Application of LMA1 gene in plant in regulation and control of plant leaf anthocyanin synthesis

Abstract

The invention discloses application of an LMA1 gene in a plant to regulation and control of plant leaf anthocyanin synthesis, and belongs to the technical field of plant anthocyanin synthesis regulation and control. The nucleotide sequence of the LMA1 gene is as shown in SEQ ID No.1. Experiments prove that the content of anthocyanin in plant leaves can be increased through LMA1 gene function deletion mutation in plants created through gene editing; the method is applied to a plant containing the LMA1 gene, such as a leguminous plant medicago truncatula, and a gene editing plant with high anthocyanin content can also be obtained through LMA1 gene function deletion mutation in a plant created through gene editing; accumulation of anthocyanin in plant leaves is changed through the LMA1 gene, the adaptive relation between plant growth and environmental pressure is improved, plants actively cope with the environmental pressure, and the nutritional function of the plants is enriched through increase of the anthocyanin content.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant anthocyanin synthesis regulation and control, and relates to a plant anthocyanin LMA1 Application of genes in regulating anthocyanin synthesis in plant leaves. Background Art

[0002] Anthocyanins are a class of water-soluble pigments widely found in plants. They belong to the class of flavonoid compounds. They not only give plant tissues rich colors (such as red, purple and blue), but also play an important role in improving plant growth and resisting biotic and abiotic stresses. For example, anthocyanins attract insects to become pollinators by reflecting light of specific wavelengths, and the color change of fruits attracts animals to feed on them, which leads to seed dispersal. Anthocyanins absorb ultraviolet rays and excess blue light, reducing the risk of chloroplast photoinhibition. As highly effective antioxidants, anthocyanins neutralize reactive oxygen species (ROS) by hydrogen donation or single electron transfer mechanisms. ROS ), protecting membrane lipids and DNA from oxidative damage; under drought, high temperature or salt stress, anthocyanin accumulation acts as a stress response signal, triggering the antioxidant enzyme system; as water-soluble glycosides, anthocyanins can regulate cell osmotic pressure, help plants maintain water balance in saline or drought environments, and improve plants' resistance to environmental stress.

[0003] According to existing studies, the biosynthesis of anthocyanins and proanthocyanidins is regulated by a series of transcription factors, such as MYB, bHLH, WDR, WRKY, NAC, bZIP, HD-ZIP and ERF family of transcription factors; DnaJ The protein is a heat shock protein with a molecular weight of 41 kD ( Heat shock protein, HSP ), also known as HSP40 ;plant DnaJ Proteins are involved in plant biological and abiotic stress responses and in the regulation of growth and development. DnaJ The protein plays a role in the gene network related to pigment biosynthesis, such as CbuDnaJ49 In Mai Yuan Jin Qiu ( Catalpa . bungei ' Maiyuanjinqiu ') The expression of the yellow part is significantly higher than that of the green part. Overexpression of this gene in tobacco results in albino leaves and calyx phenotypes, with significantly reduced chlorophyll and carotenoid contents. Ygm It is a natural mutant with yellow-green leaves in winter wheat. Transcriptome data showed that 4 DnaJ Genes in Ygm Low expression in the mutant may be related to the yellow-leaf wheat phenotype; ORANGE ( OR )and OR-Like Protein is DnaJ E1 members of the family, OR The protein binds to phytoene synthase (Phytoene Synthase), a key rate-limiting enzyme in the carotenoid biosynthesis pathway. PSY) interact and stabilize, becoming the main post-translational regulator of carotene production in plants; OR Also involved in magnesium chelatase ( MgCh ) enzyme, which catalyzes the first step in chlorophyll biosynthesis and coordinates the production of two major types of photosynthetic pigments in plants; it is not difficult to find that the prior art discloses DnaJ Protein is related to regulating chlorophyll and carotenoid content, however DnaJ Whether proteins can affect the synthesis of plant anthocyanins and the molecular basis of their influence on the synthesis of plant anthocyanins have not been addressed.

[0004] Some plants widely used in human life (such as alfalfa) have low anthocyanin content. If the anthocyanin content in these plants can be improved through genetic methods, it will not only improve their quality, but also improve plant growth and resistance to biotic and abiotic stresses, which has very high practical value. Summary of the Invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to provide a LMA1 The application of genes in regulating the synthesis of anthocyanins in plant leaves is used to increase the anthocyanin content in plants.

[0006] The object of the present invention is achieved in that LMA1 The nucleotide sequence of the gene is shown in SEQ ID No. 1. When it is used to regulate the synthesis of anthocyanins in plant leaves, gene editing is used to create LMA1 Loss-of-function mutations in genes can increase the anthocyanin content in plant leaves.

[0007] In addition, gene editing can be used to LMA1 Gene-edited plants with high anthocyanin content in leaves were obtained by loss of gene function.

[0008] LMA1 The gene is a gene that is widely expressed in tissues and organs and exists in many plants (such as the base plant of the legume family, Cercis Cercis canadensis , eudicot grapes Vitis vinifera Aristolochia, an early-diverging magnolia-like plant among angiosperms Aristolochia fimbriata , the most basal angiosperm Cinnamomum camphora Amborella trichopoda ), its encoding DnaJA Protein-like lma1-1 Mutant studies have identified the target gene that increases anthocyanin content in leaves as LMA1 Gene; further create plants through gene editing technology LMA1 Gene function loss mutation, and the mutant plants obtained were found CR-lma1-1 、 CR-lma1-2 、 CR-lma1-3 andlma1-1 The mutant can also significantly increase the anthocyanin content in plant leaves; after data query, the present invention cloned a mutant from Medicago truncatula LMA1 Gene is first time (gene ID: MtrunA17_Chr5g0426951 ), no previous related research reports have been found. LMA1 There are no reports of homologous genes in related leguminous species having the same or similar functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 For LMA1 The protein encoded by the gene is analyzed for the conserved domain structure of the protein, where: A is LMA1 Phylogenetic analysis of gene-encoded proteins; B is LMA1 The structure of the gene-encoded protein includes the DnaJ domain, Zinc finger domain, and C terminal domain; Figure 2 wild-type Medicago truncatula R108 and lma1-1 Phenotypic analysis of mutants, where A and B are wild-type Medicago truncatula R108 and lma1-1 Mutant leaf phenotype, scale bar = 2 cm; C is wild type Medicago truncatula R108 and lma1-1 The color difference of the methanol extract of the mutant leaf pigment reflects the different content of red pigments; D is the wild type Medicago truncatula R108 and lma1-1 Chromatogram of anthocyanin extracts of mutants; E is wild-type Medicago truncatula R108 and lma1-1 anthocyanin content of the mutants; Figure 3 for LAM1 Gene cloning research, where: A is lma1-1 Linkage analysis, BC2F2 represents a population that is backcrossed for two generations and then selfed for two generations, GT-F and GT-R are crosses. Tnt1 The primer combination of GT-R and Tnt-F2 is used to identify the insertion position on the gene. Tnt1 The primer combination inserted into the gene, Tnt1 The length is 5344 bp. If the template exists Tnt1 Insert, span Tnt1 The primer combination of B is unable to amplify the band; LMA1 Gene structure and Tnt1 Insertion position and direction, dark gray lines represent introns, dark gray rectangles represent exons, light gray rectangles represent untranslated regions, and black triangles represent Tnt1 Transposon, arrows indicate the insertion direction; C is LMA1 Semi-quantitative analysis of genes; D is LMA1 RT-qPCR quantitative analysis of genes; Figure 4 for LMA1 Genetic verification of function, where: A is LMA1 Schematic diagram of the target site for gene editing; B is LMA1 Genome editing status of three independent homozygous edited strains obtained by gene editing; C is LMA1 Three independent gene editing lines LMA1 Protein structure; D is LMA1 Phenotypes of three independent gene-edited strains, scale bar = 2 cm; E is LMA1 Anthocyanin content detection in three independent gene-edited lines; Figure 5 for LMA1 Expression pattern and protein subcellular localization, where A represents the root, hypocotyl, stem, leaf, petiole, rachis, flower, fruit pod and stem top of wild-type Medicago truncatula R108 LMA1 Gene expression analysis; One-way ANOVA test, p -value: p <0.05; B LMA1 Subcellular localization of proteins. Mitochondrial red fluorescent probe is used to indicate the location of mitochondria in protoplasts. Scale bar = 10 μm. Figure 6 for LMA1 Collinearity block analysis of genes and their orthologs. DETAILED DESCRIPTION

[0010] The present invention is further described below with reference to the accompanying drawings and test examples, but the present invention is not limited in any way. Any changes or substitutions made based on the teachings of the present invention fall within the scope of protection of the present invention.

[0011] The plant LMA1 Application of genes in regulating anthocyanin synthesis in plant leaves, the LMA1 The nucleotide sequence of the gene is shown in SEQ ID No. 1. LMA1 Loss-of-function mutations in genes can increase the anthocyanin content in plant leaves.

[0012] Furthermore, the plant is Medicago truncatula of the Leguminosae family.

[0013] Furthermore, gene editing involves delivering a DNA vector expressing Cas9 and sgRNA into plant cells.

[0014] Furthermore, gene editing can be used to LMA1 Gene-edited plants with high anthocyanin content in leaves were obtained by loss of gene function.

[0015] The present invention conducts relevant research around the wild type Medicago truncatula R108 ecotype of the legume model plant and finds LMA1 The relationship between genes and the regulation of anthocyanin synthesis in leaves is as follows: Test Example 1 Obtain lma1-1 mutant Noble Research Institute (Noble Research Institute) in the wild type Medicago truncatula R108 ecotype (ie Figure 2 WT, hereinafter referred to as WT) was inserted into tobacco retrotransposon Tnt1 A mutant library was constructed, and a mutant with red pigment attached to leaves (isolated from the NF6046 mutant line) was screened from the mutant library and named lma1-1 ( leaves with more anthocyanins1-1 ) mutants, lma1-1 The mutants have the following characteristics: (1) Relative to WT, lma1-1 The accumulation of red pigments on the abaxial surface of the mutant leaves is more obvious (see Figure 2 (A, B); (2) Yes lma1-1 The pigment in the mutant leaves was extracted with acidified methanol and found to be anthocyanin that was completely soluble in methanol and had a significantly darker color than the WT (see Figure 2 Middle C), it is speculated that the color difference may be caused by anthocyanins; (3) WT and lma1-1 The total anthocyanins of the mutant were extracted and analyzed by high performance liquid chromatography (HPLC). It was found that the peak shape and retention time at 530 nm of the two were consistent. However, lma1-1 The peak area of ​​the mutant was significantly larger than that of the WT (see Figure 2 E); the test found that lma1-1 The anthocyanin content in the mutant is more than 10 times that of the WT (see Figure 2 In D); So it seems that lma1-1 The anthocyanin content in the mutant was significantly increased.

[0016] Wild-type Medicago truncatula R108 ecotype (WT), NF6046 mutant strain, tobacco retrotransposon Tnt1 Purchased from Noble Research Institute in December 2017.

[0017] Experimental Example 2: Target gene identification, cloning, protein structure characterization and functional verification The study found that lma1-1 The anthocyanin accumulation phenotype in the mutant leaves can be stably inherited; lma1-1The mutant was backcrossed twice with the WT, and all F1 generation materials showed wild-type phenotypes. The segregation ratio of wild-type and mutant phenotypes in the F2 generation plants obtained by self-pollination of the F1 was 3:1 (43 wild-type plants and 13 mutant plants; χ² = 0.049 < χ² 0.05 =3.84); therefore, genetic evidence suggests that the gene controlling anthocyanin accumulation is a recessive single gene in the cell nucleus.

[0018] Backcrossing and sequencing of materials: using lma1-1 The mutant phenotype lines isolated from the mutant backcross population BC2F2 were mixed with equal amounts of young leaves for whole-genome 50× resequencing, totaling 63 Tnt1 insertion site, and there were 8 homozygous insertions.

[0019] Candidate gene identification: using primers on gDNA and Tnt1 The above primers were matched for PCR amplification and sequencing to determine the mutant BC2F2 backcross population (i.e. Figure 3 middle lma1-1 ) Tnt1 Insert in LMA1 The gene is located on exon 3 and is linked to the leaf anthocyanin accumulation phenotype in the backcross population (see A, B); GT-F and GT-R are cross LMA1 The primer combination of GT-R and Tnt-F2 is used to identify the insertion position on the gene. Figure 3 Primer combination inserted into the gene; GT-F is: CACACACACAAGTGGAGGTATCAG; GT-R is: GGTTGCAGTTTTCCTAGGGTTG; Tnt-F2 is: TCTTGTTAATTACCGTATCTCGGTGCTACA; RT-PCR technology was used to amplify Tnt1 Gene transcripts were found Tnt1 Loss of gene transcripts ( LMA1 The mutant was detected by RT-qPCR. LMA1 The transcription level of the gene was found Figure 3 The expression level of the gene was significantly lower than that of the wild type (see LMA1 D), indicating LMA1 The insertion makes Figure 3 The gene is hardly transcribed, resulting in Tnt1 Loss of gene function; therefore, it can be preliminarily determined LMA1 The gene is the target gene that controls anthocyanin synthesis in Medicago truncatula leaves. LMA1The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0020] Protein structural characteristics: LMA1 Phylogenetic analysis and amino acid sequence comparison of the protein encoded by the gene revealed LMA1 The protein encoded by this gene contains a DnaJ domain, a Zinc finger domain, and a C terminal domain, and is a typical DnaJA protein (see LMA1 (A, B in Chinese).

[0021] LMA1 Functional verification of genes: Figure 1 Gene editing to create loss-of-function mutations; LMA1 The gene has 22 exons, and two targets were selected, located at the 11th and 14th exon pairs. LMA1 Gene editing is the process of delivering a DNA vector expressing Cas9 and sgRNA into cells (operated according to known methods, see LMA1 A and B); after genetic transformation experiments, three independent T1 generation homozygous edited strains were isolated and named LMA1 1 、 Figure 4 and CR-lma1- (See CR-lma1-2 ), CR-lma1-3 Center C shows that gene editing caused Figure 4 The protein was truncated to varying degrees, and all three strains showed different degrees of leaf anthocyanin accumulation phenotype (see Figure 4 D); The anthocyanin content of leaves was detected, and the total anthocyanin content of the three mutant plant lines was significantly increased compared with the WT. LMA1 The anthocyanin levels in the mutants were close to those in the WT, about 10 times higher than that in the WT (see Figure 4 E); Through the above experiments, we can know that gene editing can create lma1-1 Loss-of-function mutations in genes Figure 4 The mutants have basically the same phenotype, which can be determined LMA1 The gene is a target gene that regulates anthocyanin synthesis in Medicago truncatula leaves.

[0022] Test Example 3 lma1-1 Gene expression patterns and protein subcellular localization By real-time quantitative PCR, LMA1 The gene is expressed in plant roots, hypocotyls, stems, leaves, stem apex, flowers and pods, with higher expression levels in flowers, leaves and stem apex (see LMA1 Based on this, protoplasts of tobacco were prepared and the PEG-mediated transformation method was used to transformLMA1 Plasmids were transiently expressed; laser confocal microscopy showed that in cells transiently expressing LMA1-GFP fusion protein, the green fluorescence signal of GFP and the red fluorescence signal of Mito-Tracker Red overlapped and co-localized, indicating that Figure 5 The protein is mainly located in mitochondria ( 35S::LMA1-GFP Middle B).

[0023] Test Example 4 LMA1 The principle of gene regulation of anthocyanin synthesis Observed by transmission electron microscopy Figure 5 The mutant's mitochondrial cristae are sparse and irregularly arranged, which directly leads to low enzyme activity of mitochondrial respiratory chain complex I, resulting in low electron transport chain efficiency and increased intracellular ROS levels. Further oxidative stress experiments proved that ROS is the main cause of leaf anthocyanin synthesis. The direct cause is the oxidative stress response in the cell activated by ROS, which acts as a signal molecule to regulate the transcriptional upregulation of anthocyanin synthesis pathway genes, resulting in the activation of leaf anthocyanin biosynthesis, indicating that LMA1 Genes involved in the cellular ROS signaling pathway regulate anthocyanin synthesis.

[0024] Test Example 5 [[ID=1 Orthologous genes The analysis of gene colinearity (microhomology) between genomes revealed ​ Located in a conserved syntenic block, its putative orthologs include genes from the basal Leguminosae group Cercis ( ​ ), the slowest evolving eudicot grape ( ​ ), Aristolochia, an early differentiated magnolia plant among angiosperms ( ​ ) and the most basal angiosperm Cinnamomum camphora ( ​ )of ​ (See ​ ); Given these data, it is believed that ​ and its putative orthologous genes represent a group of evolutionarily conserved ​ Gene.

[0025] The above studies show that plants ​ The gene is a negative regulator of anthocyanin synthesis in its leaves. ​ Genes can create ​ Loss-of-function mutations and tobacco retrotransposons ​ Insert into ​ Gene exons ​ The functions of gene loss mutations are basically the same, and they can significantly increase the accumulation of anthocyanins in the leaves of mutants; ​Genes affect the electron transfer efficiency of the respiratory chain by affecting the morphological integrity of mitochondria (the number and arrangement of internal cristae); ​ Loss of function leads to increased intracellular ROS levels, and ROS, as an oxidative stress signaling molecule, activates the accumulation of anthocyanins; therefore, ​ Genes can serve as integrators of environmental signals, growth and development signals, and intracellular signals, and are an important bridge connecting gene regulatory networks and anthocyanin biosynthesis. ​ The discovery of gene function has enriched the biosynthesis and regulatory mechanisms of plant anthocyanins, and has value in metabolic engineering and agricultural breeding.

Claims

1. In a plant LMA1 The application of genes in regulating anthocyanin synthesis in plant leaves is characterized in that: described LMA1 The nucleotide sequence of the gene is shown in SEQ ID No.

1. LMA1 Loss-of-function mutations in genes can increase the anthocyanin content in plant leaves.

2. The use according to claim 1, characterized in that The plant is Medicago truncatula of the legume family.

3. The use according to claim 1, characterized in that Gene editing involves delivering a DNA vector expressing Cas9 and sgRNA into plant cells.

4. The use according to claim 1, characterized in that Gene editing in plants LMA1 Gene-edited plants with high anthocyanin content in leaves were obtained by loss of gene function.

Images