Highly enantioselective p-nitrophenylethyl esterase mutants, their construction methods and applications
By site-directed mutagenesis of p-nitrophenylethyl esterase pnbA in Bacillus subtilis, a highly enantioselective p-nitrophenylethyl esterase mutant was constructed, solving the problems of multiple reaction steps and low purity in the existing synthesis of 1S,5R-hydrated pinol, and realizing the efficient production of highly enantioselective 1S,5R-hydrated pinol.
Patent Information
- Application Number
- CN202511144060.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-08-15
AI Technical Summary
Existing methods for synthesizing 1S,5R-hydrated pinol suffer from numerous reaction steps, unsuitability for large-scale production due to the use of precious metal catalysts, numerous side reactions, and low optical purity of the product, which limit their application in industrial synthesis.
By performing site-directed mutagenesis on the p-nitrophenylethyl esterase pnbA of Bacillus subtilis, a highly enantioselective p-nitrophenylethyl esterase mutant was constructed. It was then used to catalyze the dynamic hydrolysis and resolution of racemic or low enantioselective trans-pinenyl acetate hydrate to obtain highly enantioselective 1S,5R-pinenol hydrate.
The enantioselectivity was significantly improved, the catalytic activity was enhanced, and the product ee value was increased from 29.90% to 95.13%, which is suitable for large-scale production of high-value chiral intermediate 1S,5R-hydrated pinanol.
Smart Images

Figure CN120648670B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering technology, and in particular to a highly enantioselective p-nitrophenylethyl esterase mutant, its construction method, and its application. Background Technology
[0002] 1S , 5R- Sobrerol is a chiral trans-sobrerol with the molecular formula C1. 10 H 18 O2, belonging to the terpene diol class of compounds, is widely used in organic synthesis and the pharmaceutical industry.
[0003] Among the various chiral compounds of hydrated pinol, 1S , 5R- Hydrated pinol is often the most important chiral compound, possessing unique optical activity and exhibiting a variety of biological activities in the pharmaceutical field. Studies have shown that... 1S , 5R - Hydrated pinol has mucus-thinning, mucociliary clearance-promoting, antioxidant, and secretory IgA-increasing effects. Clinically, it is often formulated into various dosage forms such as syrup and nebulizer to treat respiratory tract infections with high mucus secretion, such as bronchitis and asthma.
[0004] at present, 1S , 5R- The synthesis of hydrated pinol mainly involves using methyl 3,5-dihydroxy-4-methylbenzoate as a starting material, and synthesizing optically pure pinol through an 8-step reaction. 1S , 5R - Hydrated pinene (Journal of Chemical Research in Chinese Universities, 2004, 25(6):1069, CN1435402A) and oxidative synthesis from α-pinene. 1S , 5R- Hydrated pinol (Tetrahedron, 1998, 54(3-4): 593-598). The former (pioneer) suffers from multiple reaction steps and the use of precious metal catalysts in intermediate reactions, which are detrimental to large-scale industrial production. The latter (pinenol) has numerous side reactions and low optical purity of the product. These drawbacks limit its application in... 1S , 5R - Further applications in the industrial synthesis of hydrated pinol.
[0005] Therefore, it is now necessary to improve existing technologies to provide more reliable solutions. Summary of the Invention
[0006] The technical problem to be solved by this invention is to address the shortcomings of the prior art by providing a highly enantioselective p-nitrophenylethyl esterase mutant, its construction method, and its applications. This invention is based on obtaining [the mutant] through dynamic kinetic resolution. 1S , 5R- A method for hydrated pinol was proposed, which demonstrates that racemic or low-diatopic-selective trans-acetic acid hydrated pinol can undergo dynamic kinetic hydrolysis and resolution under the action of esterase catalysts, yielding a single-configuration chiral intermediate after separation. 1S , 5R - Hydrated pinyl alcohol finished product.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In the first aspect of the present invention, a highly enantioselective p-nitrophenylethyl esterase mutant is provided, wherein the p-nitrophenylethyl esterase mutant is obtained by mutating the amino acid sequence of the wild-type p-nitrophenylethyl esterase pnbA as shown in SEQ ID NO.1 in one or more combinations of the following: leucine (L) at position 273 is mutated to aspartic acid (D), phenylalanine (F) at position 314 is mutated to histidine (H), and leucine (L) at position 362 is mutated to arginine (R).
[0008] Preferably, the amino acid sequence of wild-type p-nitrophenylethyl esterase pnbA was obtained by querying and screening from the NCBI database.
[0009] Preferably, the p-nitrophenylethyl esterase mutant is obtained by combining and mutating the amino acid sequence of the wild-type p-nitrophenylethyl esterase pnbA as shown in SEQ ID NO.1 in the following manner:
[0010] The 273rd leucine (L) is mutated to aspartic acid (D), the 314th phenylalanine (F) is mutated to histidine (H), and the 362nd leucine (L) is mutated to arginine (R).
[0011] Preferably, the amino acid sequence of the single point mutant obtained by mutating phenylalanine (F) at position 314 of the amino acid sequence of wild-type p-nitrophenylethyl esterase pnbA to histidine (H) is SEQ ID NO.2.
[0012] Preferably, the amino acid sequence of the combined mutant obtained by mutating phenylalanine (F) at position 314 of the amino acid sequence of wild-type p-nitrophenylacetylesterase pnbA to histidine (H) and leucine (L) at position 362 to arginine (R) is SEQ ID NO.3.
[0013] Preferably, the amino acid sequence of the combined mutant obtained by mutating leucine (L) at position 273 to aspartic acid (D), phenylalanine (F) at position 314 to histidine (H), and leucine (L) at position 362 to arginine (R) in the amino acid sequence of wild-type p-nitrophenylethyl esterase pnbA is SEQ ID NO.4.
[0014] A second aspect of the present invention provides a gene encoding a para-nitrophenylethyl esterase mutant as described above.
[0015] Preferably, the nucleotide sequence encoding the wild-type p-nitrophenylethyl esterase pnbA as shown in SEQ ID NO.1 is SEQ ID NO.5, and the genes encoding the p-nitrophenylethyl esterase mutant are all obtained by site-directed mutagenesis based on the nucleotide sequence shown in SEQ ID NO.5.
[0016] A third aspect of the present invention provides a recombinant plasmid comprising the genes described above.
[0017] Preferably, the plasmid vector of the recombinant plasmid is pET-28a(+).
[0018] In a fourth aspect, the present invention provides a host cell comprising the gene or recombinant plasmid as described above.
[0019] Preferably, the host cell is a prokaryotic cell.
[0020] Preferably, the host cell is *Escherichia coli* containing the recombinant plasmid described above. E.coli. BL21.
[0021] A fifth aspect of the present invention provides a method for constructing a highly enantioselective p-nitrophenylethyl esterase mutant as described above, the method comprising the following steps: culturing host cells as described above, inducing expression of the p-nitrophenylethyl esterase mutant; collecting the host cells for disruption and centrifugation, and separating and purifying the p-nitrophenylethyl esterase mutant from the supernatant.
[0022] In a sixth aspect, the present invention also provides a soluble protein or engineered bacteria comprising the above-described p-nitrophenylethyl esterase mutant.
[0023] A seventh aspect of the present invention provides a method for the generation of ester compounds before catalysis using a p-nitrophenylethyl esterase mutant, gene, recombinant plasmid, or host cell as described above. 1S , 5R- Applications of hydrated pinol.
[0024] Preferably, the proester compound is racemic pinene-formate hydrate or racemic pinene-acetic acid hydrate.
[0025] This invention provides a method for producing racemic or low-enantioselective trans-acetic acid hydrate pinyl ester as a substrate. 1S , 5R A green synthesis method for 1S,5R-hydrated pinol is described, wherein the above-mentioned p-nitrophenylethyl esterase mutant MBIII (L273D / F314H / L362R) is added to the reaction system to carry out the reaction and obtain a reaction solution; the reaction solution is then subjected to product extraction to obtain the target product 1S,5R-hydrated pinol.
[0026] In one embodiment of the present invention, the concentration of the p-nitrophenylethyl esterase mutant added to the reaction solution is 0.1~0.5 mg / mL.
[0027] In one embodiment of the present invention, the fluorescence coupling reaction system for ELISA reader detection contains rac- Pinyl formate hydrate, formate oxidase (AoFOX), horseradish peroxidase (HRP), fluorescent substrate AR-2, and buffer solution.
[0028] In one embodiment of the present invention, the concentration of 1S,5R-formic acid hydrate pinene is 5~50 mM, the concentration of formate oxidase (AoFOX) is 0.01~0.05 mg / mL, the concentration of horseradish peroxidase (HRP) is 0.9 U / mL, and the concentration of fluorescent substrate AR-2 is 0.1~0.2 mM.
[0029] In one embodiment of the present invention, the buffer solution is a phosphate buffer solution with a concentration of 50 mM.
[0030] In one embodiment of the present invention, the reaction temperature is 37°C, the pH is 7.0, and the reaction time is 30~60 min.
[0031] In one embodiment of the present invention, the reaction system for gas chromatography detection contains rac -Pinyl acetate hydrate and buffer solution.
[0032] In one embodiment of the present invention, the concentration of racemic pinene acetate hydrate added is 20~100 mM.
[0033] In one embodiment of the present invention, the buffer solution is a phosphate buffer solution with a concentration of 50 mM.
[0034] In one embodiment of the present invention, the reaction temperature is 37°C, the pH is 7.0, and the reaction time is 0.5~3h.
[0035] The beneficial effects of this invention are:
[0036] This invention first uses site-directed saturation mutagenesis technology to target bacteria derived from Bacillus subtilis. Bacillus subtilis A saturated mutant library of key amino acid sites in the active pocket of p-nitrophenylethyl esterase pnbA (SEQ ID NO.1) was constructed, and single-point mutants of p-nitrophenylethyl esterase with enhanced activity were obtained by fluorescence coupling reaction and screening. The mutants obtained by screening (E105L, A107T, A107D, F271E, F271S, F271V, L273D, L273V, F314N, F314H, M358K, L362R) catalyze 1S , 5R- Pinyl formate hydrate exhibits significantly higher activity than the unmutated wild-type (WT). Among these, the mutants pnbA-F314N and pnbA-F314H catalyze… 1S , 5R- The activity of pinene formate hydrate was increased by 12.20 times and 12.49 times compared to WT, respectively. Therefore, this invention subsequently selected site combination mutations based on pnbA-F314N and pnbA-F314H, and used gas chromatography to detect and screen the dynamic kinetic hydrolysis resolution effect of the mutants on racemic pinene hydrate, obtaining mutants with significantly improved enantioselectivity (pnbA-F314H, pnbA-F314H / L362R, pnbA-L273D / F314H / L362R). Specifically, the ee values of mutants pnbA-F314H, pnbA-F314H / L362R and pnbA-L273D / F314H / L362R increased to 88.05%, 92.66% and 95.13% respectively compared to WT's 29.90%. The enhanced enantioselectivity demonstrates that the p-nitrophenylethyl esterase mutants disclosed in this invention, especially pnbA-L273D / F314H / L362R, catalyze... 1S , 5R - Pinyl acetate hydrate has high enzyme activity. ee High value and high conversion rate, suitable for producing high-value chiral intermediates. 1S , 5R- Application prospects of hydrated pinol and similar terpene diols. Attached Figure Description
[0037] Figure 1 This invention relates to Bacillus subtilis. Bacillus subtilis Structural simulation of p-nitrophenylethyl esterase pnbA and comparison with 1S , 5R A schematic diagram of the molecular docking of 1-acetic acid hydrate pinyl ester, where Ser-189 is the catalytic residue, and Leu273, Phe314 and Leu362 are the target residues for mutation;
[0038] Figure 2This invention obtains information through dynamic decomposition. 1S , 5R- Route map of hydrated pinol;
[0039] Figure 3 This is a schematic diagram of the p-nitrophenylethyl esterase activity detection method used in this invention;
[0040] Figure 4 These are the gas chromatograms of hydrated pinol, hydrated pinyl acetate, and hydrated pinyl formate disclosed in this invention.
[0041] Figure 5 This invention discloses a comparison of the enzyme activities of superior mutants obtained by screening a site-directed saturation mutant library of p-nitrophenylethyl esterase, wherein the activity of wild type is used as 1 for relative enzyme activity comparison.
[0042] Figure 6 This invention presents the enantioselectivity comparison results between the dominant mutant of p-nitrophenylethyl esterase pnbA and the wild type, wherein... ee Indicates the enantiomeric excess value of 1S,5R-hydrated pinol;
[0043] Figure 7 This is an SDS-PAGE electrophoresis image of the purified p-nitrophenylethyl esterase pnbA wild-type (WT) of this invention. Detailed Implementation
[0044] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.
[0045] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.
[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. For examples where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer are followed. For reagents or instruments whose manufacturers are not specified, they are all commercially available products.
[0047] The Escherichia coli used in this invention E.coli BL21(DE3) competent cells were purchased from Beijing TransGen Biotech Co., Ltd.; wild-type p-nitrophenylethyl esterase pnbA wild-type plasmid based on the pET-28a(+) plasmid vector and primers for constructing site-directed mutant plasmids were synthesized by Beijing Qingke Biotechnology Co., Ltd.; DNA polymerase, restriction endonuclease, Dpn I, recombinase and other molecular biology reagents used were purchased from Takara; trans-acetic acid hydrate pinyl ester, ...1S , 5R - Pinyl formate hydrate was provided by Professor Chen Jianzhong of Shanghai Jiao Tong University; the fluorescent substrate AR-2 was provided by Professor Liu Fang of Guangzhou University of Chinese Medicine; and other biochemical reagents were purchased from Aladdin Biochemical Technology Co., Ltd.
[0048] The PCR instrument used was purchased from Thermo Fisher Scientific, and the microplate reader used was a BioTek Synergy H1; the high-performance gas chromatograph used was an Agilent 8860 GC System, the detector used was a flame ionization detector (FID), and the chiral column used was an Agilent Cyclodex-B (60 m × 0.25 mm × 0.25 μm).
[0049] The culture media involved in the following examples are as follows:
[0050] LB solid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl, 15 g / L agar and 50 mg / L kanamycin.
[0051] LB liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl and 50 mg / L kanamycin.
[0052] The principle of fluorescence-coupled detection of wild-type p-nitrophenylethyl esterase pnbA is as follows: Figure 2 As shown, the specific solution is as follows:
[0053] by 1S , 5R- Pinyl formate hydrate is the initial reaction substrate, which is hydrolyzed by wild-type p-nitrophenylethyl esterase pnbA in the first-stage reaction to produce 1S , 5R The hydration of pinol also produces an equimolar amount of formic acid. Formic acid, as a byproduct, is specifically recognized and oxidized by formic acid oxidase (AoFOX) in the second-stage coupling reaction to form CO2 and H2O2. In the third-stage coupling reaction, H2O2 is oxidized by horseradish peroxidase (HRP) using the fluorescent substrate AR-2 to produce fluorescent resorufin-Cl. The relative quantitative analysis of pnbA activity can be performed rapidly and sensitively by detecting the fluorescence intensity of the fluorescent product.
[0054] The fluorescent enzyme activity detection system (100 μL) consisted of: 50 mM 1S, 5R-formate hydrated pinene, 0.01 mg / mL wild-type or mutant wild-type p-nitrophenylethyl esterase pnbA, 0.05 mg / mL formate oxidase AoFOX, 0.9 U / mL horseradish peroxidase HRP, and 0.1 mM fluorescent substrate AR-2. The present invention designs a fluorescent coupling strategy for pnbA-formate oxidase-peroxidase targeting chiral pinene hydrated products, as follows: Figure 3 As shown, it is used for the detection of pnbA enzyme activity of nitrophenylethyl esterase.
[0055] The reaction was carried out at 37℃ and fluorescence was detected in real time. Excitation wavelength: 582 nm, emission wavelength: 602 nm, gain: 50, continuous shaking plate for 5 s, fluorescence was detected once every 1 min, and continuous detection was carried out for 30 minutes.
[0056] The chiral ester substrate and chiral alcohol product of the catalytic reaction were qualitatively and quantitatively analyzed by gas chromatography (GC). The carrier gas N2 flow rate was set to 1 mL / min, the injection volume was 1 μL, and the temperature program was set as follows: initial temperature 120℃ held for 0.5 min, then increased from 120℃ to 195℃ at a rate of 1.5℃ / min, and held at 195℃ for 5 min. The enantiomeric excess (ee), conversion (C), and enantiomeric ratio (E) of the product were calculated according to the following formulas:
[0057] ;
[0058] ;
[0059] In the formula C 1S5R and C 1R5S These represent the values in the reaction system at the end of the reaction. 1S , 5R - Hydrated pinol and 1R , 5S- The final concentration of hydrated pinol, C 1S5R-ace Represents the initial state of the reaction system. 1S , 5R - Initial concentration of pinyl acetate hydrate.
[0060] Example 1: Construction of a wild-type p-nitrophenylacetase pnbA site saturation mutant library and site-directed mutant plasmid
[0061] Based on the amino acid sequence SEQ ID NO.1 of wild-type p-nitrophenylethyl esterase pnbA, protein homology modeling analysis was performed on the SWISS-MODEL website. The simulated structure was then molecularly docked with amino donor substrates and amino acceptor substrates (AutoDock 4.2.6 software) to analyze its substrate binding pocket and screen key amino acid residues G105, G106, A107, F108, L110, A190, M193, I270, F271, L273, F275, F314, M358, L362, and F363.
[0062] Using the primers shown in Table 1, with wild-type plasmid pET-28a(+)- Tb Using TA as a template, whole-plasmid single-point mutation PCR was performed to construct an NNK saturated mutation library for key amino acid sites. Then, the mutation libraries for different sites were mixed in equal molar amounts to construct a saturated mutation library for all sites. After confirming that the sequencing was correct, the plasmid was extracted and stored.
[0063] Table 1. NNK primers for constructing the pnbA site saturated mutant library
[0064] Primer Name Sequence 5’-3’ pnbA-G105-F GGATTCATNNKGGCGCGTTTTATCTGGGTGC pnbA-G105-R AACGCGCCMNNATGAATCCATACCATAACCGGCAG pnbA-G106-F TTCATGGCNNKGCGTTTTATCTGGGTGCAGGT pnbA-G106-R TAAAACGCMNNGCCATGAATCCATACCATAACCGG pnbA-A107-F CATGGCGGCNNKTTTTATCTGGGTGCAGGTTCCG pnbA-A107-R CAGATAAAAMNNGCCGCCATGAATCCATACC pnbA-F108-F GCGGCGCGNNKTATCTGGGTGCAGGTTCCGAG pnbA-F108-R CCCAGATAMNNCGCGCCGCCATGAATC pnbA-Y110-F GCGTTTTATNNKGGTGCAGGTTCCGAGCC pnbA-Y110-R CCTGCACCMNNATAAAACGCGCCGCCATGAA pnbA-A190-F GTGAATCTNNKGGGGGCATGAGTATCGCTG pnbA-A190-R ATGCCCCCMNNAGATTCACCGAAGACGGTAAC pnbA-M193-F CTGGGGGCNNKAGTATCGCTGCGCTGCTAG pnbA-M193-R GCGATACTMNNGCCCCCAGCAGATTCACC pnbA-I270-F GAAAACNNKTTCCAACTGTTCTTCCAGCCGGC pnbA-I270-R CAGTTGGAAMNNGTTTTCTTTTTCGGCGATACGCAG pnbA-F271-F GAAAACATTNNKCAACTGTTCTTCCAGCCGGC pnbA-F271-R GAACAGTTGMNNAATGTTTTCTTTTTCGGCGATACGC pnbA-L273-F TTTTCCAANNKTTCTTCCAGCCGGCACTAGAC pnbA-L273-R TGGAAGAAMNNTTGGAAAATGTTTTCTTTTTCGGCG pnbA-F275-F CAACTGTTCNNKCAGCCGGCACTAGACCC pnbA-F275-R GCCGGCTGMNNGAACAGTTGGAAAATGTTTTC pnbA-F314-F GGTATCTCNNKTTCACCCCCGATAGCGATGTG pnbA-F314-R GGGGTGAAMNNGAGATACCCTTCATCCCGT pnbA-M358-F CCAGATGNNKACCGATCTGCTGTTTTGGCG pnbA-M358-R AGATCGGTMNNCATCTGGATCTGTGATTCCAGGC pnbA-L362-F CCGATCTGNNKTTTTGGCGCCCAGCAGTG pnbA-L362-R CGCCAAAAMNNCAGATCGGTCATCATCTGG pnbA-F363-F CCGATCTGCTGNNKTGGCGCCCAGCAGTG pnbA-F363-R GGGCGCCAMNNCAGCAGATCGGTCATCATC
[0065] Using the primers shown in Table 2, with wild-type plasmid pET-28a(+)- Tb Using TA as a template, a full plasmid single-point mutation PCR was performed to construct a recombinant plasmid encoding the corresponding mutant gene. After successful sequencing, the plasmid was extracted and stored.
[0066] Table 2 Primers for constructing pnbA site-directed mutagenesis
[0067] Primer Name Sequence 5'-3' pnbA-G105L-F GGATTCATCTGGGCGCGTTTTATCTGGGTGC pnbA-G105L-R AACGCGCCCAGATGAATCCATACCATAACCGGCAG pnbA-A107T-F CATGGCGGCACCTTTTATCTGGGTGCAGGTTCCG pnbA-A107T-R CAGATAAAATGGGCCGCCATGAATCCATACC pnbA-A107D-F CATGGCGGCGACTTTTATCTGGGTGCAGGTTCCG pnbA-A107D-R CAGATAAAAGTCGCCGCCATGAATCCATACC pnbA-F271E-F GAAAACATTGAACAACTGTTCTTCCAGCCGGC pnbA-F271E-R GAACAGTTGTTCAATGTTTTCTTTTTCGGCGATACGC pnbA-F271S-F GAAAACATTTCCCAACTGTTCTTCCAGCCGGC pnbA-F271S-R GAACAGTTGGGAAATGTTTTCTTTTTCGGCGATACGC pnbA-F271V-F GAAAACATTGTGCAACTGTTCTTCCAGCCGGC pnbA-F271V-R GAACAGTTGCACAATGTTTTCTTTTTCGGCGATACGC pnbA-L273D-F TTTTCCAAGACTTCTTCCAGCCGGCACTAGAC pnbA-L273D-R TGGAAGAAGTCTTGGAAAATGTTTTCTTTTTCGGCG pnbA-L273V-F TTTTCCAAGTGTTCTTCCAGCCGGCACTAGAC pnbA-L273V-R TGGAAGAACACTTGGAAAATGTTTTCTTTTTCGGCG pnbA-F314N-F GGTATCTCAACTTCACCCCCGATAGCGATGTG pnbA-F314N-R GGGGTGAAGTTGAGATACCCTTCATCCCGT pnbA-F314H-F GGTATCTCCACTTCACCCCCGATAGCGATGTG pnbA-F314H-R GGGGTGAAGTGGAGATACCCTTCATCCCGT pnbA-M358K-F CCAGATGAAAACCGATCTGCTGTTTTGGCG pnbA-M358K-R AGATCGGTTTTCATCTGGATCTGTGATTCCAGGC pnbA-L362R-F CCGATCTGCGCTTTTGGCGCCCAGCAGTG pnbA-L362R-R CGCCAAAAGCGCAGATCGGTCATCATCTGG
[0068] The full plasmid single-point mutation PCR system is shown in Table 3:
[0069] Table 3 PCR reaction system
[0070]
[0071] The whole plasmid single-point mutation PCR program is set as follows:
[0072] (1) Denature at 98℃ for 10 seconds; (2) Anneal at 60℃ for 10 seconds; (3) Extend at 72℃ for 1 minute; (4) Repeat steps (1) to (3) for 35 cycles; (5) Extend at 72℃ for 5 minutes; (6) Store the amplified product at 4℃.
[0073] Example 2: Screening of wild-type p-nitrophenylacetase pnbA mutant library
[0074] The saturated mutant library of all sites of pnbA obtained in Example 1 was electroporated into competent E. coli BL21(DE3) cells, plated, and allowed to grow overnight; then single colonies were picked and placed in 500 μL of 0.1 mg / mL solution. Kan + Incubate overnight in LB liquid medium in deep-well plates; then transfer 500 μL of 0.1 mg / mL medium at a 1% ratio. Kan + In deep-well plates of LB liquid medium, cultured until OD 600 When the concentration was approximately 0.8, 0.5 mM IPTG was added, and the mixture was cultured at 16°C and 220 rpm for 16 hours to express the target protein.
[0075] The bacterial cells were collected by centrifugation at 4500 rpm for 15 min. The supernatant was discarded, and 100 μL of lysis buffer was added to extract the crude enzyme solution. A fluorescent enzyme activity assay system (100 μL) was prepared: 50 mM 1S, 5R-formic acid hydrate pinene ester, 10 μL crude enzyme solution, 0.05 mg / mL formate oxidase AoFOX, 0.9 U / mL horseradish peroxidase HRP, and 0.1 mM fluorescent substrate AR-2. The reaction was carried out at 37℃, and fluorescence was detected in real time. The excitation wavelength was 582 nm, the emission wavelength was 602 nm, the gain was 50, and the plate was continuously shaken for 5 s. Fluorescence was detected every 1 min for 30 minutes. The relative enzyme activity was calculated by calculating the rate of fluorescence growth, and the dominant mutant well sites were selected. The mutant sequence information was obtained by sequencing.
[0076] Example 3: Preparation of wild-type and mutant p-nitrophenylethyl esterase pnbA enzyme solutions
[0077] The mutant plasmids obtained in Example 1 were transformed into competent E. coli BL21(DE3) cells, plated, and allowed to grow overnight; then, single colonies were picked and placed in 15 mL of solution containing 0.1 mg / mL... Kan + In LB broth, incubate overnight; then transfer 1% to 1 L of medium containing 0.1 mg / mL... Kan + In LB liquid medium, cultured until OD 600 When the concentration was approximately 0.8, 0.5 mM IPTG was added, and the mixture was cultured at 16°C and 220 rpm for 16 hours to express the target protein.
[0078] The bacterial culture was centrifuged to collect bacterial sludge, resuspended in 40 mL of buffer (10 mM PBS, 150 mM NaCl), and then subjected to pressure disruption at 1100 Pa for 2 min. Following this, centrifugation was performed at 12000 rpm for 30 min, and the supernatant was filtered through a membrane and stored on ice. Before purification, the nickel column was washed with 10 column volumes of purified water, followed by 10 column volumes of buffer. The filtered supernatant was then slowly poured in and flowed out, and the nickel column was washed sequentially with 10 column volumes each of imidazole buffers (10 mM PBS, 150 mM NaCl) containing 20 mM, 40 mM, 160 mM, and 500 mM, and the flow-through was collected. The target protein was mainly found in the flow-through with imidazole concentrations of 40 mM and 160 mM. The flow-through containing high-purity target protein was then concentrated and desalted using a desalting gravity column, and then replaced with 10 mM buffer. In PBS buffer; finally, adjust the enzyme concentration to 5 mg / mL (containing 30% glycerol), and store at -20°C for later use. Electrophoresis results of pnbA wild-type process proteins are as follows: Figure 7 As shown.
[0079] Example 4: Screening for pnbA dominant mutants with high enantioselectivity using gas chromatography
[0080] The dominant mutant site prepared in Example 2 was selected, and iterative combined mutations were performed based on the pnbA-F314H mutant. The obtained combined mutant plasmids were transformed into competent E. coli L21(DE3) cells, plated, and grown overnight; then single colonies were picked and placed in 500 μL of 0.1 mg / mL... Kan + Incubate overnight in LB broth liquid medium in deep-well plates; then transfer 1 L of medium containing 500 μL of 0.1 mg / mL solution at a 1% ratio. Kan + In deep-well plates of LB liquid medium, cultured until OD 600 When the concentration was approximately 0.8, 0.5 mM IPTG was added, and the mixture was cultured at 16°C and 220 rpm for 16 hours to express the target protein.
[0081] The bacterial cells were collected by centrifugation at 4500 rpm for 15 min. The supernatant was discarded, and 100 μL of lysis buffer was added to extract the crude enzyme solution. A gas chromatography reaction system (1 mL) was prepared: 50 mM trans-pinene acetate hydrate, 10 μL of crude enzyme solution, and 50 mM phosphate buffer (pH=7.0). After reacting at 37℃ for 2 h, the reaction was terminated with ethyl acetate, and the chiral ester substrate and chiral alcohol product were extracted. The extracted compounds were then qualitatively and quantitatively analyzed by gas chromatography. The results are shown in Table 4. The wild-type p-nitrophenylethyl esterase pnbA mutants pnbA-F314H, pnbA-F314H / L362R, and pnbA-L273D / F314H / L362R... ee The values showed a significant increase compared to the wild type, especially in the pnbA-L273D / F314H / L362R mutant. ee The value can reach as high as 95.13%.
[0082] Table 4. Conversion rates of trans-acetic acid hydrate pinylesterase pnbA wild-type and mutant to 1S,5R-hydrate pinylol and 1S,5R-hydrate pinylol catalyzed by pnbA. ee value.
[0083]
[0084] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.
Claims
1. A highly enantioselective p-nitrophenylethyl esterase mutant, characterized in that, The p-nitrophenylethyl esterase mutant was obtained by mutating the amino acid sequence of the wild-type p-nitrophenylethyl esterase pnbA as shown in SEQ ID NO.1 in any of the following ways: The 314th phenylalanine is mutated to histidine, or the 314th phenylalanine is mutated to histidine and the 362nd leucine is mutated to arginine, or the 273rd leucine is mutated to aspartic acid, the 314th phenylalanine is mutated to histidine and the 362nd leucine is mutated to arginine.
2. The highly enantioselective p-nitrophenylethyl esterase mutant according to claim 1, characterized in that, The amino acid sequence of the single-point mutant obtained by mutating phenylalanine (F) at position 314 of the amino acid sequence of wild-type p-nitrophenylethyl esterase pnbA to histidine (H) is SEQ ID NO.2; The amino acid sequence of the combined mutant obtained by mutating phenylalanine (F) at position 314 (H) and leucine (L) at position 362 (R) of wild-type p-nitrophenylacetylesterase pnbA is SEQ ID NO.
3. The amino acid sequence of the combined mutant obtained by mutating leucine (L) at position 273 to aspartic acid (D), phenylalanine (F) at position 314 to histidine (H), and leucine (L) at position 362 to arginine (R) in the amino acid sequence of wild-type p-nitrophenylethyl esterase pnbA is SEQ ID NO.
4.
3. A gene encoding a para-nitrophenylethyl esterase mutant as described in any one of claims 1-2.
4. The gene according to claim 3, characterized in that, The nucleotide sequence encoding the wild-type p-nitrophenylethyl esterase pnbA as shown in SEQ ID NO.1 is SEQ ID NO.
5. The genes encoding the p-nitrophenylethyl esterase mutants are all obtained by site-directed mutagenesis based on the nucleotide sequence shown in SEQ ID NO.
5.
5. A recombinant plasmid comprising the gene as described in claim 3 or 4.
6. The recombinant plasmid according to claim 5, characterized in that, The plasmid vector for the recombinant plasmid is pET-28a(+).
7. A host cell comprising the gene as described in claim 3 or 4 or the recombinant plasmid as described in claim 5 or 6.
8. The host cell according to claim 7, characterized in that, The host cell is *Escherichia coli* containing the recombinant plasmid as described in claim 5 or 6. E. coli. BL21.
9. A method for constructing a highly enantioselective p-nitrophenylethyl esterase mutant as described in any one of claims 1-2, characterized in that, The method includes the following steps: culturing the host cells as described in claim 7 or 8, inducing the expression of the p-nitrophenylethyl esterase mutant; collecting the host cells for disruption and centrifugation, and separating and purifying the p-nitrophenylethyl esterase mutant from the supernatant.
10. A p-nitrophenylethyl esterase mutant as described in any one of claims 1-2, the gene as described in claim 3 or 4, the recombinant plasmid as described in claim 5 or 6, or the host cell precatalytic ester compound generation as described in claim 7 or 8. 1S , 5R Applications in hydrated pinol; The proester compound is racemic pinene-formate hydrate or racemic pinene-acetic acid hydrate.
Citation Information
Patent Citations
Method for preparing trans-(+)-hydrated pinanol
CN1435402A
Engineered biocatalysts useful for carbapenem synthesis
CN105051180A
Method for obtaining 1S, 5R-hydropinol through dynamic kinetic resolution
CN117947113A