Application of OsbZIP34 gene in regulation and control of rice disease resistance
By regulating rice disease resistance through the OsbZIP34 gene, preparing recombinant vectors and recombinant microorganisms, and overexpressing the OsbZIP34 gene, the problem of difficulty in preventing and controlling rice sheath blight was solved, and a significant improvement in rice disease resistance was achieved.
Patent Information
- Application Number
- CN202510792720.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-09-16
AI Technical Summary
The existing technology is difficult to prevent and control rice sheath blight, and the reliance on chemical agents leads to high economic costs and great risks of environmental pollution. The effect of resistance genes is not obvious, making it difficult to effectively improve rice disease resistance.
The OsbZIP34 gene is used to regulate rice disease resistance. By preparing recombinant vectors and recombinant microorganisms, the OsbZIP34 gene is overexpressed to improve rice resistance to sheath blight.
It significantly enhances rice resistance to sheath blight and reduces susceptibility, providing an efficient and environmentally friendly disease resistance breeding strategy.
Smart Images

Figure CN120648700A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to the application of the OsbZIP34 gene in regulating rice disease resistance. Background Art
[0002] Rice sheath blight, caused by Rhizoctonia solani, is one of the most destructive fungal diseases in rice production worldwide, posing a serious threat to rice yield and food security. With the continuous increase in nitrogen fertilizer input, the large-scale promotion of compact varieties, and the high-density planting pattern, the incidence and spread of the disease have shown a significant trend of increasing severity. Its affected area has ranked first among the three major rice diseases, posing a serious challenge to national food security. At present, the prevention and control of sheath blight is still highly dependent on chemical agents, which not only increases economic costs, but also exacerbates the threat to agricultural product safety and human health and the risk of environmental and ecological pollution. Therefore, the creation and promotion of rice varieties resistant to sheath blight is recognized as the most cost-effective and environmentally friendly fundamental prevention and control strategy.
[0003] Rice resistance to sheath blight is a quantitative trait controlled by quantitative trait loci (QTLs) or multiple genes. However, experiments constructing near-isogenic lines and characterizing phenotypic patterns across multiple environments have shown that most of these effects are subtle. To address this challenge, the integration of reverse genetics with omics technologies such as genomics and transcriptomics offers a new avenue for breakthroughs. By screening for differentially expressed genes or gene sets associated with disease resistance through omics techniques, coupled with systematic experimental validation, we can more comprehensively and efficiently identify key genes involved in sheath blight resistance. Summary of the Invention
[0004] The present invention aims to solve at least one of the technical problems existing in the prior art or related art.
[0005] To this end, the present invention provides an application of the OsbZIP34 gene in regulating rice disease resistance, which can effectively solve the problem of difficulty in preventing and controlling sheath blight in actual rice production.
[0006] The present invention provides an application of the OsbZIP34 gene in regulating rice disease resistance. The nucleotide sequence of the OsbZIP34 gene is shown in SEQ ID NO.1.
[0007] Furthermore, the amino acid sequence of the protein encoded by the OsbZIP34 gene is shown in SEQ ID NO.2.
[0008] Furthermore, the application includes preparing a recombinant vector comprising the OsbZIP34 gene and capable of regulating rice disease resistance.
[0009] Furthermore, the application includes preparing a recombinant microorganism comprising the OsbZIP34 gene or a recombinant vector comprising the OsbZIP34 gene that can regulate rice disease resistance.
[0010] Furthermore, the application includes a method for cultivating highly disease-resistant rice, which includes overexpressing the OsbZIP34 gene.
[0011] Furthermore, the method for overexpressing the OsbZIP34 gene includes: amplifying the OsbZIP34 gene using primers, enzymatically ligating the gene into a vector, transforming the gene into Escherichia coli and verifying the result by sequencing, extracting the plasmid, and transforming the gene into plant cells or tissues.
[0012] Furthermore, the primers are OsbZIP34-F with a nucleotide sequence as shown in SEQ ID NO.3 and OsbZIP34-R with a nucleotide sequence as shown in SEQ ID NO.4.
[0013] Furthermore, the vector is a pCAMBIA1390 vector; the transformation of plant cells or tissues includes Escherichia coli transformation, Agrobacterium transformation, Ti plasmid transformation, Ri plasmid transformation, plant virus vector transformation, direct DNA transformation or electroporation transformation of plant cells or tissues.
[0014] Furthermore, the application includes a method for cultivating highly disease-resistant rice, which comprises increasing the content of the protein encoded by the OsbZIP34 gene having an amino acid sequence as shown in SEQ ID NO.2.
[0015] Furthermore, the disease resistance is resistance to sheath blight.
[0016] Compared with the existing technology, the present invention has at least the following beneficial effects: the application of the OsbZIP34 gene provided by the present invention in regulating rice disease resistance can effectively solve the problem of difficulty in preventing and controlling sheath blight in actual rice production, and can increase the resistance of rice plants to sheath blight and reduce their susceptibility to the disease. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0018] Figure 1 The expression levels of OsbZIP34 gene in the wild type at different times after inoculation with Rhizoctonia solani.
[0019] Figure 2 A shows the knockout site mutation of the three knockout lines of the OsbZIP34 gene; B shows the lesion length results of the three knockout lines of the OsbZIP34 gene and the wild type in vitro sheath blight resistance identification; "*" indicates a significant difference at the 5% level, i.e., p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e., P≤0.01, scale bar = 5 cm.
[0020] Figure 3 A shows the protein expression level of the three overexpression lines of the OsbZIP34 gene; B shows the expression level detection of the three overexpression lines of the OsbZIP34 gene; C shows the lesion length results of the in vitro sheath blight resistance identification of the three overexpression lines of the OsbZIP34 gene and the wild type; "*" indicates a significant difference at the 5% level, i.e., p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e., P≤0.01, scale bar = 5 cm. DETAILED DESCRIPTION
[0021] In order to better understand the above technical solution, the technical solution of the embodiment of the present application is described in detail below through the accompanying drawings and specific embodiments. It should be understood that the embodiment of the present application and the specific features in the embodiment are detailed descriptions of the technical solution of the embodiment of the present application, rather than limitations on the technical solution of the present application. In the absence of conflict, the embodiment of the present application and the technical features in the embodiment can be combined with each other.
[0022] The present invention provides an application of the OsbZIP34 gene in regulating rice disease resistance. The nucleotide sequence of the OsbZIP34 gene is shown in SEQ ID NO. 1. The amino acid sequence of the protein encoded by the OsbZIP34 gene is shown in SEQ ID NO. 2.
[0023] Specifically, the present invention found that knocking out the OsbZIP34 gene weakened the resistance of rice to sheath blight, while overexpressing the OsbZIP34 gene significantly enhanced the resistance of rice to sheath blight. This indicates that the OsbZIP34 gene has potential application value in molecular breeding for sheath blight resistance and can provide an important genetic resource for breeding rice for sheath blight resistance.
[0024] In some feasible embodiments, the application includes preparing a recombinant vector comprising the OsbZIP34 gene and capable of regulating rice disease resistance.
[0025] Specifically, the present invention found that the recombinant vector can accurately participate in the regulation process of the OsbZIP34 gene, thereby significantly improving the resistance of rice to sheath blight.
[0026] In some feasible embodiments, the application includes preparing a recombinant microorganism comprising the OsbZIP34 gene and capable of regulating rice disease resistance.
[0027] In some feasible embodiments, the application includes preparing a recombinant microorganism capable of regulating rice disease resistance and comprising a recombinant vector containing the OsbZIP34 gene.
[0028] Specifically, the present invention discovered that recombinant microorganisms can accurately participate in and complete the regulation process of the OsbZIP34 gene, thereby significantly improving rice resistance to sheath blight.
[0029] In some feasible embodiments, the application includes a method for cultivating highly disease-resistant rice, comprising overexpressing the OsbZIP34 gene. By overexpressing the OsbZIP34 gene, the rice plant's resistance to sheath blight is increased and its susceptibility to the disease is reduced.
[0030] Specifically, the overexpression process includes: amplifying the OsbZIP34 gene, using the amplification primer pair as OsbZIP34-F with a nucleotide sequence as shown in SEQ ID NO.3 and OsbZIP34-R with a nucleotide sequence as shown in SEQ ID NO.4, enzymatically ligating the gene to a vector, transforming the gene into Escherichia coli and verifying the result through sequencing, extracting the plasmid, and transforming the gene into plant cells or tissues.
[0031] In some feasible embodiments, the enzyme is cleaved and linked to a vector. The vector can be any vector that can direct exogenous gene expression in plants, preferably the pCAMBIA1390 vector. After the enzyme is cleaved and linked to the vector, plant cells or tissues can be transformed by methods such as Escherichia coli transformation, Agrobacterium transformation, Ti plasmid transformation, Ri plasmid transformation, plant virus vector transformation, direct DNA transformation, or electroporation transformation. Preferably, the enzyme is cleaved and linked to the vector, followed by transformation into Agrobacterium, which is then introduced into rice.
[0032] In the above-mentioned methods, any enhanced promoter or constitutive promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter, can be added. To facilitate identification and screening of transgenic plant cells or plants, the plant expression vector used can be modified, such as by adding a gene encoding an enzyme or luminescent compound that can produce a color change (such as the GUS gene or luciferase gene) that can be expressed in plants, or an antibiotic resistance marker (such as a gentamicin marker or a kanamycin marker).
[0033] In some feasible embodiments, the application includes a method for breeding highly disease-resistant rice, the method comprising increasing the content of the protein encoded by the OsbZIP34 gene having an amino acid sequence as shown in SEQ ID NO. 2.
[0034] Specifically, the method of cultivating highly disease-resistant rice of the present invention uses genetic technology to overexpress the sheath blight-resistant gene OsbZIP34 to obtain transgenic cell lines and transgenic plants with enhanced sheath blight resistance.
[0035] In some possible embodiments, the disease resistance is sheath blight resistance.
[0036] Specifically, the application of the OsbZIP34 gene provided by the present invention in regulating rice disease resistance increases the plant's resistance to sheath blight and reduces its susceptibility to disease.
[0037] In the following specific examples, the gene sequence is from the sheath blight-resistant rice germplasm YSBR1. YSBR1, a rice germplasm resistant to sheath blight, is deposited at the Yangzhou University Rice Germplasm Bank. This rice germplasm is derived from a natural variant of a japonica-indica hybrid population. After multiple generations of self-pollination, the progeny gradually become homozygous. This variety has been shown to exhibit significantly higher resistance to sheath blight than other tested varieties.
[0038] In the following specific examples, the rice genetic transformation material is the sheath blight-susceptible variety NIP (Nipponbare): stored and provided by the Rice Germplasm Resource Bank of Yangzhou University.
[0039] Example 1 Identification and cloning of the OsbZIP34 gene
[0040] To identify genes that confer resistance to sheath blight, our laboratory identified the sheath blight-resistance gene, OsbZIP34, based on transcriptome data from rice varieties before and after sheath blight infection. OsbZIP34's expression was downregulated after sheath blight infection, leading to knockout and overexpression studies.
[0041] The cloning method of the OsbZIP34 gene comprises the following steps:
[0042] The PCR amplification primers OsbZIP34-F and OsbZIP34-R of the OsbZIP34 gene were designed based on the genome of the rice germplasm YSBR1, which is resistant to sheath blight.
[0043] OsbZIP34-F:5'-CGAACGATAGCCGGTACCATGGCATCCTCGGCCGCCT-3'(SEQ ID NO.3)
[0044] OsbZIP34-R:5'-ATTGTCAATATGCTCAGTCTACCCTTTGCTGTCATCAT-3'(SEQ ID NO.4)
[0045] Using cDNA from sheath blight-resistant rice germplasm YSBR1 as a template, PCR amplification was performed. The PCR amplification products were recovered and purified, and sequenced to screen out the OsbZIP34 gene.
[0046] PCR amplification reaction system:
[0047]
[0048] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 95°C for 15 s, extension at 72°C at 1 kb / min, and 30 cycles.
[0049] The nucleotide sequence encoded by the rice OsbZIP34 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0050] Example 2 Analysis of expression characteristics of OsbZIP34 gene
[0051] RNA samples were collected from different tissues (roots, stems, leaves, leaf sheaths, and panicles) of the rice sheath blight-susceptible rice variety NIP (Nipponbare) at the booting stage. Total RNA was extracted using Trizol (Invitrogen) according to the manufacturer's protocol (Invitrogen). Genomic DNA contamination was removed using DNaseI (RNase-free, Promega) (see the DNaseI manufacturer's instructions for the method), and the first-strand cDNA was synthesized using the PrimeScript RT reagent KitWith gDNAEraser Kit (TaKaRa) (see the manufacturer's instructions for the method). Real-time quantitative PCR was performed using cDNA from the aforementioned different tissues as templates and the rice Actin gene as an internal reference gene (the nucleotide sequence of Actin gene amplification primer F is shown in SEQ ID NO. 5, and the nucleotide sequence of Actin gene amplification primer R is shown in SEQ ID NO. 6). The OsbZIP34 gene-specific quantitative primers QOsbZIP34-F (SEQ ID NO. 7) and QOsbZIP34-R (SEQ ID NO. 8) were used to detect the specificity of the OsbZIP34 gene in different rice tissues. The reaction conditions were: pre-denaturation at 95°C for 2 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 10 seconds, and 72°C for 10 seconds.
[0052] Actin gene amplification primer F: 5'-CTAAGCCAAGAGGAGCTGTTAT-3' (SEQ ID NO. 5)
[0053] Actin gene amplification primer R: 5'-ATAACAGATAGGCCGGTTGAAA-3' (SEQ ID NO.6)
[0054] QOsbZIP34-F:5'-TGAAGTCACAACCACCTTACTTT-3'(SEQ ID NO.7)
[0055] QOsbZIP34-R:5'-CTACTAGGTAAAACCCCATGCA-3'(SEQ ID NO.8)
[0056] NIP was cultured under normal field conditions until the end of tillering, and inoculated with Rhizoctonia solani (the strain was a medium-strong pathogenic strain of Rhizoctonia solani YN-7 provided by the Plant Protection Department of Yangzhou University). The embedding method was used for inoculation (Pan Xuebiao, Journal of Jiangsu Agricultural College, 1997, (03): 28-33). A 1 cm long and 2 mm wide piece of wood bark (covered with hyphae) with Rhizoctonia solani hyphae was carefully embedded into the leaf sheath 1 cm to 2 cm below the second leaf of rice. The rice leaf sheath tissue of the 1 cm section above and below the inoculum was cut before inoculation (0 h) and 8 h, 15 h, 24 h and 32 h after inoculation, and stored in liquid nitrogen. The experimental process of RNA extraction, reverse transcription and qRT-PCR was the same as the above-mentioned steps for determining the expression level of rice tissue. The expression level of OsbZIP34 gene in rice tissue was determined. The results are as follows. Figure 1 .
[0057] like Figure 1 As shown in the figure, the OsbZIP34 gene was induced to down-regulate expression after being infected by Rhizoctonia solani, and the expression level was the lowest at 15 hours after inoculation.
[0058] Example 3 Creation of OsbZIP34 gene knockout materials and identification of sheath blight resistance
[0059] 1. Construction steps of CRISPR / Cas9 knockout vector using rice OsbZIP34 gene:
[0060] 1) Select a target site with high knockout efficiency; design and synthesize a sgRNA that recognizes the target site, the sgRNA nucleotide sequence is: 5'-ACGGGGACAGGGACACCC-3' (SEQ ID NO. 9).
[0061] 2) Use the restriction endonuclease Pst1 (Takara) on the pCXUN-Cas9 vector to cut the specific enzyme cutting site and combine it with the sgRNA.
[0062] The reaction system is:
[0063] Run the recombination program on a PCR instrument at 37°C for 30 min and store on ice.
[0064] 3) Transform DH5α. After the competent DH5α cell mass is dissolved, add the ligation product obtained in step 2, spread it on an LB plate containing kanamycin, and culture at 37°C for 1 day.
[0065] 4) Randomly select 12 single clones from the plate and place them into 2 mL sterile EP tubes. Add 500 μL of liquid LB containing kanamycin in advance and shake for 6 hours. Pipette 5 μL of the bacterial solution from each sample for PCR reaction. Select positive clones and verify by sequencing. The primer sequences for the PCR reaction are:
[0066] OsbZIP34-ko-F: 5'-ATGGCATCCTCGGCCG-3' (SEQ ID NO.10)
[0067] OsbZIP34-ko-R: 5'-CGTAGTACCGCCTGCATCGA-3' (SEQ ID NO.11)
[0068] Plasmids were extracted from the correct positive clones and recombinant plasmids were extracted using EZNATM Plasmid Midi Kit (OMEGA).
[0069] 5) Transform the recombinant positive plasmid into Agrobacterium tumefaciens EHA105 using a system consisting of 20 μL of Agrobacterium tumefaciens (EHA105) plus 1 μL of plasmid. Place the plasmid on ice for 5 minutes, quickly freeze in liquid nitrogen for 5 minutes, then place it in a 37°C water bath for 5 minutes, and finally place it on ice for 5 minutes. Add 100 μL of antibiotic-free LB medium, incubate at 28°C at 200 rpm for 2 hours, then directly plate the plate onto a kanamycin-rifampicin plate and incubate at 28°C for two days.
[0070] 6) Verification of positive Agrobacterium monoclones: After two days, a single clone was selected and placed in a 5 mL sterile EP tube. 2 mL of the corresponding bacterial antibiotic + rifampicin was added in advance, and the cells were shaken overnight. The next day, the bacterial solution was sent for sequencing. Once the sequencing feedback was correct, the prepared Agrobacterium pCXUN-Cas9-OsbZIP34 was ready for subsequent transformation experiments. The genetic transformation of the transgenic plants in the examples was performed by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments.
[0071] 2. The wild type (WT) and knockout lines (OsbZIP34-ko1, OsbZIP34-ko2 and OsbZIP34-ko3) of this gene were used to identify their resistance to sheath blight using the in vitro inoculation method.
[0072] The in vitro identification method for sheath blight resistance is as follows:
[0073] When the rice plants in the field grow to the early stage of heading, in vitro stem sampling is carried out. After cutting the rice stems, only the sword leaf and the second leaf are left. They are placed in water overnight to allow the rice to adapt to the climate chamber environment and prevent the rice from losing water. The next day, the same embedding method is used for inoculation. The cultured wood bark with a length of 1 cm and a width of 2 mm (as long as it is covered with hyphae) containing Rhizoctonia solani hyphae is carefully placed on the leaf sheath 1 cm below the second leaf. After the inoculation is completed, the stem is inserted into a test tube rack embedded with floral mud and then moved into the nutrient solution. It is then placed in an environment with a temperature and light setting of 14 hours of light (30°C), 10 hours of darkness (24°C), and a humidity setting of 90% for growth. The length of the lesions was investigated 7 days after inoculation. The results are as follows Figure 2 .
[0074] like Figure 2 As shown in Figure A, three transgenic knockout lines were obtained, named OsbZIP34-ko1, OsbZIP34-ko2, and OsbZIP34-ko3, respectively. OsbZIP34-ko1 lacked one base, OsbZIP34-ko2 lacked two bases, and OsbZIP34-ko3 lacked four bases. Figure 2 As shown in Figure B, the average lesion lengths of the three transgenic knockout lines, OsbZIP34-ko1, OsbZIP34-ko2, and OsbZIP34-ko3, were 13.1 cm, 13.4 cm, and 13.8 cm, respectively, significantly longer than those of the wild-type plants (9.3 cm). These results suggest that the OsbZIP34 gene positively regulates rice sheath blight resistance.
[0075] Example 4 Creation of OsbZIP34 Gene Overexpression Material and Identification of Sheath Blight Resistance
[0076] 1. The steps for constructing overexpression vectors and materials are as follows:
[0077] 1) Using the cDNA of the sheath blight-resistant rice germplasm YSBR1 as a template, primers OsbZIP34-F and OsbZIP34-R were designed to amplify the OsbZIP34 gene. The primer sequences are:
[0078] OsbZIP34-F:5'-CGAACGATAGCCGGTACCATGGCATCCTCGGCCGCCT-3'(SEQ ID NO.3)
[0079] OsbZIP34-R:5'-ATTGTCAATATGCTCAGTCTACCCTTTGCTGTCATCAT-3'(SEQ ID NO.4)
[0080] The OsbZIP34 gene sequence was amplified using a high-fidelity DNA polymerase. The PCR protocol was as follows: initial denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds; annealing at 60°C for 30 seconds; extension at 72°C for 5 minutes; 34 cycles; and a total extension of 5 minutes. The product was stored at 4°C.
[0081] 2) The overexpression vector pCAMBIA1390, which carries the strong promoter Ubi, was digested with the restriction endonuclease PstI (Takara) to linearize it.
[0082] 3) The target gene OsbZIP34 was ligated with the linearized vector pCAMBIA1390 using homologous recombination enzyme (ClonExpress II One Step Cloning Kit from Novozymes).
[0083] 4) Introduce the ligated product into competent DH5α medium, select positive single colonies on LB medium containing kanamycin, and sequence them. Once the alignment is correct, the OsbZIP34-OE vector is successfully constructed.
[0084] The constructed knockout vector plasmid and overexpression plasmid were sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice genetic transformation, and the recipient rice variety was NIP (Nipponbare).
[0085] After the rice genetic transformation is completed, the primer sequence for detecting the overexpression vector is:
[0086] OsbZIP34-OE-F:AGAGAGGACATCATTGCT(SEQ ID NO.12)
[0087] OsbZIP34-OE-R:CGCTCGTCGTCGGACTTG(SEQ ID NO.13)
[0088] 5) For overexpressing plants, first perform Western Blot analysis on all T0 plants using GFP antibodies; then further analyze the RNA levels of plants with higher protein expression. The primer sequences for qRT-PCR are:
[0089] QOsbZIP34-F:TGAAGTCACAACCACCTTACTTT(SEQ ID NO.7)
[0090] QOsbZIP34-R:CTACTAGGTAAAACCCCATGCA(SEQ ID NO.8)
[0091] 2. The resistance of the gene-overexpressing lines to sheath blight was identified using the in vitro inoculation method described in Example 3 above.
[0092] Three independent T0 generation transgenic overexpression lines with significantly increased OsbZIP34 gene and protein expression were obtained by Western Blot and qRT-PCR, and were named OsbZIP34-OE1, OsbZIP34-OE2, and OsbZIP34-OE3 ( Figure 3 AB in the figure). Figure 3 A shows that the expression levels of the three transgenic overexpression lines OsbZIP34-OE1, OsbZIP34-OE2 and OsbZIP34-OE3 were significantly higher than those of the wild type. Figure 3 As shown in Figures BC, the average lesion lengths of the three transgenic overexpression lines (OsbZIP34-OE1, OsbZIP34-OE2, and OsbZIP34-OE3) were 7.9 cm, 7.6 cm, and 7.2 cm, respectively, significantly shorter than those in the wild-type plants (9.6 cm). These results suggest that the OsbZIP34 gene positively regulates sheath blight resistance in rice and that overexpression of this gene can significantly enhance resistance to sheath blight in rice.
[0093] Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that are out of the scope disclosed in this application and are made using conventional techniques known in the art. It is easy for those skilled in the art to understand that, under the premise of no conflict, the above-mentioned advantageous methods can be freely combined and superimposed. The above is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the scope of protection of the present application. The above is only a preferred embodiment of the present application. It should be pointed out that for ordinary technicians in this technical field, without departing from the technical principles of the present application, several improvements and variations can be made, and these improvements and variations should also be regarded as the scope of protection of the present application.
Claims
1. Application of the OsbZIP34 gene in regulating disease resistance in rice, characterized in that: The nucleotide sequence of the OsbZIP34 gene is shown in SEQ ID NO.
1.
2. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the OsbZIP34 gene is shown in SEQ ID NO.
2.
3. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 1, characterized in that: The application includes preparing a recombinant vector comprising the OsbZIP34 gene and capable of regulating rice disease resistance.
4. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 1, characterized in that: The application includes preparing a recombinant microorganism comprising the OsbZIP34 gene or a recombinant vector comprising the OsbZIP34 gene and capable of regulating rice disease resistance.
5. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 1, characterized in that: The application includes a method for cultivating highly disease-resistant rice, which includes overexpressing the OsbZIP34 gene.
6. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 5, characterized in that: The method for overexpressing the OsbZIP34 gene comprises: amplifying the OsbZIP34 gene using primers, enzymatically ligating the gene to a vector, transforming the gene into Escherichia coli and verifying the gene by sequencing, extracting the plasmid, and transforming the gene into plant cells or tissues.
7. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 6, characterized in that: The primers are OsbZIP34-F with a nucleotide sequence as shown in SEQ ID NO.3 and OsbZIP34-R with a nucleotide sequence as shown in SEQ ID NO.
4.
8. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 6, characterized in that: The vector is pCAMBIA1390 vector; the transformation of plant cells or tissues includes Escherichia coli transformation, Agrobacterium transformation, Ti plasmid transformation, Ri plasmid transformation, plant virus vector transformation, direct DNA transformation or electroporation transformation of plant cells or tissues.
9. The use of the OsbZIP34 gene in regulating rice disease resistance according to claim 2, characterized in that: The application includes a method for cultivating highly disease-resistant rice, which comprises increasing the content of the protein encoded by the OsbZIP34 gene having an amino acid sequence as shown in SEQ ID NO.
2.
10. Use of the OsbZIP34 gene in regulating rice disease resistance according to any one of claims 1 to 9, characterized in that: The disease resistance is resistance to sheath blight.