a monovalent salt refers herein to a composition or sample comprising a monovalent salt concentration of ≤ 150 mM.

[0208] The term "about ≤ X mM" is equivalent to "0 to about X mM".

[0209] The composition or sample may not comprise a monovalent salt.

[0210] Thus, in one aspect, the composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof has a concentration of alkali metal salt in the composition or sample of <150 mM, about ≤100 mM, about ≤75 mM, about ≤55 mM, about 20 mM to about 75 mM, about 20 mM to about 55 mM.

[0211] As described above, the composition or sample comprising ToxN endoribonuclease or its enzymatically active fragment is substantially free of free divalent metal cations, i.e., the composition or sample may comprise low concentrations of divalent metal cations. Free divalent metal cations refer herein to divalent metal cations that are not combined with a divalent cation chelating agent (such as EDTA or EGTA).

[0212] Thus, the composition or sample may comprise free divalent metal cations at a concentration of about ≤ 3 mM.

[0213] The composition or sample may be free of free divalent metal cations.

[0214] The free divalent cation is preferably selected from Mg 2+ and Mn 2+ .

[0215] The composition or sample may contain no free Mg 2+ .

[0216] The composition or sample may contain no free Mn 2+ .

[0217] Preferably, the free Mg in the composition and sample is 2+ and / or free Mn 2+ The concentration is about ≤ 2 mM, more preferably about ≤ 1 mM.

[0218] A composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof may comprise free Mg in the composition or sample in the range 2+ and / or Mn 2+ Concentrations of: 0 to about 1 mM, about 1 μM to about 1 mM, about 1 μM to about 0.9 mM, about 1 μM to about 0.8 mM, about 1 μM to about 0.7 mM, about 1 μM to about 0.6 mM, about 1 μM to about 0.5 mM.

[0219] The composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof may comprise a concentration ratio of divalent metal cations to divalent ion chelator in the composition or sample such that the maximum concentration of free divalent cations (i.e., not bound to a divalent ion chelator) in the composition or sample is no greater than 3 mM, preferably no greater than 2 mM, and more preferably no greater than 1 mM.

[0220] The composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof may comprise free Mg in the composition or sample in the range of 0 to about 3 mM. 2+ concentration.

[0221] A composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof may comprise free Mn in the composition or sample in the range of 0 to about 1 mM. 2+ concentration.

[0222] The composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof can comprise a concentration of the divalent ion chelator of about ≤ 10 mM.

[0223] The divalent ion chelator is preferably EDTA or EGTA.

[0224] For solubility reasons, compositions and samples containing divalent metal cations are preferably added as divalent salts. A divalent salt is a salt in which at least one counterion is divalent, for example, MgCl2 or MnCl2. The salt is preferably inorganic.

[0225] Inorganic salts are salts in which neither counterion contains carbon. The monovalent or divalent salt is preferably an inorganic salt.

[0226] Preferably, the compositions and samples comprise a monovalent salt, and preferably also comprise a monovalent anion as a counterion. The preferred concentrations of the monovalent salts disclosed herein are inherently preferred concentrations of the monovalent counterions, and vice versa.

[0227] Thus, provided herein are compositions or samples comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1 or comprises an amino acid sequence having at least 30% identity, such as 70% identity, to SEQ ID No. 1, wherein

[0228] - The concentration of the monovalent salt in the composition or sample is about ≤100 mM, about ≤75 mM, about ≤55 mM, about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM.

[0229] Also provided is a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1 or comprises an amino acid sequence having at least 70% identity to SEQ ID No. 1, wherein

[0230] - the concentration of the monovalent salt in the composition or sample is about ≤100 mM, about ≤75 mM, about ≤55 mM, preferably about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM

[0231] And among them

[0232] - the composition or sample is substantially free of free divalent metal cations, wherein the divalent metal cation is preferably Mg 2+ or Mn 2+ , and wherein the divalent metal cation is provided as an inorganic salt, such as as MgCl2 or MnCl2.

[0233] Also provided is a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1 or comprises an amino acid sequence having at least 30% identity, such as at least 70% identity, to SEQ ID No. 1, wherein

[0234] - the concentration of the monovalent salt in the composition or sample is about ≤100 mM, about ≤75 mM, about ≤55 mM, preferably about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM

[0235] And among them

[0236] - The concentration of free divalent metal cations is about ≤ 1 mM, the divalent metal cation is preferably Mg 2+ or Mn 2+ , and wherein the divalent metal cation is provided as an inorganic salt, such as as MgCl2 or MnCl2.

[0237] Also provided is a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1 or comprises an amino acid sequence having at least 30% identity, such as at least 70% identity, to SEQ ID No. 1, wherein

[0238] - the concentration of the monovalent salt in the composition or sample is about ≤100 mM, about ≤75 mM, about ≤55 mM, preferably about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM

[0239] And among them

[0240] - the composition or sample comprises: a ratio of the concentration of divalent metal cations in the composition or sample to the concentration of the divalent ion chelator such that the concentration of free divalent metal cations present in the sample or composition is about ≤ 1 mM and the concentration of the divalent ion chelator is about ≤ 10 mM

[0241] - The divalent metal cation is preferably Mg 2+ or Mn 2+ , and is provided as an inorganic salt, such as MgCl2 or MnCl2, and

[0242] - The divalent ion chelator is preferably EDTA or EGTA.

[0243] As explained above, the free Mg in the samples herein 2+ or Mn 2+ Indicated as not bound to EDTA or EGTA.

[0244] Thus, for example, the ratio of the concentration of divalent metal cations to the concentration of divalent ion chelating agent in the composition or sample can be, for example, 2 mM:1 mM, 5 mM:5 mM, 5 mM:10 mM, 10 mM:10 mM, or any other combination of alternative ratios, so long as the concentration of free divalent metal cations in the composition or sample is about ≤1 mM and the concentration of divalent ion chelating agent is preferably about ≤10 mM.

[0245] Preparation of ToxN endoribonuclease of the present invention

[0246] Methods for preparing ToxN endoribonuclease are described in Manikandan, P. et al., Identification, functional characterization, assembly and structure of ToxIN type III toxin-antitoxin complex from E. coli, Nucleic acid research, 2022, Vol. 50, No. 3, pp. 1687-1700 and further described in Example 1.

[0247] The ToxN endoribonuclease and enzymatically active fragments thereof or nucleic acid molecules encoding the endoribonuclease can be isolated from natural sources, such as bacteria, for example, Escherichia coli, Pectobacterium niger, Bacillus thuringiensis subsp. kostak, Lactococcus lactis subsp. lactis or Eubacterium rectale.

[0248] Alternatively, the enzyme can be recombinantly produced in a host cell and isolated and purified therefrom. Wherein, the host cell is not or is not derived from an organism that naturally expresses a gene encoding the ToxN endoribonuclease, i.e., the host cell is a heterologous host cell, such as a yeast cell, an insect cell, a human cell line or a bacterial cell, preferably Escherichia coli.

[0249] According to the present invention, nucleic acid sequences encoding ToxN endoribonuclease or enzymatically active fragments thereof can be amplified from genomic DNA using PCR, isolated as cDNA, or can be ordered from commercial suppliers such as GENEWIZ, GeneArt from Thermo Fisher Scientific, or Genscript.

[0250] As described above, the nucleic acid sequence encoding the ToxN endoribonuclease or its enzymatically active fragment can be codon optimized to improve protein production in heterologous host cells. Various software programs for assisting with codon optimization are well known in the art. CodonW is an example of an open source software program that can be used. Preferably, the codon optimization software is provided by Raab, D., Graf, M., Notka, F., T.,&Wagner,R.(2010).The GeneOptimizer Algorithm:Usingaslidingwindow approach to cope with the vast sequence space inmultiparameter DNAsequence optimization.Systems and Synthetic Biology,4(3),215-225 The GeneOptimizer algorithm described was used to generate codon-optimized DNA sequences for expression of ToxN endoribonuclease in Escherichia coli host cells.

[0251] For expressing protein from DNA sequence by heterologous expression in a variety of host cell systems using the recombinant gene expression system known, there are multiple available molecular techniques.For example, the nucleic acid molecules encoding ToxN endoribonuclease or its enzymatic activity fragment can be inserted into an applicable expression vector, which comprises the necessary transcription and translation elements for the expression of the applicable selected host cell.The example of commonly used expression vector is a plasmid or a virus.

[0252] To ensure reliable transcription of the gene of interest, the expression vector may contain a strong promoter. Bacteriophages T5 and T7 are examples of strong promoters for expression in E. coli. The promoter can be regulated by including a chemical switch. An example of an inducible promoter used in E. coli is the commonly used lac promoter induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (Hansen LH, Knudsen S, et al., 2001). SJ,"The effect of the lacY gene on the induction of IPTG inducible promoters,studied in Escherichia coli andPseudomonas fluorescens",Curr.Microbiol.1998,36(6):341-7) or an XylS / Pm expression cassette comprising a promoter inducible by toluic acid (Gawin, A. et al., The XylS / Pm regulator / promotersystem and its use in fundamental studies of bacterial gene expression,recombinant protein production and metabolic engineering,Microb.Biotechnol.,2017,Vol.10,No.4,pp.702-718). The XylS / Pm regulator / promoter system derived from Pseudomonas putida is widely used to regulate low-level and high-level recombinant expression of genes and gene clusters in Escherichia coli and other bacteria.

[0253] Other aspects of the present invention are methods for expressing ToxN endoribonuclease or its enzymatic activity fragment as described above in applicable heterologous cells. The host cell can be a bacterium or yeast cell. Preferably, the enzyme is expressed in a bacterial host cell, more preferably in an Escherichia coli BL21 (DE3) cell.

[0254] Transformation of the above-mentioned expression vector containing ToxN endoribonuclease can be performed by methods well known to skilled artisans, for example, by using chemically competent cells.

[0255] As described above, ToxN endoribonuclease can be synthesized using recombinant DNA technology. Alternatively, the endoribonuclease can be produced using a cell-free expression system or chemical synthesis of ToxN endoribonuclease.

[0256] The ToxN endoribonuclease comprising a signal peptide for secretion into the cell culture medium can be isolated and purified from the host cell culture medium using any technique known in the art and fully described in the literature. Examples of such techniques or any combination thereof can include precipitation, ultrafiltration, different chromatographic techniques, such as size exclusion chromatography, immobilized metal affinity column chromatography, and / or immunosorbent chromatography.

[0257] The ToxN endoribonuclease produced in the cell can also be separated and purified using techniques well known to the skilled person. Examples of methods for preparing cell lysates from E. coli cells are homogenization, ultrasonication, or enzymatic lysis using lysozyme. After the ToxN endoribonuclease is released from the cracked cells, the enzyme can be subjected to any purification method, such as size exclusion chromatography, immobilized metal affinity column chromatography, and / or immunosorbent chromatography.

[0258] ToxN endoribonuclease may comprise a C-terminal or N-terminal His-tag to facilitate the isolation, purification and / or identification of the enzyme. The N-terminal polyhistidine-tagged ToxN endoribonuclease is shown in SEQ ID No. 2.

[0259] The purified ToxN endoribonuclease or its enzymatically active fragment can be finally stored in a buffer.

[0260] The purified ToxN endoribonuclease or its enzymatically active fragment can finally be stored in a suitable buffer. Buffers suitable for storing ToxN endoribonuclease are known to the skilled person.

[0261] It has been found that the ToxN enzyme is particularly stable if stored in a buffer comprising from about 100 mM to about 500 mM monovalent salt. The monovalent salt may be selected from NaCl.

[0262] Preferably, the alkali metal ion of the salt is selected from Na + , K + 、Li + and Rb + .

[0263] The anion of the salt comprising an alkali metal ion is preferably selected from fluoride (F), chloride (Cl), bromide (Br), iodine (I), sulfate, phosphate or hydroxide or any suitable combination thereof.

[0264] Preferably, the alkali metal salt is NaCl, KCl, Na2SO4, K2SO4, KOH, NaOH, Na-phosphate, K-phosphate or any suitable combination.

[0265] Kit containing ToxN endoribonuclease

[0266] The compositions and samples of the present invention comprise an endoribonuclease that is not inhibited by the presence of a divalent ion chelator, which is typically added to an enzyme reaction to terminate the enzyme's catalytic activity. Thus, the ToxN endoribonuclease has advantageous uses in various molecular biology methods involving the prior use of other enzymes. This method is discussed in more detail below. Thus, in other aspects, a kit is provided, comprising:

[0267] i) a composition comprising a ToxN endoribonuclease as defined above; and

[0268] ii) a second composition comprising a second enzyme selected from the group consisting of an RNA polymerase, an RNA ligase for ligating single-stranded RNA molecules, a pyrophosphatase, a phosphatase, a kinase, or any other nucleic acid or ribonucleic acid modifying enzyme, and at least one additional ToxN endoribonuclease having a different recognition site than the ToxN endoribonuclease of a) .

[0269] The second enzyme may be another ToxN endoribonuclease having a different recognition site compared to the ToxN enzyme mentioned in i).

[0270] Kits containing ToxN endoribonuclease may contain a suitable buffer for performing RNA digestion.

[0271] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0272] Methods for cleaving single-stranded RNA

[0273] The enzymatic activity of ToxN endoribonuclease makes this enzyme particularly suitable for use in methods involving the cleavage of single-stranded RNA.

[0274] Different ToxN endoribonucleases cleave single-stranded RNA molecules at different recognition sites.

[0275] Thus, in one aspect, the composition comprising a ToxN endoribonuclease can be a solution applied to a sample, wherein the sample comprises at least one isolated single-stranded RNA molecule comprising at least one cleavage site for the ToxN endoribonuclease.

[0276] In other aspects, a method for cleaving a single-stranded RNA molecule in a sample is provided, wherein the method comprises the steps of:

[0277] a. providing a sample comprising at least one single-stranded RNA molecule comprising at least one cleavage site for a ToxN endoribonuclease; and

[0278] b. contacting ToxN endoribonuclease or an enzymatically active fragment thereof with the sample under conditions that allow cleavage of at least a portion of the RNA molecules present in the sample.

[0279] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0280] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0281] The digestion step is typically incubation, and as described above and in the Examples. Suitable incubations include incubation at about 10°C to about 50°C, such as about 10°C to 30°C, preferably about 15°C for 1 minute to about 2 hours, such as about 5 minutes to about 1.5 hours, such as about 15 minutes to about 1 hour.

[0282] The single-stranded RNA molecules in the sample can be concatamers comprising multiple copies of a precursor of any one of mRNA, siRNA, circular RNA precursor, microRNA or ribozyme, and wherein the concatamer RNA molecules comprise a cleavage site for ToxN endoribonuclease between each copy of the precursor of any one of mRNA, siRNA, circular RNA, microRNA or ribozyme.

[0283] Methods for preparing circular RNA molecules

[0284] The properties of the 5' and 3' ends of RNA produced by ToxN can be exploited by subjecting the RNA to an RtcB ligase reaction, which connects the 3'-PO4 end to the 5'-OH end of the RNA. Through this reaction, the RNA becomes circular. The mechanism for preparing circular RNA using RtcB ligase is described in Tanaka, N. et al., Novel mechanism of RNA repair by RtcB via sequential 2', 3'-cyclic phosphodiesterase and 3'-phosphate / 5'-hydroxyl ligation reactions, J Biol Chem., 2011, Vol. 286, No. 50, pp. 43134-43143.

[0285] In other aspects, a method is provided for preparing a single-stranded circular RNA molecule present in a sample, wherein the RNA molecule comprises a cleavage site for a ToxN endoribonuclease; contacting the ToxN endoribonuclease with the RNA molecule under conditions that allow digestion of at least a portion of the RNA molecule present in the sample, thereby producing an RNA molecule comprising a 3'-PO4 end and a 5'-OH end; and contacting the digested RNA molecule with an RtcB ligase under conditions that allow ligation, thereby producing a circular RNA.

[0286] Method for producing multiple copies of RNA by rolling circle transcription (RCT)

[0287] Rolling circle transcription (RCT) using small circular single-stranded DNA as template has been widely studied in the past two decades. Interestingly, transcription by rolling circle mechanism is achieved by using T7 RNA polymerase, but can occur in the absence of specific typical promoters (canonical promoters), and produces transcripts of tandem repeats complementary to the circular template. In the literature, the use of RNase H (Wang et al., Preparation of small RNAs using rolling circle transcription and site-specific RNA disconnection, Molecular Therapy-Nucleic Acids, 2015, e215) or ribozymes (WO2020023741) has been reported.

[0288] By adapting the method to use the site-specific ToxN endoribonuclease, the method is simplified and eliminates the need for RNase H and helper DNA fragments and eliminates the use of synthetic or transcript-encoded ribozymes.

[0289] Thus, in other aspects, methods for synthesizing RNA by rolling circle transcription (RCT) are provided, such as Figure 11 The method comprises the following steps:

[0290] - providing a single-stranded DNA plasmid comprising a sequence encoding an RNA recognition site for the ToxN endoribonuclease, optionally adjacent to a recognition site for RNA polymerase (also called a promoter);

[0291] - Amplify RNA;

[0292] Once circularization is complete, RNA polymerase will continue to amplify the RNA into long chains with multiple copies of the target RNA;

[0293] -ToxN cleaves RNA to produce multiple copies of RNA. This process can occur simultaneously with RNA polymerase to continuously produce new RNA.

[0294] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0295] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0296] Method for preparing double-stranded siRNA

[0297] Small interfering RNA (siRNA, sometimes called short interfering RNA or silencing RNA) is a type of double-stranded RNA that is typically 20-24 base pairs in length, generally around 21 base pairs, similar to miRNA. siRNA functions in the RNA interference (RNAi) pathway and interferes with the expression of specific genes with a complementary nucleotide sequence by post-transcriptionally degrading the mRNA, thereby preventing translation.

[0298] In other aspects, a method for synthesizing siRNA is provided. The method comprises the following steps:

[0299] a. providing a sample comprising at least one rolling circle transcribed concatemeric RNA molecule, wherein the rolling circle transcribed concatemeric RNA molecule comprises cleavage sites for two different ToxN endoribonucleases ToxN-A and ToxN-B having different recognition sites, wherein the recognition site of ToxN-B is located between the tandem repeats, and the recognition sequence of ToxN-A is located within the tandem repeats;

[0300] b. contacting the sample with a ToxN-B endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the RNA molecules present in the sample, thereby generating single repeat sequences that form a hairpin structure based on their sense-antisense sequence information; contacting the formed hairpin structure with a second ToxN-A enzyme that cleaves the RNA in the loop structure to form a double-stranded RNA molecule; and

[0301] c. Double-stranded siRNA is generated by removing the overhanging ends of the resulting portion containing the ToxN recognition site using a standard single-strand specific ribonuclease such as RNase T1. Figure 12 The method is shown.

[0302] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0303] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0304] Methods for analyzing RNA modifications

[0305] The ToxN family of endoribonucleases are very useful in RNA analysis, particularly in the analysis of long modified RNA molecules that must be cleaved into fragments to enable analysis of RNA modifications.

[0306] Similar to the well-known DNA endoribonucleases commonly used in in vitro molecular cloning methods of double-stranded DNA, the ToxN endoribonuclease family is a group of enzymes that cleave single-stranded RNA at specific recognition sequences without the need for any guide RNA, ribozyme, or complex with a DNA probe.

[0307] 5' capping of synthetically produced mRNA is crucial for efficient translation of mRNA into functional proteins or peptides in vivo.

[0308] However, it is known that RNA capping is an incomplete process during mRNA production, resulting in a portion of the produced mRNA being uncapped. The completeness of capping can be assessed by methods such as LC-MS, IP RP HPLC, gel electrophoresis such as PAGE, or capillary gel electrophoresis (CGE).

[0309] The addition of the capping structure changes the molecular weight of the RNA fragments to a level that is undetectable in standard molecular biology analyses. In addition, the heterogeneity of the RNA product solution in terms of the length of the different products makes it more difficult to assess the molecular weight changes of the entire RNA population.

[0310] Thus, a hypothetical length homogenization of the entire RNA population would ultimately yield only 2 to 5 subpopulations that differ in molecular weight depending on their capping status.

[0311] Different types of mRNA capping structures are well known to technicians, and Chan, SH et al., RNase H-based analysis of synthetic mRNA 5'cap incorporation, RNA 2022, Vol. 28, pp. 1144-1155 disclose examples of some 5'mRNA capping structures. Chan, SH et al. 2022 also disclose an analysis of the 5' capping efficiency of mRNA using DNA-RNA chimera-guided RNase H to cut newly synthesized mRNA. However, the problem with RNase H in this method is that it is difficult to obtain uniform cutting because the reaction must be optimized for both the optimal DNA-RNA hybridization and the ability of the enzyme to provide uniform cutting. Another advantage of ToxN endoribonucleases is that they only require pentamers as recognition sites.

[0312] EP3183340 proposes the use of ribozymes instead of RNase H, however ribozymes require excess enzyme and the cleavage of the enzyme is highly dependent on the 3D structure of RNA.

[0313] Recently, other RNA capping phenomena have been detected in eukaryotes, bacteria, and archaea. These atypical caps are mainly derived from metabolites and cofactors such as NAD. + 、FAD + Atypical caps can affect RNA stability, mitochondrial function, and RNA translation, Doamekpor et al. 2022 (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC9283932 / ).

[0314] The inventors have shown for the first time that the ToxN endoribonuclease family can overcome the problems of prior art endoribonucleases, as the enzymes are able to digest single-stranded RNA without requiring hybridized DNA probes, guide RNAs or a specific 3D structure of the RNA molecule for RNA cleavage.

[0315] Figure 9a Methods for analyzing the 5' capping efficiency of in vitro transcribed mRNA using ToxN, including co-transcriptional 5' capping of mRNA, are outlined in

[15] . The mRNA was in vitro transcribed and contained a ToxN recognition site in its 5' UTR.

[0316] The ToxN recognition sequence is located a predetermined number of ribonucleotides from the 5' end of the synthetically transcribed and 5' capped mRNA.Digestion of the 5' capped RNA with ToxN produces a population of 5' capped mRNA molecules having the same ribonucleotide length.

[0317] For analysis of mRNA modifications, the molecular weight differences provided by the modifications are not significant in long RNA molecules.

[0318] Long RNA molecules are RNA molecules with a length of at least 10, 100, 200, 500 or 1000 nucleotides. Preferably, the RNA molecule has a length of 5 to 50,000 nucleotides, 10 to 30,000 nucleotides, 100 to 25,000 nucleotides or 200 to 20,000 nucleotides, 500 to 15,000 nucleotides.

[0319] In one aspect, the 5'-capped mRNA fragments generated after digestion with ToxN enzyme contain 2 to 100 ribonucleotides, preferably 5 to 50 ribonucleotides, and more preferably 5 to 10 ribonucleotides.

[0320] In an alternative approach, recognition sequences for the ToxN enzyme can be transcriptionally introduced on each side of the potential RNA segment in question to study RNA modifications at internal locations of the RNA molecule.

[0321] In an alternative approach, the recognition sequence for the ToxN enzyme can be transcriptionally introduced before the poly(A) tail of the potential mRNA fragment in question in order to study the poly(A) tail length distribution of mRNA molecules.

[0322] Thus, in one aspect, a method is provided for determining the 5' capping efficiency of a modified RNA molecule, wherein the method comprises the following steps:

[0323] a. Providing a sample comprising at least one single-stranded mRNA molecule, the single-stranded mRNA molecule comprising a ToxN endoribonuclease cleavage site in the 5'UTR of the mRNA;

[0324] b. contacting the sample from step a) with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the single-stranded RNA molecule to produce at least one 5' terminal RNA fragment and at least one 3' terminal RNA fragment.

[0325] c. Isolating the RNA fragments from step b) and determining the presence of a 5'-capping modification at the 5' end of the 5' terminal RNA fragments.

[0326] In other aspects, the separation and detection of step c) of the above method is based on the different molecular weight, charge or length of the RNA fragments produced.

[0327] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0328] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0329] Therefore, in another aspect, there is provided a method for determining the length distribution of poly(A) tails of RNA molecules, wherein the method comprises the following steps:

[0330] a. providing a sample comprising at least one single-stranded mRNA molecule comprising a ToxN endoribonuclease cleavage site in the 3'UTR of the mRNA located upstream of the poly (A) tail;

[0331] b. contacting the sample from step a) with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the single-stranded RNA molecule to produce at least one 5' terminal RNA fragment and at least one 3' terminal RNA fragment.

[0332] c. Isolating the RNA fragments from step b) and determining the presence and length of the poly(A) tail at the 3' end of the 3' terminal RNA fragments.

[0333] 3'-terminal RNA fragments containing poly(A) tails can be enriched by using an oligo-dT based enrichment step to remove the poly(A)-free fraction.

[0334] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0335] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0336] In other aspects, the separation and detection of step c) of the above method is based on the different molecular weight, charge or length of the RNA fragments produced.

[0337] In other aspects, separation and detection of RNA fragments is selected from gel electrophoresis, capillary electrophoresis, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, LC-UV.

[0338] As described above, capping analysis after cleavage with E. coli ToxN1 can be performed in the same manner as other methods using LC-MS, FFF (FastFlow fractionation), or similar techniques. The pentamer recognition site is quite versatile and can be placed anywhere in the 5'UTR. The enzyme does not require an overhang and cleaves the ssRNA starting at the cleavage site. Therefore, when cleaving directly at the 5' site, the shortest fragment that EcoToxN1 can produce is 3 nucleotides long: GAA, see Table 1 above.

[0339] Since there is no excess of additional oligomers present in the capping assay with E. coli ToxN1, analysis can be performed on a simple urea / acrylamide gel.

[0340] Examples 10a-c and Figure 9b -d shows that ToxN endoribonuclease can be used in methods for analyzing RNA modifications, such as, for example, 5' capping of RNA.

[0341] Methods for RNA fingerprinting

[0342] Similar to DNA fingerprinting using DNA restriction enzymes, RNA restriction enzymes can be used to exploit the different locations of cleavage sites within ssRNA. RNA fingerprinting is an important tool in diagnosis and treatment. ToxN endoribonuclease offers several advantages when used in RNA fingerprinting, including rapid and reliable fragmentation of single-stranded RNA molecules of defined lengths that can be analyzed by gel electrophoresis, capillary electrophoresis, high-pressure liquid chromatography (HPLC), mass spectrometry (MS), or LC-MS, LC-UV.

[0343] Provided Figure 10a The RNA fingerprint analysis method shown in , wherein the method comprises the following steps:

[0344] a. providing a sample comprising a single-stranded RNA molecule having an unknown sequence;

[0345] b. contacting the sample from step a) with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions allowing cleavage of at least a portion of the RNA molecules present in the sample to obtain a plurality of RNA fragments;

[0346] c. Isolating and detecting the fragmented RNA molecules from step b) to obtain a fingerprint of the RNA molecules with unknown sequence, and comparing the obtained fingerprint with the fingerprint of RNA molecules with known RNA sequences.

[0347] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0348] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0349] The determination of RNA species in a polyvalent RNA composition as described in WO2022212711 is another RNA fingerprinting method, in which the use of ToxN endoribonuclease will simplify and improve the method compared to the RNase H enzyme that requires hybridized DNA probes at its recognition site.

[0350] The method is based on an RNA composition comprising one or more different RNA species (e.g., RNA encoding different proteins), wherein each RNA species comprises a unique nucleotide sequence that can be used to identify the RNA species. A unique identification and / or ratio determination (IDR) sequence is incorporated into at least one position among the different RNA species in the RNA composition, thereby inferring a unique fingerprint for each RNA species (e.g., within a non-coding region).

[0351] According to WO2022212711 and without wishing to be bound by theory, it is believed that RNA can be digested to release RNA fragments comprising IDR sequences, and analytical methods can be used to quantify the type and amount of RNA fragments comprising each IDR to produce a profile of the type and / or amount of each RNA species in the RNA composition.

[0352] Using IDR sequences for analysis allows characterization of multivalent RNA compositions containing several distinct RNA species, even when the multiple RNA species are difficult to distinguish by length or coding sequence. For example, a multivalent RNA composition containing eight RNA species, each encoding a different serotype of the same protein, can have similar lengths and coding sequences, but each RNA species can contain a different IDR pattern in either the coding or noncoding regions.

[0353] Because each IDR sequence unambiguously recognizes a specific RNA species, the abundance of IDR sequences can be measured to determine the abundance of RNA encoding each serotype.

[0354] Furthermore, the coding sequence of one or more RNA species in a multivalent RNA composition can be modified independently of the IDR sequence (e.g., to alter the structure of the encoded therapeutic protein or antigen), thereby allowing the same analytical methods to be used to evaluate RNA compositions in which one or more RNA coding sequences are modified.

[0355] Thus, a method for analyzing RNA species in a multivalent RNA composition is provided, wherein the method comprises the following steps:

[0356] a. providing a sample comprising a multivalent RNA composition comprising a first RNA species and a second RNA species, wherein at least one position of the first RNA species and the second RNA species comprises a cleavage site for a ToxN endoribonuclease;

[0357] b. contacting the sample from step a) with a ToxN endoribonuclease under conditions that allow cleavage of the first and second RNA species, thereby releasing a plurality of first and second RNA fragments from the first and second RNA species;

[0358] c. Isolating and detecting the presence and / or amount of the released first RNA fragment and second RNA fragment.

[0359] The RNA molecule can be selected from mRNA, viral RNA, in vitro transcribed mRNA, therapeutic RNA.

[0360] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.

[0361] Suitable RNA digestion buffers and reaction conditions for performing RNA cleavage are described in detail above.

[0362] The separation and detection in step c) of the above method can be based on the different molecular weight, charge or length of the RNA fragments produced.

[0363] In other aspects, separation and detection of RNA fragments is selected from gel electrophoresis, capillary electrophoresis, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, LC-UV.

[0364] Example 11 and Figure 10b and Figure 10c It was shown that endoribonucleases from type III toxin-antitoxin (TA) systems, such as those from the ToxN subfamily, can be used in RNA fingerprinting methods. Figure 10b Depicts two synthetic RNA oligomers of equal length, 20 bases, that migrate equally in a urea / acrylamide gel (lanes 1 and 8). However, each RNA oligomer has an E. coli ToxN1 (ET-N1) cleavage site located at a different position in the RNA sequence. Therefore, RNA molecules present in a mixture can be identified by their unique RNA fragmentation patterns. In addition, band intensities can be used to assess the ratio of two RNA molecules in a mixture, see, Figure 10c .

[0365] Having generally described the present invention, a further understanding may be obtained by reference to certain specific examples. The examples illustrate the properties and effects of the ToxN endoribonuclease according to the present invention and are provided herein for illustrative purposes only and are not intended to be limiting.

[0366] Example

[0367] Example 1 - Cloning, expression and purification of Escherichia coli ToxN1 (ET-N1) endoribonuclease having SEQ ID NO: 1

[0368] The E. coli ToxN1 (ET-N1) enzyme (toxin) was cloned into the pBAD / His A vector, and the RNA (antitoxin) was cloned into the pRSFDuet TM-1, as described in Manikandan, P. et al., Identification, functional characterization, assembly and structure of ToxIN type III toxin-antitoxin complex from E.coli, Nucleic acid research, 2022, Vol. 50, No. 3, pp. 1687-1700. Plasmids containing toxins and antitoxins were co-transformed into E. coli BL21 (DE3) cells and grown overnight at 37 ° C, 180 rpm, and then subcultured at 37 ° C, 180 rpm until OD 600 was approximately 0.5. The culture was incubated at 15 ° C, without shaking for 30 minutes, and the toxin was induced by adding IPTG at a final concentration of 1 mM and incubated at 15 ° C, 180 rpm for 24 h. The cells were harvested by centrifugation at 6000 rpm for 15 minutes. The cells were resuspended in lysis buffer (50 mM Tris, 300 mM NaCl, 10 mM imidazole, 10% glycerol, 2 mM 2-mercaptoethanol, pH 7.5, 25°C) and lysed by sonication. The lysate was centrifuged at 13,000 rpm for 30 minutes, and the supernatant was loaded onto a Ni 2+ -NTA column. The complex was eluted using elution buffer (lysis buffer + 200mM imidazole). The fraction containing the complex was dialyzed with ion exchange buffer (50mM NaCl, 50mM Tris-HCl, 1mM DTT, pH 7.5) and purified using anion exchange chromatography by increasing the gradient of NaCl from 50mM to 1000mM in a 100ml volume. This produced the following fractions: toxin E. coli ToxN1 (ET-N1) (at about 300mM NaCl); antitoxin; RNA (at about 600mM NaCl) and E. coli ToxN1-RNA complex (at about 500mM NaCl). They were further purified by size exclusion chromatography (SEC) using an S200 column (GE).

[0369] Toxin (E. coli ToxN1)_Fwd 5'-AGGTCAT ATG GCGAAATTTTTCAC AATATCA-3'

[0370] Toxin (E. coli ToxN1)_Rev 5'-GGAAATAGACGATCTCGAGTCTA GAGCAT-3'

[0371] Example 2 - In vitro transcription and production of RNA oligomers containing ToxN recognition and cleavage sites

[0372] In vitro transcription was performed in 50 μL reactions using 30 U T7 RNA polymerase (ThermoScientific, EP0111) with included 5X reaction buffer (200 mM Tris-HCl pH 7.9; 30 mM MgCl , 50 mM DTT, 50 mM NaCl, 10 mM spermidine), 50 U RiboLock RNase inhibitor (ThermoScientific, EO0381), 2 mM NTP (ThermoScientific, R1481) and 1 μg linearized (ScaI digested) pGEMEX-1 template. As an alternative template, any linearized plasmid with a T7 promoter and a ToxN cleavage site or a PCR product comprising a T7 promoter and a ToxN cleavage site may be used. The transcription reaction was continued for 2 h at 37° C. and inactivated by adding 10 μL 60 mM ETDA, followed by incubation at 65° C. for 10 minutes. Reaction cleanup was performed using the RNeasy MiniElute Cleanup kit (Qiagen, 74204) to elute the purified RNA in RNase-free water.

[0373] Recognition site:

[0374] Escherichia coli ToxN (ET-N1): GAA^AU

[0375] P. atrosepticum ToxN: GAA^AU

[0376] Bacillus thuringiensis ToxN (BT-N1): AAA^AAA

[0377] Lactococcus lactis (L. lactis) ToxN (AbiQ): AA^AA

[0378] Eubacterium rectale CptIN:GA^AAG

[0379] Escherichia albertii ToxN / AbiQ (ET-N5): 5'..GAAA↓AAC..3' and 5'.AAAA↓AUC..3'

[0380] Example 3 - Endoribonuclease Activity - Determination of Optimal Enzyme Concentration

[0381] This experiment was performed to verify that the E. coli ToxN1 (NCBI accession number: WP_059274511) used according to the present invention exhibits endoribonuclease activity on single-stranded RNA substrates.

[0382] A 50-nucleotide RNA single-stranded oligomer was digested with E. coli ToxN1. The recognition site GAAAU is located in the center of the oligomer and produces a 26-nucleotide product. The results of the polyacrylamide / urea gel analysis are shown in Figure 2. Figure 2 shown.

[0383] A 50-nucleotide RNA single-stranded oligomer sequence, in which the cleavage site of Escherichia coli ToxN1 (ET-N1) is added. The line indicates:

[0384] 5'-CGCAAUUGCCGCAUUACAAGG GAAAU AACUUCGUACGUUG UUGUUAGCAU / 3'-FAM

[0385] Detection conditions (25 μl):

[0386] 0nM to 120nM ToxN enzyme

[0387] 50 mM Tris-HCl pH 7.5

[0388] 50mM NaCl

[0389] 1mM DTT

[0390] 0.125 μM RNA oligo

[0391] 1h at 15℃

[0392] Example 4 - Activity spectrum of Escherichia coli ToxN1 (ET-N1) endoribonuclease: monovalent salt concentration and pH

[0393] A 50-nucleotide RNA single-stranded oligomer was digested with ToxN. The recognition site GAAAU is located in the center of the oligomer and produces a 26-nucleotide product (the oligomer sequence is shown in Example 3). The results are shown in FIG. Figure 3 The results show that the ToxN enzyme is capable of cleaving single-stranded RNA in a pH range of 7.0 to 9.0. This result further demonstrates that the enzyme's specificity is dependent on monovalent ion concentration and is optimal at NaCl concentrations of 50 mM and lower. At concentrations above 50 mM, RNA cleavage specificity is low, and the enzyme digests RNA at secondary, closely related sequence recognition sites.

[0394] Detection conditions

[0395] 125nM RNA oligomer

[0396] 40 nM E. coli ToxN1

[0397] 50 mM Tris-HCl pH 7.0 to pH 9.0

[0398] NaCl 0mM to 175mM

[0399] 1h at 15℃

[0400] Analysis results of polyacrylamide / urea gel

[0401] Example 5 - Activity spectrum of ToxN endoribonuclease: divalent salt concentration

[0402] a) A 50-nucleotide RNA single-stranded oligomer was digested with E. coli ToxN1 (ET-N1). The recognition site GAAAU is located in the center of the oligomer and produces a 26-nucleotide product (the oligomer sequence is shown in Example 3). The results are shown in FIG. Figure 4a As shown, the enzyme activity of E. coli ToxN1 (ET-N1) was extensively inhibited by MgCl2 at concentrations greater than 1 mM (lanes E-J).

[0403]

[0404] Detection conditions

[0405] 50 mM TrisHCl pH 8.0

[0406] 25mM NaCl

[0407] 125nM RNA oligomer

[0408] 40 nM E. coli ToxN1

[0409] 1h at 15℃

[0410] b) Digestion of a 50-nucleotide RNA single-stranded oligomer with ToxN. The recognition site GAAAU is located in the center of the oligomer and produces a 26-nucleotide product (the oligomer sequence is shown in Example 3). The results are shown in FIG. Figure 4b As shown, ToxN enzyme activity was extensively inhibited by MgCl2 at concentrations greater than 3 mM and MnCl2 at concentrations greater than 1 mM.

[0411] Detection conditions

[0412] 25mM Tris / HCl pH 7.5

[0413] 25mM NaCl

[0414] 0.5 μM RNA oligomer

[0415] 10 nM E. coli ToxN1

[0416] 10 min at 37 °C

[0417] Example 6 - Activity spectrum of E. coli ToxN1 (ET-N1) endoribonuclease: concentrations of divalent salts, EDTA and DTT

[0418] Digestion of a 50-nucleotide RNA single-stranded oligomer with the ToxN1 recognition sequence. The recognition site GAAAU is located in the center of the oligomer and produces a 26-nucleotide product (the oligomer sequence is shown in Example 3).

[0419] The experimental results are as follows Figure 5 As shown, it was demonstrated that ToxN1 endoribonuclease activity was restored by the addition of EDTA (divalent cation scavenger) (lane G, lane H).

[0420]

[0421] Detection conditions

[0422] 50 mM TrisHCl pH 8.0

[0423] 25mM NaCl

[0424] 125nM RNA oligomer

[0425] 40nM Escherichia coli ToxN1 (ET-N1)

[0426] 1h at 15℃

[0427] Example 7 - Activity profile of Escherichia coli ToxN1 (ET-N1) endoribonuclease: incubation time at 15°C

[0428] Under gradually increasing incubation time, Escherichia coli ToxN1 (ET-N1) was used to digest a 50-nucleotide RNA single-stranded oligomer. The recognition site GAAAU is located in the center of the oligomer and produces a 26-nucleotide product (the oligomer sequence is shown in Example 3). The results are shown in FIG. Figure 6 As shown, and proves that the enzyme is efficient. After 5 minutes, at the optimal detection temperature of 15 ° C, 50% of the RNA oligomers were cleaved (lane C).

[0429]

[0430] Detection conditions

[0431] 50 mM Tris-HCl pH 8.0

[0432] 25mM NaCl

[0433] 125nM RNA oligomer

[0434] 40nM ToxN1(ET-N1)

[0435] 15℃

[0436] Example 8 - Activity spectrum of ToxN endoribonuclease: incubation temperature

[0437] Escherichia coli ToxN1 (ET-N1) was used to digest a 50-nucleotide single-stranded RNA oligomer. The recognition site GAAAU is located in the center of the oligomer, resulting in a 26-nucleotide product (the oligomer sequence is shown in Example 3). The goal was to establish a profile of enzyme activity at different incubation temperatures.

[0438] The results are as follows Figure 7 shown.

[0439]

[0440] 50 mM TrisHCl pH 8.0

[0441] 25mM NaCl

[0442] 125nM RNA oligomer

[0443] 40nM ToxN1(ET-N1)

[0444] At the specified temperature, 30 minutes

[0445] Example 9 - Activity spectrum of E. coli ToxN1 endoribonuclease: Incubation temperature

[0446] Escherichia coli ToxN1 (ET-N1) was used to digest a 50-nucleotide single-stranded RNA oligomer. The recognition site GAAAU is located in the center of the oligomer, resulting in a 26-nucleotide product (the oligomer sequence is shown in Example 3). The goal was to establish a profile of enzyme activity at different incubation temperatures.

[0447] The results are as follows Figure 8 It is shown and demonstrated that the specificity of the enzyme decreases at temperatures above 30°C.

[0448]

[0449] Detection conditions

[0450] 50 mM TrisHCl pH 8.0

[0451] 25mM NaCl

[0452] 125nM RNA oligomer

[0453] 40nM ToxN1(ET-N1)

[0454] For 30 minutes at the specified temperature

[0455] Example 10a - Analysis of 5'-cap status

[0456] Perform in vitro translation (IVT) for generating RNA constructs using standard procedures.

[0457] Digest the IVT RNA at 37°C. After terminating the IVT reaction with EDTA, mix a portion of the IVT reaction with 10 - 90 nM Escherichia coli ToxN1 (ET-N1) in IVT buffer for 10 - 20 minutes. Terminate the reaction by adding urea gel loading buffer (95% formamide, 0.25 M EDTA, bromophenol blue), and load the samples onto a 20% urea / acrylamide gel. Visualize the samples with SYBRGold.

[0458] The results of the 5'-cap status analysis are as Figure 9b shown.

[0459] Example 10b - Analysis of mRNA post-transcriptional capping efficiency<00D1061>

[0460] Linearize pGEM3Zf-ETN1+13 with HincII and use it in the T7 RNAP IVT reaction. Then, cap half of the resulting GEM3Zf mRNA with vaccinia capping enzyme and purify it on a silica column. Then, digest the half-capped and half-uncapped mRNA with Escherichia coli ToxN1 (ET-N1) ribonuclease and load it onto a 10% polyacrylamide gel (TBE, Sybr Gold) containing 7 M urea. Use FIJI to quantify the relative band intensities of the capped (<<p1) and uncapped (p2) mRNA fragments (average peak height of three slices, capped mRNA is denoted as "a, b, c", uncapped mRNA is denoted as "d, e, f"). Dilute the mRNA with RNA loading buffer at 1:1 and heat it at 65°C for 10 minutes, then load approximately 150 ng of mRNA per lane.

[0461] Constructs used in IVT:

[0462] pGEM3Zf:

[0463] TAATACGACTCACTATA_GGGCGAATTCGAA↓ATCGGTACCCGGGGATCCTCTAGAGTC*GAC

[0464] Generate mRNA GEM3Zf:

[0465] (5' cap)GGGCGAAUUCGAA↓AUCGGUACCCGGGGAUCCUCUAGAGUC

[0466] ↓ToxN / Escherichia coli ToxN1 / (ET-N1) cleavage site

[0467] *HincII cutting site (for plasmid linearization)

[0468] _ indicates transcription start

[0469] The results of the analysis of 5'-cap status are as follows Figure 9c This method indicated that 56% of the mRNA was capped.

[0470] Example 10c-mRNA co-transcriptional capping efficiency analysis

[0471] pAZ_01 was linearized with PpuMI and used in T7RNAP IVT reactions (with or without co-transcriptional capping with a cap analog). Half of the capped and uncapped pAZ_01 mRNAs were digested with E. coli ToxN1 (ET-N1) endoribonuclease and loaded onto a 10% polyacrylamide gel containing 7 M urea (stained with Sybr Gold). Uncapped and capped mRNAs digested with ET-N1 showed a single, larger band, demonstrating that the capping efficiency was close to 100%. After diluting the mRNA 1:1 with RNA loading buffer and heating at 65°C for 10 minutes, approximately 150 ng of mRNA or 15 ng of RNA oligomers were loaded per lane.

[0472] Constructs used in IVT:

[0473] pAZ_01:

[0474] TAATACGACTCACTATA_AGGTCTTCTGGTCCCCACAGAA↓ATCTCAGAGAGAACCCACCATGGAGGACGCAAAGAACATAAAAAAAG*GACCC

[0475] Generation of mRNA AZ_01:

[0476] (5' cap)AGGUCUUCUGGUCCCCACAGAA↓AUCUCAGAGAGAACCCACCAUGGAGGACGCAAAGAACAUAAAAAAAG

[0477] ↓ToxN / Escherichia coli ToxN1 / (ET-N1) cleavage site

[0478] *PpuMI cleavage site (for plasmid linearization)

[0479] _ indicates transcription start

[0480] The results of the analysis of 5'-cap status are as follows Figure 9d shown.

[0481] Example 11 - Fingerprinting by Ratio Analysis of RNA Mixtures

[0482] RNA fingerprinting analysis was performed by simultaneously digesting two 20-nucleotide RNA substrates (MOD-UTR: GGGAA↓AUAAGAGAGAAAAGA-FAM and Dist1: GCCGAA↓AUAGUGACCCUGCA-FAM). The FAM-labeled products differed by only one nucleotide, resulting in 15- and 14-nucleotide product bands, respectively. Reaction conditions: 10 nM Escherichia coli ToxN1 (ET-N1), 500 nM substrate, at 37°C for 10 minutes. Only the FAM-labeled product was visible.

[0483] The fingerprint analysis results are as follows Figure 10b shown. Figure 10c The ratio of the two RNA molecules in the mixture calculated by measuring the band intensities is shown.

[0484] Example 12 - RNA Synthesis

[0485] Production of Mango aptamers. IVT-generated concatemers of Mango aptamers were digested with Escherichia coli ToxN1 (ET-N1) in a buffer containing 25 mM Tris / HCl, 25 mM NaCl, pH 7.5, at decreasing enzyme concentrations at 37°C for 20 minutes. Mango aptamers are described in Dolgosheina et al., 2014; doi:10.1021 / cb500499x.

[0486] Example 13 - Stability of the E. coli ToxN1 (ET-N1) enzyme in the presence of monovalent salts in storage buffers ranging from 100 mM NaCl to 500 mM NaCl.

[0487] Example 14 - Digestion of RNA by other ToxN endoribonucleases of the ToxIN family 25 mM Tris pH 7.5, 25 mM NaCl

[0488] 10 min at 37 °C

[0489] 500 nM RNA substrate

[0490] 10 nM endoribonuclease

[0491] Total volume 20 μL

[0492] Substrate oligomers:

[0493]

[0494] The results are as follows Figure 14 As shown, BT-N1 recognized and cleaved AAA↓AAA with good confidence. ET-N5 cleaved GAAA↓AAC and AAAA↓AUC with similar efficiency.

[0495] This example demonstrates that even though the protein sequence identity % between ET-N1 and ET-N5 is only 40.88, and the protein sequence identity % between ET-N1 and BT-N1 is only 30.95%, other endoribonucleases belonging to the ToxN enzyme family according to the pFam classification also cleave single-stranded RNA under the same buffer conditions as ToxN (ET-N1). From EMBL-EBI's ClustalOmega multiple protein sequence alignment tool (default settings) % identity was calculated.

[0496] % identity BT-N1 ET-N1 ET-N5 BT-N1 100 30.95 30.97 ET-N1 30.95 100 40.88 ET-N5 30.97 40.88 100

[0497] Sequence Listing

[0498]

[0499]

Claims

1. A composition comprising an isolated ToxN endoribonuclease or an enzymatically active fragment thereof, wherein - The concentration of the monovalent salt in the composition is ≤ 150 mM, such as about ≤ 100 mM, and wherein the monovalent salt is preferably an alkali metal salt.

2. A sample comprising at least one polyribonucleotide and an isolated ToxN endoribonuclease or an enzymatically active fragment thereof, wherein - the concentration of the monovalent salt in the sample is about ≤ 150 mM, such as about ≤ 100 mM, and wherein the monovalent salt is preferably an alkali metal salt.

3. A method for cleaving single-stranded RNA molecules in a sample, wherein the method comprises the following steps: a. providing a sample comprising at least one single-stranded RNA molecule comprising a ToxN endoribonuclease cleavage site; and b. contacting ToxN endoribonuclease or an enzymatically active fragment thereof with at least one RNA molecule in the sample under conditions that allow cleavage of at least a portion of the RNA molecule present in the sample, and wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt.

4. The method of claim 3, wherein the single-stranded RNA molecule in step a) is a concatemer comprising multiple copies of a precursor of any one of mRNA, siRNA, circular RNA, microRNA or ribozyme, and wherein the concatemer RNA molecule comprises a cleavage site for ToxN endoribonuclease between each copy of the precursor of any one of mRNA, siRNA, circular RNA, microRNA or ribozyme.

5. A method for determining the 5'-capping efficiency of an RNA molecule, wherein the method comprises the following steps: a. Providing a sample comprising at least one single-stranded mRNA molecule, wherein the single-stranded mRNA molecule comprises a ToxN endoribonuclease cleavage site in the 5'UTR of the mRNA; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the single-stranded RNA molecule to produce at least one 5' terminal RNA fragment and at least one 3' terminal RNA fragment, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and c. Isolating and detecting the RNA fragments from step b) and determining the presence of a 5'-capping modification at the 5' end of the 5' terminal RNA fragments.

6. A method for RNA fingerprint analysis, wherein the method comprises the following steps: a. providing a sample comprising at least one single-stranded RNA molecule having an unknown sequence; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the RNA molecule, thereby obtaining a plurality of RNA fragments, wherein the concentration of the monovalent salt in the sample is about ≤150 mM, such as about ≤100 mM, and wherein the monovalent salt is preferably an alkali metal salt; and c. Isolating and detecting the fragmented RNA molecules from step b, thereby obtaining a fingerprint of the RNA molecules with unknown sequence, and comparing the obtained fingerprint with the fingerprint from the RNA molecules with known sequence.

7. The method according to claims 5 and 6, wherein the separation and detection steps are selected from gel electrophoresis, capillary gel electrophoresis (CGE), PAGE, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, IP RP HPLC and LC-UV.

8. The method of claim 6, wherein the RNA molecule is selected from the group consisting of mRNA, RNA virus, immunogenic RNA molecule, viroid, long non-coding RNA and ribozyme.

9. The composition, sample or method according to any one of claims 1 to 6, wherein the composition or sample is substantially free of divalent metal cations, wherein the divalent metal cation is preferably Mg 2+ or Mn 2+ .

10. The composition, sample or method according to any one of claims 1 to 6, wherein the concentration of divalent metal cations in the composition or sample is about ≤3 mM, such as about ≤2 mM, such as about ≤1 mM, wherein the divalent metal cation is preferably Mg 2+ or Mn 2+ .

11. The composition, sample or method according to any one of claims 1 to 6, wherein the composition or sample comprises a concentration ratio of divalent metal cations to divalent ion chelating agents in the composition or sample such that the concentration of free divalent metal cations present in the composition is about ≤ 3 mM, such as about ≤ 2 mM, such as about ≤ 1 mM, wherein the divalent metal cation is preferably Mg 2+ or Mn 2+ .

12. The composition, sample or method of any one of claims 1 to 6 and 11, wherein the composition or sample comprises a divalent ion chelator at a concentration of about ≤ 10 mM.

13. The composition, sample or method according to any one of claims 1 to 6, wherein the isolated ToxN endoribonuclease comprises the amino acid sequence of SEQ ID No. 1 or an enzymatically active fragment thereof, or is a ToxN endoribonuclease comprising an amino acid sequence having at least 30% identity with SEQ ID No.

1.

14. The composition or sample of any one of claims 1, 2 or 13, wherein the isolated ToxN endoribonuclease is not complexed with ToxI RNA.

15. A kit comprising: a. A composition according to any one of claims 1, 9-14; as well as b. a second composition comprising a second enzyme and at least one additional ToxN endoribonuclease having a different recognition site than the ToxN endoribonuclease of a), wherein the second enzyme is selected from the group consisting of: an RNA polymerase, an RNA ligase for connecting single-stranded RNA molecules, a pyrophosphatase, a phosphatase, a kinase, or any other nucleic acid or ribonucleic acid modifying enzyme.

Images