A method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields and its application in the preparation of liver pâté.

By combining multiple physical field enhancement methods with microbial fermentation, the problem of the difficult degradation of the odorous substances in lamb liver has been solved, achieving efficient conversion of the odorous substances and improving product quality, which is suitable for the preparation of lamb liver pâté.

CN120642908BActive Publication Date: 2025-11-14NINGBO UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511158204.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-11-14
Estimated Expiration
2045-08-19

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively and synergistically degrade amines and aldehydes that cause fishy odor in sheep liver, resulting in residual fishy odor that affects product quality and consumer acceptance. Furthermore, traditional methods may damage the nutritional components of food or lead to quality deterioration.

Method used

A multi-physical field enhancement method was used, including high-intensity ultrasonic disruption and high-voltage pulsed electric field treatment combined with fermentation by Rhodotorula glutinis and Lactobacillus plantarum, to process lamb liver mince in sequence, thereby promoting the transformation of fishy-smelling substances.

Benefits of technology

It significantly improved the conversion rate of the pungent substances in lamb liver, maintained or improved the color, texture, acidity and degree of fat oxidation of fermented liver pâté, and enhanced the flavor and quality of the product.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120642908B_ABST
    Figure CN120642908B_ABST
Patent Text Reader

Abstract

This invention discloses a method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields and its application in the preparation of liver pâté. The method includes the following steps: adding 1-5 vt% of Rhodotorula glutinis (CGMCC NO.35011) to liver paste for fermentation, followed by adding 1-5 vt% of Bacillus plantarum (CGMCC NO.35012) for further fermentation to obtain fermented liver paste; subjecting the fermented liver paste to high-intensity ultrasonic disruption, followed by high-voltage pulsed electric field treatment, and maintaining the mixture in a 35-40℃ constant temperature incubator for 30-120 min to complete the degradation of amines and aldehydes. The invention also provides the application of the liver product prepared by the above method in the preparation of lamb liver pâté. The advantages are that it simultaneously achieves the transformation of key odorous substances in the liver and maintains or improves its physicochemical quality during the post-fermentation process, maintaining the color, texture, acidity, and degree of fat oxidation of the fermented liver pâté product unchanged.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of meat product processing technology, and in particular relates to a method for simultaneously enhancing the degradation of amines and aldehydes through multiple physical fields and its application in the preparation of liver pâté. Background Technology

[0002] Lamb liver, an important byproduct of lamb processing, is rich in nutrients such as protein, fat, vitamins, and minerals, but its utilization rate is currently low. Lamb and its byproducts develop a strong gamey odor during pre-processing, processing, storage, and reheating, resulting in a noticeable gamey smell during consumption and a lingering aftertaste, significantly reducing consumer appeal and limiting its processing potential. Lamb processing byproducts, such as lamb liver and kidneys, are particularly problematic due to their intense gamey odor, leading to low utilization rates and substantial resource waste. The gamey odor of lamb liver is related to various volatile flavor compounds, primarily amines, aldehydes, and enaldehydes. Currently, there is a lack of combined technologies to synergistically degrade amines and aldehydes, contributing to the gamey odor. Furthermore, amines and aldehydes are also major contributors to flavor degradation in livestock and poultry meat during processing and transportation, significantly affecting product quality and the processing suitability of raw meat, thus limiting consumer acceptance of the meat, resulting in gamey odors and even a rotten smell. Therefore, developing efficient deodorization technology to stabilize or improve product quality characteristics while degrading and transforming odorous substances, thereby enhancing the flavor and application potential of lamb liver, is a pressing technical challenge for the livestock and poultry processing industry.

[0003] Currently, deodorization technologies mainly include physical, chemical, and biological methods. Physical methods include adsorption, encapsulation, and sensory masking; chemical methods include Maillard reaction, acid-base-salt treatment, antioxidant methods, and ozone deodorization; biological methods include microbial fermentation, such as lactobacillus fermentation and yeast fermentation. Biological fermentation not only has a good deodorization effect but also retains the nutrients in the food matrix to the greatest extent and inhibits the growth of spoilage bacteria during the deodorization process, thus possessing significant development and utilization value. Ultrasonic food processing is a modern processing method that utilizes ultrasonic technology to modify the physicochemical properties of food. Through mechanisms such as acoustic cavitation, mechanical vibration, and thermal effects, it is widely used for various processing purposes such as sterilization, emulsification, extraction, drying, crystallization, and tenderization of food, offering advantages such as high efficiency, energy saving, environmental friendliness, and preservation of food quality. Pulsed electric field processing is a non-thermal food processing technology that uses short-duration, high-voltage pulsed electric fields (typically 1–50 kV / cm, pulse width in the μs–ms range) to act on food. Through electroporation, it disrupts cell membrane structures, achieving purposes such as sterilization, enzyme inactivation, improved extraction, or modification of biomolecular structures. Currently, there are no research reports on methods for preparing fermented liver pâté based on the synergistic degradation of amines and aldehydes using multiple physical fields. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a method for simultaneously enhancing the degradation of amines and aldehydes by multiple physical fields during the post-fermentation process to achieve the transformation of key odorous substances in liver and maintain or improve its physicochemical quality, and its application in the preparation of liver pâté. This method can maintain the color, texture, acidity and degree of fat oxidation of fermented liver pâté products.

[0005] The technical solution adopted by this invention to solve the above-mentioned technical problems is as follows: a method for simultaneously enhancing the degradation of amines and aldehydes through multiple physical fields, comprising the following steps: adding 1-5 vt% of Rhodotorula glutinis culture with preservation number CGMCC NO.35011 to liver mince for fermentation, followed by adding 1-5 vt% of Bacillus plantarum culture with preservation number CGMCC NO.35012 for fermentation to obtain fermented liver mince; subjecting the fermented liver mince to high-intensity ultrasonic disruption, followed by high-voltage pulsed electric field treatment, and maintaining it in a constant temperature incubator at 35-40℃ for 30-120 min to complete the degradation of amines and aldehydes.

[0006] Further, after adding 3 vt% of Rhodotorula glutinis culture with preservation number CGMCC NO.35011 to the lamb liver mince, it was fermented in a constant temperature incubator at 30℃ for 1 h, and then 3 vt% of Bacillus plantarum culture with preservation number CGMCC NO.35012 was added and fermented in a constant temperature incubator at 30℃ for 2 h to obtain fermented lamb liver mince.

[0007] Furthermore, the viable cell count of both the Rhodotorula glutinis culture and the Bacterium plantarum culture is 10. 7 -10 9 CFU / mL.

[0008] Furthermore, the high-intensity ultrasonic fragmentation process is as follows: ultrasonic fragmentation for 10 minutes under the conditions of an output power of 270 W and an on-off cycle of 4 s and 5 s.

[0009] Furthermore, the high-voltage pulse electric field treatment is as follows: treatment for 5 minutes in a high-voltage pulse electric field with an electric field strength of 40 kV, a pulse frequency of 300 Hz, and a duty cycle of 47%.

[0010] This invention also provides the application of the liver product prepared by the above method in the preparation of lamb liver pâté, comprising the following steps: after homogenizing the lamb liver product, it is thoroughly mixed in the following proportions by weight: 50-60 parts lamb liver sample, 3-5 parts salt, 1-3 parts white sugar, 2-4 parts vegetable oil, 2-4 parts β-cyclodextrin, 1-2 parts monoglycerides, 1-2 parts spices, and 20-30 parts brine; the mixture is placed in a water bath, the temperature is set to 95-100℃, and it is cooked for 30 minutes. After cooling, it is canned and sterilized at high temperature to obtain lamb liver pâté.

[0011] Compared with existing technologies, the advantages of this invention are as follows: This invention provides a method for simultaneously enhancing the degradation of amines and aldehydes through multiple physical fields and its application in the preparation of liver pâté. Rhodotorula glutinis and Lactobacillus plantarum, which can effectively and simultaneously transform amines and aldehydes, are inoculated into liver chyme for fermentation. After fermentation, the liver is sequentially treated with high-intensity ultrasound and high-voltage pulsed electric field, with a combined treatment time of only 15 minutes. This rapidly and efficiently promotes the synergistic transformation of key odorous substances in animal liver, such as amines and aldehydes. Based on the initial deodorization through the combined fermentation of Rhodotorula glutinis and Lactobacillus plantarum, and leveraging the enhanced electromechanical coupling effect induced by multiple physical field treatments, high-intensity ultrasound is first used to disrupt the cell walls, followed by a high-voltage pulsed electric field to enhance enzyme activity. This enhances the accessibility between the enzyme system and the substrate, exposes the enzyme's action center, and targets and promotes the biochemical metabolic activity of the microorganisms during post-fermentation, thereby further promoting the degradation and transformation of odorous substances. Through the coupling effect of multiple physical fields and microbial fermentation, the conversion rate of key odorous substances such as trimethylamine, dimethylamine, histamine, and aldehydes in the liver is significantly increased. At the same time, the physicochemical quality of fermented liver pâté, such as color, texture, acidity, and degree of fat oxidation, remains unchanged or is even significantly improved.

[0012] In summary, the present invention provides a method for the degradation of amines and aldehydes through the synergistic enhancement of multiple physical fields during post-fermentation and its application in fermented liver pâté. This method not only achieves efficient biotransformation of the odorous substances in sheep liver but also improves the physicochemical quality characteristics of sheep liver. It effectively removes the odor and improves the flavor and quality of sheep liver, providing a new technical path for the high-value-added development and utilization of sheep liver and other livestock and poultry offal meat products.

[0013] The above-mentioned red yeast ( Rhodotorula mucilaginosa The XXY10 strain, with accession number CGMCCNO.35011, was deposited on June 26, 2025, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0014] The above-mentioned Lactobacillus plantarum ( Lactiplantibacillus plantarumThe XXL11 strain, with accession number CGMCC NO.35012, was deposited on June 26, 2025, at the China General Microbiological Culture Collection Center, located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0015] Figure 1 Results of aldehyde dehydrogenase activity assay in single cultures of yeast and lactic acid bacteria;

[0016] Figure 2 Results of alcohol dehydrogenase activity assays in single cultures of yeast and lactic acid bacteria;

[0017] Figure 3 Results of extracellular protease activity assays in single cultures of yeast and lactic acid bacteria;

[0018] Figure 4 Results of intracellular protease activity assays for single cultures of yeast and lactic acid bacteria;

[0019] Figure 5 Results of aldehyde dehydrogenase activity assay in mixed cultures of yeast and lactic acid bacteria;

[0020] Figure 6 Results of alcohol dehydrogenase activity assay in mixed cultures of yeast and lactic acid bacteria;

[0021] Figure 7 Results of extracellular protease activity assay in mixed cultures of yeast and lactic acid bacteria;

[0022] Figure 8 Results of intracellular protease activity assay for mixed cultures of yeast and lactic acid bacteria;

[0023] Figure 9 This is a colony morphology diagram of Rhodotorula glutinis XXY10;

[0024] Figure 10 This is a colony morphology diagram of *Lactobacillus plantarum* XXL11.

[0025] Figure 11 Gram staining results for Rhodotorula glutinis XXY10;

[0026] Figure 12 Gram staining results for Lactobacillus plantarum XXL11;

[0027] Figure 13 The phylogenetic tree results for Rhodotorula glutinis XXY10;

[0028] Figure 14 Results of the phylogenetic tree of Lactobacillus plantarum XXL11;

[0029] Figure 15The results of measuring the activity of sheep liver aldehyde dehydrogenase under mixed bacterial fermentation under different physical field treatments;

[0030] Figure 16 The results of mixed-culture fermentation of sheep liver alcohol dehydrogenase under different physical field treatments;

[0031] Figure 17 The results of measuring the extracellular protease activity of sheep liver under mixed bacterial fermentation under different physical field treatments;

[0032] Figure 18 The results of intracellular protease activity determination in sheep liver fermentation under different physical field treatments;

[0033] Figure 19 The results of trimethylamine (TMA) determination in sheep liver fermented with mixed bacteria under different physical field treatments;

[0034] Figure 20 The results of dimethylamine (DMA) determination in sheep liver fermented with mixed bacteria under different physical field treatments;

[0035] Figure 21 The results of histamine HA determination in sheep liver fermented with mixed bacteria under different physical field treatments;

[0036] Figure 22 The results of aldehyde determination in sheep liver fermented with mixed bacteria under different physical field treatments;

[0037] Figure 23 The pH values ​​of sheep liver fermented with mixed bacteria under different physical field treatments were measured.

[0038] Figure 24 The results of TVB-N value determination for mixed-culture fermented sheep liver under different physical field treatments;

[0039] Figure 25 The results of TBARS value determination for mixed-culture fermented sheep liver under different physical field treatments;

[0040] Figure 26 Sensory analysis of mixed-culture fermented sheep liver under different physical field treatments;

[0041] Figure 27 PCA analysis of comprehensive indicators of mixed-culture fermented sheep liver under different physical field treatments;

[0042] Figure 28 PCA analysis of electronic nose in mixed-culture fermented sheep liver under different physical field treatments;

[0043] Figure 29 This study compares the effects of physical field treatment on the degradation of odorous substances before and after fermentation. Detailed Implementation

[0044] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0045] Specific Implementation Example 1: Screening and Identification of Target Strains, including the following steps:

[0046] Step 1: Initial screening of target strains: The fermented kimchi samples were serially diluted and plated onto YPD solid medium and MRS agar medium, with three replicates for each medium. The samples were incubated at 30℃ and 37℃ for 24-48 h, respectively. Different morphological colonies were selected from the plates and streaked repeatedly until purified single colonies were obtained. Ten yeast strains and two lactic acid bacteria strains were obtained from YPD solid medium and MRS agar medium, respectively. The yeast strains were initially named XXY1, XXY2, XXY3, XXY4, XXY9, XXY10, XXY12, XXY16, XXY17, and XXY21; the lactic acid bacteria were initially named XXL8 and XXL11. The YPD solid medium consisted of 20.0 g / mL glucose, 10.0 g / mL peptone, 5.0 g / mL yeast extract, and 14.0 g / mL agar. The MRS agar medium consists of peptone 10.0 g / mL, beef extract 10.0 g / mL, yeast extract 5.0 g / mL, glucose 20.0 g / mL, dipotassium hydrogen phosphate 2.0 g / mL, triammonium citrate 2.0 g / mL, sodium acetate 5.0 g / mL, magnesium sulfate 0.1 g / mL, manganese sulfate 0.05 g / mL, agar 15.0 g / mL, and Tween 80 1.0 g / mL.

[0047] Step 2: Secondary screening of target strains: Ten yeast strains and two lactic acid bacteria strains obtained from the initial screening were inoculated into YPD liquid medium and MRS broth medium, respectively, and activated for 12-24 h. After two subcultures, the activities of aldehyde dehydrogenase, alcohol dehydrogenase, extracellular protease, and intracellular protease in the bacterial cultures were measured. Yeast and lactic acid bacteria with high enzyme activity were selected for co-culture, and the enzyme activity of the mixed culture system was measured again to identify the target strains. The composition of YPD liquid medium was 20.0 g / mL glucose, 20.0 g / mL peptone, and 10.0 g / mL yeast extract. The MRS broth medium consisted of 10.0 g / mL peptone, 8.0 g / mL beef extract, 4.0 g / mL yeast extract, 20.0 g / mL glucose, 2.0 g / mL dipotassium hydrogen phosphate, 2.0 g / mL diammonium hydrogen citrate, 5.0 g / mL sodium acetate, 0.2 g / mL magnesium sulfate, 0.04 g / mL manganese sulfate, and 1.0 g / mL Tween 80.

[0048] The methods for determining the activities of aldehyde dehydrogenase, alcohol dehydrogenase, extracellular protease, and intracellular protease in bacterial culture are as follows:

[0049] (1) Preparation of crude enzyme solution: Take 5 mL of bacterial culture and centrifuge at 4℃ and 10000 × g for 5 min to collect the bacterial cells. Wash the cells with PBS buffer at pH=7.4 and resuspend them. Use an ultrasonic pulverizer to break the cells (output power 270 W, on for 4 s and off for 5 s, working time 20 min). Centrifuge the cell lysate at 4℃ and 10000 × g for 5 min and take out the supernatant, which is the crude enzyme solution.

[0050] (2) Aldehyde dehydrogenase activity assay: Add 0.1 mL Tris-HCl buffer (1 mol / L, pH=8.0), 0.1 mL KCl solution, 0.1 mL coenzyme NAD solution, 0.02 mL acetaldehyde solution, 0.01 mL mercaptoethanol solution, and 0.57 mL deionized water to a 1.5 mL centrifuge tube. After mixing, preheat in a 35℃ metal bath for 5 min. Add 0.1 mL crude enzyme solution and detect the change in absorbance at 340 nm wavelength within 1 min. The enzyme activity unit is defined as the change in OD value within 1 min. 340 A change in value of 0.001 represents 1 unit of activity. The formula for calculating aldehyde dehydrogenase activity is: Aldehyde dehydrogenase activity = [(ΔA)] / (ΔA) 340 ×μ) / (v×10 -3 ] / c, where the enzyme activity unit of aldehyde dehydrogenase is U / mL, μ is the enzyme dilution factor, v is the amount of enzyme added, c is the protein concentration (mg / mL), and ΔA 340 The increase in absorbance at 340 nm over 5 minutes is the value of the increase in absorbance.

[0051] (3) Alcohol dehydrogenase activity assay: Add 1.5 mL of sodium pyrophosphate buffer (0.1 M, pH=9.2), 0.5 mL of ethanol solution, and 1 mL of coenzyme NAD solution to a 5 mL centrifuge tube. Mix well and incubate at 37°C for 20 min. Add 0.1 mL of preheated crude enzyme solution under the same conditions. Read the absorbance at 340 nm every 1 min for 5 min until the increase in absorbance per minute reaches a stable value. One unit of enzyme activity is defined as one unit of alcohol dehydrogenase equivalent to an OD value at 37°C for 5 min. 340 The amount of enzyme required to increase the value by 0.00 l units. Formula for calculating alcohol dehydrogenase activity: Alcohol dehydrogenase activity = [(ΔA...]] 340nm [×3.1) / (ΔX×0.1)] / c, where the alcohol dehydrogenase activity unit is U / mg; where: ΔA 340 ΔX represents the increase in absorbance at 340 nm over 5 minutes; ΔX is the unit of increase in absorbance (0.001); 3.1 is the total reaction volume; 0.1 is the volume of the sample enzyme solution; c is the protein concentration (mg / mL).

[0052] (4) Extraction of crude intracellular enzyme solution: Take 5 mL of bacterial culture and centrifuge at 4℃ and 10000 × g for 5 min to collect the bacterial cells. Wash the cells with PBS and resuspend them. Use an ultrasonic pulverizer to break the cells (output power 550 W, on for 6 s and off for 5 s, working time 5.5 min). Centrifuge the cell lysate at 4℃ and 10000 × g for 5 min and take out the supernatant, which is the crude intracellular enzyme solution.

[0053] (5) Extraction of crude extracellular enzyme solution: Take 80 mL of bacterial culture and centrifuge at 4℃ and 10000 × g for 20 min. Take the supernatant and add 80% saturated ammonium sulfate to precipitate the protease. Stir in an ice water bath to dissolve it completely. Place it in a refrigerator at 4℃ and let it stand for 8-12 h to allow the protease to precipitate completely. Then take it out and centrifuge at 4℃ and 10000 × g for 20 min to collect the precipitate. Redissolve it with 0.02M PBS and centrifuge again to collect the supernatant, which is the crude extracellular enzyme solution.

[0054] (6) Protease activity assay: Take 1 mL of extracellular or intracellular crude enzyme solution into a 10 mL centrifuge tube, heat in a 40℃ water bath for 2 min, then add 1 mL of preheated 2wt% casein solution, keep the temperature precisely for 10 min, add 2 mL of 0.4 mol / L trichloroacetic acid to terminate the reaction and place in an ice bath for 10 min, centrifuge at 4℃, 10000 r / min for 10 min and collect the supernatant. Take 1 mL of the supernatant, add 5 mL of 0.4 mol / L Na2CO3 and 1 mL of Folin-Ciocalteu reagent, react in a 40℃ water bath for 20 min, and measure the absorbance at 680 nm. The formula for calculating protease activity is: Protease activity (U / g) = (A×V×4×n) / m×(1 / 10), where: A is the activity of the final diluted sample obtained from the standard curve, U / mL; V is the volume of the volumetric flask used for the solution sample, mL; 4 is the total volume of the reaction reagents, mL; n is the dilution factor of the sample; m is the mass of the sample, g; and 1 / 10 is the reaction time of 10 min, calculated as 1 min.

[0055] The results are as follows Figure 1 , Figure 2 , Figure 3 and Figure 4 As shown, the activities of aldehyde dehydrogenase, alcohol dehydrogenase, extracellular protease, and intracellular protease were compared among the 10 yeast strains and 2 lactic acid bacteria strains obtained from the initial screening. The activities of all four enzymes in yeast strains XXY1, XXY9, XXY10, XXY12, XXY16, XXY21, and lactic acid bacteria strain XXL11 were significantly higher than those in other strains. These seven strains were selected for subsequent mixed culture experiments.

[0056] The results are as follows Figure 5 , Figure 6 , Figure 7 and Figure 8 As shown, after co-culturing yeast strains XXY1, XXY9, XXY10, XXY12, XXY16, and XXY21 with lactic acid bacteria XXL11, compared with the single-strain mode, the activities of aldehyde dehydrogenase, alcohol dehydrogenase, extracellular protease, and intracellular protease were significantly increased, indicating that the co-fermentation of yeast and lactic acid bacteria can significantly improve their enzyme activities, thus showing the potential to further promote the degradation of fishy substances. Furthermore, after co-culturing yeast XXY10 with lactic acid bacteria XXL11, the activities of four enzymes were significantly higher than those of other groups, and finally, yeast XXY10 and lactic acid bacteria XXL11 with high enzyme activity expression were screened.

[0057] Step 3: Identification of target strains XXY10 and XXL11

[0058] (1) Morphological and physiological biochemical identification: Strains XXY10 and XXL11 were inoculated onto YPD solid medium and MRS agar medium, respectively, and cultured at 30℃ and 37℃ for 24-48 h, respectively, and single colonies grew. The results are as follows: Figure 9 , Figure 10 As shown. Strain XXY10 colonies are pink, relatively large, with a smooth, moist surface and strong stickiness. Strain XXL11 colonies are milky white, small and dense, opaque, with regular edges and a smooth surface. Gram staining of strains XXY10 and XXL11 was followed by observation under an optical microscope, and the results are as follows. Figure 11 , Figure 12 As shown in the table. Strains XXY10 are round or oval in shape and Gram-positive. Strains XXL11 are short or long rod-shaped and Gram-positive. The physiological and biochemical characteristics of strains XXY10 and XXL11 are shown in Tables 1 and 2.

[0059] Table 1 Physiological and biochemical characteristics of strain XXY10

[0060]

[0061] Table 2 Physiological and biochemical characteristics of strain XXL11

[0062]

[0063] Based on morphological and physiological biochemical identification results, strain XXY10 was preliminarily identified as belonging to the genus Rhodotorula, and strain XXL11 as belonging to the genus Lactobacillus.

[0064] (2)Molecular identification: Strains XXY10 and XXL11 were sequenced respectively. The nucleotide sequence of strain XXY10 is shown as SEQ ID NO.1: GACGGTGTCCTACCTGATTTGAGATCTAATCCTTAAATGTAGACATTTCTGATTAGAAGCTTCCTTTAACCCAACCCGGCTCTAGTCCGAAGACTAGAATTCCTCAGCGAATAGTCTATTACGCCAAGTCAATCCGAAGTTCGATTGCGGATGCTAATGCATTACGAACGAGCTAGACCGTAAAGGCCAGCAGCGCTCAGAAACCAAACACCTCTTCAATCATTAAGAAAGAGGAGGGTTGAAGTATTCATGACACTCAAACAGGCATGCTCCACGGAATACCATGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTTTATTTTGTTATAAAATTTAATACATTCATAGACTTTGTGTTTATAAGTGAATAGGAGTTCGCTCTCTTGCGAGAGTTACTATCCCAAACAAGTGCACAGGGTTAGAAAGTGAGAGTTCGGACTCCAAGTTAAGTTGGACGTCCTATATTCACTAATGATCCTTCCGCAGGCCCCCTAAACGGAAGAAGGATCAT。

[0065]

[0066] The sequencing results were compared with those in NCBI, and the 16S rDNA sequence of strain XXY10 was found to be... Rhodotorula mucilaginosa With 98.81% similarity, the 16S rDNA sequence of strain XXL11 is similar to... Lactiplantibacillus plantarum With 99.59% similarity, combined with physiological and biochemical identification results, strain XXY10 was identified as Rhodotorula glutinis (…). Rhodotorula mucilaginosa Strain XXL11 is *Lactobacillus plantarum* ( Lactiplantibacillus plantarum ), such as phylogenetic tree Figure 13 , Figure 14 As shown. Currently, both strains are deposited at the China General Microbiological Culture Collection Center (CGMCC). Strain XXY10 has the accession number CGMCC NO.35011, and strain XXL11 has the accession number CGMCC NO.35012. The deposit date is June 26, 2025. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences.

[0067] Specific Example 2: The effect of synergistic multiple physical field treatment of strains XXY10 and XXL11 on the degradation of amines and aldehydes in fermented sheep liver.

[0068] Example 1: Preparation of fermented liver pâté using a multi-physical field synergistic enhancement method for the degradation of amines and aldehydes during post-fermentation, comprising the following steps:

[0069] Step 1: Remove the bile and fibrous tissue from the lamb liver, cut it into small pieces, and mince it with a meat grinder to obtain lamb liver mince;

[0070] Step 2: After adding 3 vt% of Rhodotorula glutinis XXY10 bacterial solution to the lamb liver mince obtained in Step 1, ferment it in a 30℃ constant temperature incubator for 1 hour. Then add 3 vt% of Lactobacillus plantarum XXL11 bacterial solution and ferment it in a 30℃ incubator for 2 hours to obtain fermented lamb liver mince. The preparation methods of Rhodotorula glutinis and Lactobacillus plantarum bacterial solutions are as follows: the selected Rhodotorula glutinis XXY10 ( Rhodotorula mucilaginosa Lactobacillus plantarum XXL11 ( Lactobacillus plantarum After activation for two generations, culture until the viable count reaches 10. 8 CFU / mL, after centrifugation, the supernatant liquid culture medium was discarded, and the precipitated bacterial sludge was washed twice with an equal volume of physiological saline to obtain a viable count of 10. 8 CFU / mL bacterial suspension;

[0071] Step 3: The fermented lamb liver paste obtained in Step 2 is ultrasonically broken for 10 minutes under the conditions of output power of 270 W, on for 4 seconds and off for 5 seconds. Then it is treated in a high-voltage pulsed electric field with an electric field strength of 40 kV, a pulse frequency of 300 Hz, and a duty cycle of 47% for 5 minutes. It is then kept in a constant temperature incubator at 37℃ for 30-120 minutes to obtain a lamb liver sample with reduced fishy smell and improved physicochemical quality.

[0072] Step 4: After further homogenizing the lamb liver sample obtained in Step 3, thoroughly mix it according to the following formula: 50-60 parts lamb liver, 3-5 parts salt, 1-3 parts white sugar, 2-4 parts vegetable oil, 2-4 parts β-cyclodextrin, 1-2 parts monoglycerides, 1-2 parts spices, and 20-30 parts brine. Place the mixture in a water bath at 95-100℃ and cook for 30 minutes. Then remove and cool to approximately 70℃. Can the mixture under aseptic conditions and sterilize it at high temperature to obtain lamb liver pâté, designated as UPL group.

[0073] Comparative Example 1 is the same as Example 1 above, except that steps 3 and 4 are omitted, and it is referred to as the UFL group.

[0074] Comparative Example 2 is the same as Example 1 above, except that step 4 is omitted and it is referred to as group FL.

[0075] Comparative Example 3 is the same as Example 1 above, except that step 4 is adjusted to ultrasonically break down the fermented lamb liver paste obtained in step 3 for 10 min under the conditions of output power of 270 W, on for 4 s and off for 5 s, and then keep it in a constant temperature incubator at 37℃ for 30-120 min, which is recorded as UL group.

[0076] Comparative Example 4 is the same as Example 1 above, except that step 4 is adjusted to treat the fermented lamb liver paste obtained in step 3 in a high-voltage pulsed electric field with an electric field strength of 40 kV, a pulse frequency of 300 Hz, and a duty cycle of 47% for 5 min, and then keep it in a constant temperature incubator at 37℃ for 30-120 min, which is recorded as the PL group.

[0077] Comparative Example 5 is the same as Example 1 above, except that steps 3 and 4 are adjusted to involve ultrasonic treatment of yeast and lactobacillus respectively before fermentation of sheep liver. The physical field treatment is placed before the fermentation process and is designated as the UU group, as detailed below:

[0078] Rhodotorula glutinis XXY10 and Lactobacillus plantarum XXL11 were ultrasonically broken down for 10 minutes at an output power of 270 W with an on-off cycle of 4 seconds and 5 seconds. Then, 3 vt% of Rhodotorula glutinis XXY10 bacterial solution was added to the lamb liver paste obtained in step 1, and the mixture was fermented in a 30℃ incubator for 1 hour. Next, 3 vt% of Lactobacillus plantarum XXL11 bacterial solution was added, and the mixture was fermented in a 30℃ incubator for 2 hours to obtain fermented lamb liver paste. The fermented lamb liver paste was directly homogenized, and the prepared seasonings were added to the treated fermented lamb liver paste according to the proportions in Example 1, and mixed thoroughly. The mixture was placed in a water bath at 95-100℃ and cooked for 30 minutes, then removed and cooled to approximately 70℃. Under aseptic conditions, it was canned, and the packaged lamb liver pâté was sterilized at high temperature to obtain lamb liver pâté.

[0079] Specific Example 3: Determination of enzyme activity in fermented sheep liver samples treated with different physical fields.

[0080] 1. Preparation of crude enzyme solution: Take 5 g of sheep liver and add 50 mL of PBS buffer. Use a high-speed homogenizer to homogenize at 12000 rpm for 1 min. After standing, centrifuge at 4℃ and 8000 × g for 10 min and filter. Use an ultrasonic homogenizer to break the cells (output power 270 W, on for 4 s and off for 5 s, working time 20 min). Centrifuge the cell lysate at 4℃ and 10000 × g for 5 min and take out the supernatant, which is the crude enzyme solution.

[0081] 2. Intracellular crude enzyme extraction: Take 5 g of sheep liver and add 50 mL of PBS buffer. Use a high-speed homogenizer to homogenize at 12000 rpm for 1 min. After standing, centrifuge at 4℃ and 8000 × g for 10 min and filter. Use an ultrasonic homogenizer to break the cells (output power 550 W, on for 6 s and off for 5 s, working time 5.5 min). Centrifuge the cell lysate at 4℃ and 10000 × g for 5 min and take out the supernatant, which is the intracellular crude enzyme solution.

[0082] 3. Extraction of crude extracellular enzyme solution: Take 8 g of sheep liver, add 80 mL of PBS buffer, homogenize at 12000 rpm for 1 min using a high-speed homogenizer, let stand, centrifuge at 4℃ and 8000 × g for 10 min, filter, add 80% saturated ammonium sulfate to precipitate the protease, stir in an ice water bath to fully dissolve, place in a 4℃ refrigerator and let stand for 8-12 h to allow the protease to fully precipitate, then take it out and centrifuge at 4℃ and 10000 × g for 20 min to collect the precipitate, reconstitute with 0.02 M PBS, centrifuge again and collect the supernatant, which is the crude extracellular enzyme solution.

[0083] The methods for measuring aldehyde dehydrogenase, alcohol dehydrogenase, intracellular protease, and extracellular protease are the same as those in Specific Example 1 above.

[0084] according to Figure 15 , Figure 16 , Figure 17 and Figure 18 The activities of aldehyde dehydrogenase, alcohol dehydrogenase, extracellular protease, and intracellular protease in fermented sheep liver samples under different physical field treatments were compared and analyzed. The results showed that the activities of the four enzymes in the UFL group were 1140, 945.5, 3702, and 490.13 U / mL, respectively. The fermentation process significantly increased the overall enzyme activity of the samples, with the enzyme activities in the FL group increasing to 1253.33, 1247.23, 4620.67, and 552 U / mL, respectively, indicating that *Rhodotorula glutinis* and *Lactobacillus plantarum* enhanced enzyme expression levels and catalytic efficiency through metabolic interactions. The introduction of physical field treatment further enhanced enzyme activity. Compared with the FL group, the activities of the four enzymes in the UL and PL groups increased by 13.3% and 21.01%; 22.62% and 41.67%; 42.71% and 57.68%; and 14.28% and 21.83%, respectively. The UPL group exhibited the highest levels of activity across the four enzyme groups, with increases of 84.8%, 133.44%, 106.64%, and 71.28% in aldehyde dehydrogenase, alcohol dehydrogenase, extracellular protease, and intracellular protease, respectively, compared to the UFL group. Particularly noteworthy was the significant increase in aldehyde dehydrogenase activity in the UPL group, exceeding the combined increase of the UL and PL groups, demonstrating the synergistic effect of high-intensity ultrasound and high-voltage pulsed electric field treatment in stimulating enzyme activity. The combined effect of the cavitation effect generated by high-intensity ultrasound and the electroporation induced by the high-voltage pulsed electric field further improved cell membrane permeability, optimized the spatial structural stability of enzymes, and promoted the complementary utilization of metabolites among strains, thereby achieving a more efficient enzyme activity enhancement and significantly improving the metabolic efficiency and quality of the fermentation process.

[0085] Specific Example 4: Analysis of changes in odor substances TMA, DMA and HA in fermented sheep liver samples treated with different physical fields.

[0086] 1. Sample pretreatment: Add 5 g of sheep liver to 10 mL of 7.5 wt% trichloroacetic acid solution, homogenize at 12000 rpm for 1 min using a high-speed homogenizer, let stand, centrifuge at 4℃ and 8000 × g for 10 min, transfer the supernatant to a 50 mL volumetric flask, and make up to volume with 7.5 wt% trichloroacetic acid solution.

[0087] 2. Trimethylamine (TMA) determination: Take 200 μL of the above supernatant, add 50 μL of 10wt% formaldehyde solution, 500 μL of toluene, and 150 μL of 25wt% NaOH solution, and shake for 15 min to mix thoroughly. Transfer the toluene layer to a test tube containing 125 μL of 0.02wt% picric acid solution, and finally transfer it to a test tube containing an appropriate amount of anhydrous Na2SO4. Measure its absorbance at 410 nm.

[0088] 3. Determination of dimethylamine (DMA): Mix 1 mL of the above supernatant with 100 μL of copper ammonia reagent, vortex for 2 min, add 1 mL of 5 wt% CS2-benzene solution, incubate in a 50℃ water bath for 2 min, vortex again for 2 min, then add 100 μL of 30 wt% acetic acid solution and let stand for 3 min. Transfer the toluene layer to a test tube containing an appropriate amount of anhydrous Na2SO4 and measure its absorbance at 440 nm.

[0089] 4. Histamine (HA) determination: Soak 3 g of sheep liver in 6 mL of 10 wt% trichloroacetic acid solution for 2-3 h, shake for 2 min, centrifuge at 4℃ and 8000 × g for 10 min, and filter. Take 2 mL of the filtrate, adjust the pH to between 10 and 12 with NaOH, add 3 mL of n-pentanol, shake to extract for 5 min, and then centrifuge at 4℃ and 8000 × g for 5 min. Take 2 mL of the n-pentanol extract in a 10 mL centrifuge tube, add 3 mL of 1 mol / L HCl solution, shake for 2 min, and discard the n-pentanol. Take 2 mL of the HCl extract, add 3 mL of Na2CO3 and 3 mL of azo reagent, add water to the mark, mix well, let stand for 10 min, and measure the absorbance at 480 nm.

[0090] Table 3. Determination results of TMA, DMA and HA in fermented sheep liver samples under different physical field treatments.

[0091]

[0092] According to Table 3, Figure 19 , Figure 20 and Figure 21The removal rates of three typical odor substances (TMA, DMA, and HA) in five groups of samples were compared. The results showed that all treatment groups exhibited significant deodorization effects compared to the UFL group. Specifically, the contents of TMA, DMA, and HA in the FL group decreased by 32.93%, 22.79%, and 10.81%, respectively, indicating that microorganisms degraded odor substances through enzymatic reactions during fermentation. Furthermore, the removal effect of odor substances was significantly improved after the introduction of physical field treatment. Compared to the FL group, the degradation rates of TMA, DMA, and HA in the UL and PL groups increased by 22.10% and 13.13%; 5.22% and 9.5%; and 4.05% and 24.52%, respectively, indicating that physical field treatment during post-fermentation further promoted the degradation of odor substances by enhancing microbial cell membrane permeability and metabolic activity. Among them, the UPL group showed significant advantages in the degradation of the three odor substances, with degradation rates of 67.65%, 39.08%, and 76.32% for TMA, DMA, and HA, respectively. Especially for HA, the degradation rate of the UPL group was significantly higher than the sum of the UL and PL groups, showing a clear synergistic enhancement effect. This result indicates that the application of multiple physical fields to enhance the degradation of odor substances by bacterial strains during post-fermentation is not limited to increasing cell membrane permeability and metabolic activity, but is also related to electromechanical effect-driven metabolic pathway modification and metabolic flux rearrangement. Compared with single physical field treatment, the combined application of high-intensity ultrasound and high-voltage pulsed electric field can achieve higher efficiency in removing odor substances, thereby further improving the flavor quality and physicochemical stability of sheep liver samples, showing good application prospects and promotional value.

[0093] Specific Example 5: Analysis of aldehyde content in fermented sheep liver samples treated with different physical fields.

[0094] Determination of aldehydes: Accurately weigh 0.5-1.0 g of lyophilized sheep liver sample and place it in a 10 mL headspace vial. Seal the vial and place it in a static headspace sampler. Insert a 50 / 30 μm DVB / CAR / PDMS extraction head into the headspace vial and equilibrate at 120℃ for 30 min. After equilibration, automatically transfer 2 mL of gas from the top of the headspace vial and introduce it into the GC sample for analysis. GC conditions: DB624 column (30 m × 0.32 mm × 0.25 μm), injection port temperature 250℃, split mode (split ratio 20:1), carrier gas He, flow rate 2 mL / min. Temperature program: Initial column temperature 40℃, hold for 5 min, increase to 150℃ at 5℃ / min, increase to 250℃ at 15℃ / min and hold for 2 min. Mass spectrometry (MS) conditions: ion source temperature 230℃, EI mode with 70 eV electron impaction, Scan mode for qualitative and quantitative detection of volatile compounds, detection range 30-600 m / z. Volatile aldehydes in sheep liver were identified by comparing mass spectra with those of known compounds in the NIST17 mass spectrometry database. Results were obtained in triplicate.

[0095] like Figure 22 As shown, there were significant differences in the aldehyde content of sheep liver samples from different treatment groups. In the UFL group, 2-methylbutyraldehyde, 3-methylbutyraldehyde, 2-methylpropionaldehyde, benzaldehyde, and hexanal were significantly enriched, and these aldehydes were identified as characteristic odor substances in sheep liver. Compared with the UFL group, the relative abundance of aldehydes in the FL, UL, PL, and UPL groups was significantly reduced, indicating that physical field synergistic fermentation treatment can effectively degrade characteristic aldehyde odor substances in sheep liver. Among them, the UPL group showed the most significant degradation effect on aldehydes, with degradation rates of 44.66%, 52.87%, 25.43%, 96.71%, and 92.13% for 2-methylbutyraldehyde, 3-methylbutyraldehyde, 2-methylpropionaldehyde, benzaldehyde, and hexanal, respectively. This indicates that high-intensity ultrasound combined with high-voltage pulsed electric field treatment can effectively enhance the removal of aldehyde odor substances in sheep liver, which is beneficial for the efficient removal and transformation of odor substances, thereby improving the sensory quality and safety of the product.

[0096] Specific Example 6: Physicochemical Quality Analysis of Fermented Sheep Liver

[0097] 1. pH analysis of fermented sheep liver samples treated with different physical fields.

[0098] pH determination: Take 2.5 g of sheep liver and add 10 mL of deionized water. Homogenize under ice bath (8000 rpm × 10 s × 3), then filter with neutral filter paper and measure the pH of the filtrate with a pH meter.

[0099] The results are as follows Figure 23As shown, compared with the UFL group, the pH value of the FL group did not change significantly, indicating that fermentation treatment alone had little effect on the pH of the system. In contrast, the pH values ​​of the UL, PL, and UPL groups all decreased significantly, indicating that high-intensity ultrasound, high-voltage pulsed electric field, and their combined treatment significantly promoted the accumulation of acidic metabolites during fermentation. Physical field treatment enhanced the efficiency of microbial utilization of substrates and increased their metabolic activity, thereby generating more acidic products and causing a decrease in pH value. An acidic environment is conducive to protein gelation, promotes protein degradation and the release of free amino acids, and thus improves the texture stability, water retention, and nutritional and functional properties of the samples.

[0100] 2. TVB-N value analysis of fermented sheep liver samples treated with different physical fields.

[0101] TVB-N value determination: Weigh 5 g of minced sheep liver, add 50 mL of deionized water, shake to disperse the sample evenly in the water, soak for 30 min, and then filter. Accurately pipette 10 mL of filtrate and 5 mL of magnesium oxide suspension into a digestion tube, place it in the reaction chamber, tighten the screw clamp, add 5 drops of mixed indicator to the receiving flask, set the amount of boric acid to 10 mL, the amount of water to 10 mL, distill for 5 min, and remove the receiving flask of the distillate. Titrate with hydrochloric acid standard titration solution to the endpoint. Use a mixed indicator solution of 2 parts methyl red ethanol solution and 1 part methylene blue ethanol solution, the endpoint color is blue-purple, and a reagent blank is prepared at the same time.

[0102] like Figure 24 As shown, the TVB-N value differed significantly among the different treatment groups. The UFL group had the highest TVB-N value, at 17.83 mg / 100g. In contrast, the TVB-N values ​​of the FL (11.57 mg / 100g), UL (7.75 mg / 100g), PL (8.68 mg / 100g), and UPL (4.95 mg / 100g) groups were all significantly lower than those of the UFL group, indicating that the combined fermentation treatment with different physical fields can effectively inhibit amino acid degradation and slow down the spoilage process of the samples. Among them, the UPL group showed the most significant inhibitory effect, with a TVB-N value reduced by 72.25% compared to the UFL group, 57.26% compared to the FL group, 36.14% compared to the UL group, and 43.01% compared to the PL group. This indicates that the combined application of high-intensity ultrasound and high-voltage pulsed electric field treatment can significantly reduce the TVB-N value and improve the quality and stability of fermented sheep liver.

[0103] 3. TBARS value analysis of fermented sheep liver samples treated with different physical fields.

[0104] TBARS determination: Weigh 2 g of sheep liver and add it to a centrifuge tube. Then add 10 mL of trichloroacetic acid mixture to the centrifuge tube, homogenize at high speed (12000 rpm × 15 s × 3) in an ice bath, and filter twice with double-layer neutral filter paper. Take 1 mL of filtrate, add 1 mL of thiobarbituric acid, vortex and mix for 1 min, heat in a metal bath for 40 min (100℃), remove and cool to room temperature, and centrifuge at 4℃ for 10 min. Take 1 mL of supernatant, add 1 mL of chloroform, vortex and extract for 1 min, allow to stand for layering, and add 200 μL of supernatant to an ELISA plate for testing. Record the absorbance values ​​at 532 nm and 600 nm and calculate the TBARS value. TBARS (mg / kg) = (A 532 -A 600 )÷155×0.5×72.6×1000.

[0105] like Figure 25 As shown, the TBARS value is an important indicator for measuring the level of lipid oxidation, and its value directly reflects the degree of lipid oxidation in the sample. Compared with the UFL group, the TBARS value of the FL group decreased by 13.25%, indicating that the co-fermentation treatment of Rhodotorula glutinis and Lactobacillus plantarum can effectively inhibit the lipid oxidation process and reduce the accumulation of lipid oxidation products. After applying the physical field, the oxidation inhibition effect was further enhanced. The TBARS values ​​of the UL group and PL group decreased by 26.31% and 18.05% compared with the UFL group, respectively. Further analysis showed that the TBARS value of the UPL group was the lowest, decreasing by 40.8%, 21.75%, 19.66%, and 27.76% compared with the UFL, FL, UL, and PL groups, respectively. This result indicates that the combined treatment of high-intensity ultrasound and high-voltage pulsed electric field can effectively enhance the antioxidant capacity of fermented sheep liver, reduce the generation of lipid oxidation products, and thus significantly improve the physicochemical quality of the sample.

[0106] 4. Color difference analysis results of fermented sheep liver samples treated with different physical fields

[0107] Color difference measurement: Brightness (L), redness (a), and yellowness (b) were measured using a colorimeter (CR-400 Konica Minolta Investment Ltd, Tokyo, Japan). The instrument was calibrated using white and black ceramic plates (L=98.14, a=-0.23, b=1.89). The L, a, and b values ​​correspond to brightness, redness, and yellowness, respectively. Color measurements were performed on fermented sheep liver at room temperature, in triplicate. The results are shown in Table 4.

[0108] Table 4. Color difference analysis of fermented sheep liver samples treated with different physical fields

[0109]

[0110] As shown in Table 4, compared with the UFL group, the L, a, and b values ​​of the FL, UL, PL, and UPL groups did not change significantly. This indicates that the combined treatment of high-intensity ultrasound and high-voltage pulsed electric field during the post-fermentation process has no significant impact on the color characteristics of sheep liver. This suggests that the treatment method can effectively maintain the physicochemical properties of sheep liver while keeping its color stable, thus meeting the requirements for appearance quality.

[0111] 5. Texture analysis results of fermented sheep liver samples treated with different physical fields

[0112] Texture determination: 30 g of crushed sheep liver was weighed and added to the sample cup matched with the A / BE35 probe. The TPA mode was used to test the texture of the sample: pre-test speed 1 mm / s, mid-test speed 1 mm / s, post-test speed 1 mm / s, test distance 5 mm, trigger force 5 g. The hardness, adhesion, cohesion, elasticity, and chewiness of the sheep liver sample were recorded, and the results are shown in Table 5.

[0113] Table 5. Texture analysis of fermented sheep liver samples treated with different physical fields

[0114]

[0115] Table 5 shows that compared with the UFL group, the hardness, cohesiveness, and chewiness of the FL, UL, PL, and UPL groups did not change significantly, but their adhesiveness increased significantly and their elasticity decreased significantly. This result indicates that the synergistic treatment of physical field and bacterial fermentation had a certain impact on the texture properties of lamb liver, particularly the changes in adhesiveness and elasticity, which may be related to changes in protein structure during fermentation and physical field treatment. Overall, this treatment method effectively maintains the hardness and chewiness of lamb liver while improving its adhesiveness, further enhancing the product's taste and eating experience.

[0116] 6. Sensory analysis of fermented sheep liver samples treated with different physical fields.

[0117] Sensory evaluation: Weigh 5 g of lamb liver and transfer it to a 20 mL headspace vial. Seal the vial and equilibrate in a 30°C water bath for 30 min. The sensory evaluation panel consisted of 10 members aged 22-28 years with a food science background. The odor rating scale was 0-10, where 0 represents no odor and 10 represents the strongest odor. Upon receiving the instruction, the sensory evaluation panel members quickly opened a set of sample vials numbered according to a random number table on the table and scored the lamb liver samples in each vial based on their odor.

[0118] like Figure 26As shown, the perceived fishy smell of sheep liver samples changed significantly after treatment with different physical fields. The UFL group had the highest fishy smell score, at 8.83. Fermentation significantly reduced the perceived fishy smell of sheep liver; the FL group had a fishy smell perception score of 7.33, a 17% decrease compared to the UFL group. The UL and PL groups had fishy smell perception scores of 6.43 and 5.88, respectively, representing decreases of 27.2% and 33.43% compared to the UFL group. This indicates that applying physical field treatment during post-fermentation can effectively reduce fishy substances in sheep liver and lower its perceived fishy smell. Further analysis showed that the UPL group had the lowest fishy smell perception score, at 4.45, a decrease of 49.58%, 39.25%, 30.74%, and 24.26% compared to the UFL, FL, UL, and PL groups, respectively. This highlights the significant advantages of combined high-intensity ultrasound and high-voltage pulsed electric field treatment in promoting the degradation of fishy substances and improving the sensory quality of sheep liver.

[0119] Specific Implementation Example 7: Principal Component Analysis (PCA) of Comprehensive Indicators of Fermented Sheep Liver Samples Treated with Different Physical Fields.

[0120] like Figure 27 As shown, a comprehensive PCA analysis was performed on the flavor and physicochemical properties of lamb liver under different treatments. The results showed that the distribution of different treatment groups was clearly separated in the PCA diagram, indicating that different treatment methods had a significant impact on the flavor and physicochemical quality of lamb liver. Further analysis revealed that the flavor and physicochemical properties of lamb liver under different treatment methods exhibited a progressive trend from the unfermented group (UFL) to the conventionally fermented group (FL), then to the single physical field treatment group (UL, PL), and finally to the combined physical field treatment group (UPL). This clearly revealed the migration path of flavor substances and highlighted the significant advantages of combined ultrasonic and pulse treatment in synergistically enhancing fermentation effects and significantly optimizing the flavor and quality of lamb liver, providing a strong theoretical basis for the process optimization and quality improvement of related products.

[0121] Specific Implementation Example 8: Electronic nose PCA analysis of fermented sheep liver samples treated with different physical fields.

[0122] Electronic nose assay: Weigh 5 g of sheep liver, transfer it to a 20 mL headspace vial, seal it, and place it in a 30℃ water bath for equilibration for 30 min. Then, insert the electronic nose injection needle into the sample vial for detection. Instrument parameter settings: cleaning time 70 s, detection time 120 s, and airflow rate 150 mL / min.

[0123] like Figure 28As shown, the electronic nose PCA results revealed significant differences in flavor profiles between the lamb liver samples before and after treatment. The contribution rates of the first principal component (PC1) and the second principal component (PC2) were 49.3% and 29.9%, respectively, with a total contribution rate of 79.2%. This indicates that PCA analysis can comprehensively reflect the characteristic flavor information of lamb liver, and the results have high reliability. Furthermore, the distribution of different treatment groups in the PCA diagram showed a gradual migration trend from the unfermented group to the combined physical field treatment group. This change is highly consistent with the PCA analysis results of the flavor and physicochemical indicators mentioned above, further validating the significant advantages of combined physical field treatment in optimizing the flavor quality of lamb liver.

[0124] Specific Example 9: Analysis of the Degradation Effect of Physical Field Treatment Before and After Fermentation on the Odor Substances of Lamb Liver

[0125] like Figure 29 As shown, under the single fermentation mode, the degradation rates of TMA, DMA, and HA in the FL group were 32.93%, 22.79%, and 10.81%, respectively. Except for the UU group, which showed no significant difference in the degradation effect of TMA, the other physical field treatment groups all showed significant improvements in the degradation of the three amine-based odor substances TMA, DMA, and HA compared to the FL group, indicating that the introduction of the physical field helps to enhance the fermentation system's ability to remove odor substances.

[0126] Furthermore, regarding the removal of TMA, the degradation rates of the UL, PL, and UPL groups were 27.05%, 18.08%, and 39.67% higher than that of the UU group, respectively. In terms of the removal of DMA and HA, although the degradation rates of the UL and PL groups were slightly lower than those of the UU group, the degradation rates of the UPL group were 3.64% and 21.81% higher than those of the UU group, respectively, demonstrating the significant advantages of combined physical field treatment in deodorization. These results indicate that introducing physical field treatment, especially the combined treatment of ultrasound and high-voltage pulsed electric fields, during the post-fermentation stage can effectively promote the degradation and transformation of amine-based odor-causing substances such as TMA, DMA, and HA. Compared to physical field intervention methods before fermentation, the post-fermentation stage treatment mode exhibits superior performance in odor control, possessing high industrial application potential and promotional value, and providing technical support for optimizing the quality of flavored foods.

[0127] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. A method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields, characterized in that, Includes the following steps: Fermented liver mince was obtained by adding 1-5 vt% of Rhodotorula glutinis culture (CGMCC NO.35011) to liver mince and then fermenting it with 1-5 vt% of Bacillus plantarum culture (CGMCC NO.35012). The fermented liver mince was then subjected to high-intensity ultrasonic disruption and then high-voltage pulsed electric field treatment, and kept in a constant temperature incubator at 35-40℃ for 30-120 min to complete the degradation of amines and aldehydes.

2. The method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields according to claim 1, characterized in that, After adding 3 vt% of Rhodotorula glutinis culture with preservation number CGMCC NO.35011 to the lamb liver mince, ferment it in a constant temperature incubator at 30℃ for 1 h. Then add 3 vt% of Bacillus plantarum culture with preservation number CGMCC NO.35012 and ferment it in a constant temperature incubator at 30℃ for 2 h to obtain fermented lamb liver mince.

3. The method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields according to claim 2, characterized in that, The viable cell counts of both the Rhodotorula glutinis culture and the Bacterium plantarum culture are 10. 7 -10 9 CFU / mL.

4. The method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields according to claim 1, characterized in that, The high-intensity ultrasonic fragmentation process is as follows: ultrasonic fragmentation for 10 minutes under the conditions of output power of 270 W, on for 4 seconds and off for 5 seconds.

5. The method for simultaneously enhancing the degradation of amines and aldehydes using multiple physical fields according to claim 4, characterized in that, The high-voltage pulse electric field treatment is as follows: the electric field strength is 40 kV, the pulse frequency is 300 Hz, and the duty cycle is 47%, and the treatment lasts for 5 minutes.

6. The use of a liver product prepared by the method according to any one of claims 1-5 in the preparation of lamb liver pâté, characterized in that, Includes the following steps: After homogenizing the lamb liver product, mix it thoroughly according to the following weight ratio: 50-60 parts lamb liver sample, 3-5 parts salt, 1-3 parts white sugar, 2-4 parts vegetable oil, 2-4 parts β-cyclodextrin, 1-2 parts monoglycerides, 1-2 parts spices, and 20-30 parts brine. Place the mixture in a water bath, set the temperature to 95-100℃, cook for 30 minutes, then remove, cool, can, and sterilize at high temperature to obtain lamb liver pâté.

Citation Information

Patent Citations

  • Composite leavening agent for reducing content of biogenic amine in sausages and method for preparing sausages through fermentation of composite leavening agent

    CN116716213A

  • Lactobacillus plantarum for degrading low-molecular aldehydes, composition of lactobacillus plantarum and application of lactobacillus plantarum in degradation of fishy smell of duck liver

    CN119799597A