Gene for regulating nitrogen absorption and root growth under salt stress and application thereof
By knocking out the rice OsGSK1 gene through the CRISPR/Cas9 system, a frameshift mutation was generated, which regulated nitrogen absorption and root growth under salt stress, solved the problems of nitrogen utilization and root growth of rice under salt stress, and improved the stress resistance and yield of rice.
Patent Information
- Application Number
- CN202510907203.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-02
- Publication Date
- 2025-09-16
AI Technical Summary
In the existing technology, the relationship between nitrogen absorption and root growth regulation of rice under salt stress is unclear, which affects the stress resistance and yield of rice.
The OsGSK1 gene in rice was knocked out using the CRISPR/Cas9 system, resulting in a frameshift mutation and obtaining OsGSK1 mutant rice, which regulates nitrogen absorption and root growth under salt stress.
It significantly improved the lateral root density and nitrogen absorption rate of rice in high-salt environment, and enhanced the stress resistance and yield of rice.
Smart Images

Figure CN120648709A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of rice breeding and biological genes, and particularly relates to a gene for regulating nitrogen absorption and root growth under salt stress and an application thereof. Background Art
[0002] Compared to traditional selection-followed hybrid breeding, gene editing technology has become a highly effective means of studying gene function, facilitating rapid improvements in rice quality and stress tolerance. For example, knocking out the rice RST1 gene resulted in salt tolerance and an increase in yield. Furthermore, studies have shown that judicious nitrogen fertilizer application during salt stress can alleviate growth inhibition caused by salt stress. However, in rice, the residual nitric oxide produced during nitrate assimilation, compared to ammonium ions, can activate antioxidant enzymes under salt stress, thereby enhancing salt tolerance. Furthermore, plant roots are not only nutrient transporters but also the first line of defense against salt stress, contributing to plant adaptation to salt and nitrogen uptake. Phosphokinase proteins are crucial hubs in plants, connecting signaling and environmental responses. OsGSK1, a rice GSK3-like phosphokinase, has been reported to negatively regulate salt tolerance in rice seedlings. However, the relationship between OsGSK1 and nitrogen uptake and utilization in rice under salt stress, as well as the specific salt tolerance manifestations in roots, remain unclear. Summary of the Invention
[0003] In view of the above problems, the present invention aims to provide a gene for regulating nitrogen absorption and root growth under salt stress and its application. To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0004] A gene that regulates nitrogen absorption and root growth under salt stress is disclosed. The OsGSK1 gene is knocked out in rice to obtain an OsGSK1 mutant rice. The nucleotide sequence of the OsGSK1 gene is shown in SEQ ID NO: 1.
[0005] Furthermore, the amino acid sequence of the protein encoded by the OsGSK1 gene is shown in SEQ ID NO: 2.
[0006] Furthermore, the OsGSK1 mutant rice is obtained by knocking out the OsGSK1 gene in rice using the CRISPR / Cas9 system, so that the amino acid sequence of the rice produces a frameshift mutation.
[0007] The invention relates to the application of genes for regulating nitrogen absorption and root growth under salt stress in rice breeding. The functions of the protein encoded by the OsGSK1 gene include: regulating the rice's absorption rate of nitrate nitrogen and regulating rice root growth under salt stress.
[0008] Furthermore, regulating the nitrate nitrogen absorption rate of rice includes increasing or decreasing the nitrogen absorption rate and total nitrogen content of the rice root system under normal environment and high-salt environment.
[0009] Furthermore, the rice variety is Taichung 65.
[0010] Furthermore, a method for constructing an OsGSK1 mutant rice with a gene that regulates nitrogen absorption and root growth under salt stress comprises:
[0011] Total RNA was extracted from rice seedlings;
[0012] Convert total DNA into cDNA;
[0013] Primers GSK1-cds-F and GSK1-cds-R were designed;
[0014] Using cDNA as template, PCR amplification was performed using GSK1-cds-F and GSK1-cds-R to obtain amplified products;
[0015] The OsGSK1 knockout vector was constructed based on the amplified product;
[0016] The OsGSK1 knockout vector was used to transform rice, and an OsGSK1 homozygous mutant was screened.
[0017] Furthermore, the primer sequences for PCR amplification are:
[0018] GSK1-cds-F: ATGGAGGCGCCGCCGGGGCCGG;
[0019] GSK1-cds-R:TTAGCTCCCAGCATGCGCAAAG.
[0020] Compared with existing technologies, the present invention exhibits the following beneficial effects: The present invention knocks out the OsGSK1 gene in rice, generating a frameshift mutation and producing an OsGSK1 mutant rice. Comparison of the mutant strain with the wild-type strain revealed significantly higher lateral root density in the mutant strain compared to Taichung 65 under high-salt conditions. Furthermore, the total nitrogen content and nitrogen utilization efficiency in the aboveground part of the mutant strain were also significantly higher than those of Taichung 65. These results demonstrate the potential application of the rice OsGSK1 gene in improving nitrogen utilization in rice under salt stress, and are of great significance for the efficient breeding of rice stress-resistant resources and for increasing rice yield. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.
[0022] Figure 1 Schematic diagram of knocking out the OsBZR3 gene target in Taichung 65 according to the present invention; Figure 1 A is a diagram of the OsGSK1 gene structure and a schematic diagram of target mutation types and amino acid changes. Figure 1 B is the result of sequencing the target mutation types of homozygous mutants osgsk1-1 and osgsk1-2 using Sanger sequencing and comparing them with the Taichung 65 sequence using snapgene software. Figure 1 A. Consistent.
[0023] Figure 2 The salt tolerance performance of the root system of the OsGSK1 knockout mutant seedlings after salt stress and the Na + External line chart; Figure 2 A is a representative image of the root performance of wild-type Taichung 65 and OsGSK1 mutant under normal conditions and after 4 days of 125 mM NaCl treatment, with the scale bar being 1 cm; Figure 2 B is a bar graph showing the lateral root density of Taichung 65 and OsGSK1 mutants under normal conditions and after 4 days of treatment with 125 mM NaCl. At least 12 biological replicates were included, and multiple comparisons were used for significance analysis.
[0024] Figure 3 The total nitrogen content and nitrate nitrogen absorption rate of Taichung 65 and OsGSK1 mutant under normal and salt stress conditions of the present invention are as follows: Figure 3 A is a statistical graph of the total nitrogen content in the aboveground parts of 14-day-old Taizhong 65 and two OsGSK1 mutants, osgsk1-1 and osgsk1-2, after being treated with 0 mM and 150 mM NaCl for 5 days. Figure 3 B is the 8-day-old Taichung 65, osgsk1-1 and osgsk1-2 seedlings grown in K-containing medium containing 0 mM and 150 mM NaCl, respectively. 15 Analysis chart of nitrate nitrogen absorption rate in NO3 solution; DETAILED DESCRIPTION
[0025] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the present invention. Any modifications or substitutions to the methods, steps, or conditions of the present invention, without departing from the spirit and substance of the present invention, fall within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, and instruments used in the examples herein are commercially available; unless otherwise specified, all technical means in the examples herein are conventional means well known to those skilled in the art.
[0026] Example 1 Construction of OsGSK1 knockout vector and overexpression vector
[0027] 1.1 Obtaining the OsGSK1 coding sequence
[0028] Total RNA was extracted from Taichung 65 rice seedlings and converted into cDNA. Primers GSK1-cds-F and GSK1-cds-R were designed based on the coding sequence predicted from the Ricedate website (https: / / www.ricedata.cn / gene / ). Primers are short, single-stranded DNA or RNA molecules that serve as templates for initiating DNA synthesis in PCR experiments. During PCR, after the double-stranded DNA is denatured into single strands at high temperatures, the primers bind to the complementary sequence of the target DNA sequence, providing a starting point for DNA polymerase to begin synthesizing a new strand. DNA polymerase can only add deoxynucleotides starting from the 3' end of the primer in the presence of a primer, thereby synthesizing a new DNA strand. Primers enable specific amplification of the target DNA fragment. Primer F typically binds to the 5' end of the target DNA sequence, meaning it binds to the single-stranded DNA near the starting point of the gene fragment to be amplified. Primer R binds to the 3' end of the target DNA sequence, and together, primers R and F define the range of the target DNA fragment to be amplified.
[0029] PCR amplification was performed using the cDNA as a template. The amplified product was sequenced by Sanger sequencing and then aligned and its amino acid sequence predicted using SnapGene software. The sequencing results showed that the coding sequence of the OsGSK1 gene in Taichung 65 rice is shown in SEQ ID NO. 1, and the amino acid sequence of the OsGSK1 gene is shown in SEQ ID NO. 2.
[0030] The primer sequences for PCR amplification are:
[0031] GSK1-cds-F: ATGGAGGCGCCGCCGGGGCCGG;
[0032] GSK1-cds-R:TTAGCTCCCAGCATGCGCAAAG;
[0033] The amplification program was as follows: 95°C, pre-denaturation for 5 minutes; 95°C, denaturation for 15 seconds; 47°C, annealing for 15 seconds; 72°C, extension for 1 minute 20 seconds, for 36 cycles.
[0034] 1.2 Construction of OsGSK1 knockout vector and homozygous identification
[0035] A target sequence was designed within the fourth exon of the OsGSK1 gene using the CRISPR / Cas9 / Cpf1 gene editing system. The U6a promoter and target sequence were linked by overlap extension PCR to construct a sgRNA expression cassette. The sgRNA expression cassette was then inserted into the Cas9 vector using T4 ligase. Positive recombinant plasmids were screened by bacterial culture PCR and Sanger sequencing. The resulting positive recombinant plasmids were then sent to Boyuan Biotechnology Company for transformation into the rice variety Taichung 65, resulting in T0-generation transformed seedlings. Hygromycin primers were used to screen for insertion-free lines in the T1 generation. Genotyping of the target sequence was performed, and homozygous mutant lines were identified using primers GSK1-T1-F and GSK1-T1-R. Individual plants without T-DNA insertions and sequence mutations were selected for T2-generation cultivation.
[0036] Identify homozygous mutant plants and select single plants without vector insertion and sequence mutation for T2 generation planting. Homozygous mutant plants refer to plants with the same mutant type for both alleles at a specific gene locus. For example, under normal circumstances, a gene locus may have a wild-type allele such as A, and a mutant may have a mutant allele such as a. The genotype of the homozygous mutant plant at this gene locus is aa. The results are as follows Figure 1 As shown, all OsGSK1 knockout mutants in Taichung 65 were homozygous mutants, and all resulted in amino acid frameshift mutations, indicating that the vector construction was successful and the obtained mutants can be used for subsequent detection of nitrate nitrogen response under salt stress. The present invention uses the CRISPR / Cas9 gene editing system to knock out the OsBZR3 gene target in Taichung 65. Compared with the sequence in Taichung 65, the target sequences in the osgsk1-1 and osgsk1-2 mutants are inserted with a T and A base, respectively, resulting in premature termination of the amino acid sequence.
[0037] Target sequence: CGTACTCCATAACAAGATTC
[0038] Primer sequences:
[0039] GSK1-T1-F:TGCATGCTTACCGTGTATTG;
[0040] GSK1-T1-R:GAGGATCAACCTGTATCAGC.
[0041] In this example, primers GSK1-cds-F and GSK1-cds-R were designed based on the predicted coding sequence. PCR amplification was performed using the cDNA as a template. The amplified products were sequenced by Sanger sequencing and then aligned and amino acid sequence predicted using SnapGene software. All OsGSK1 knockout mutants from Taichung 65 were homozygous, resulting in amino acid frameshift mutations.
[0042] Example 2 Experiment on identification of rice root growth phenotype under salt stress
[0043] 2.1 Statistics of lateral root density above the main root under salt
[0044] Seeds of plump OsGSK1 mutants and wild-type Taichung 65 were selected and soaked in water at 30°C ± 2°C for 2 days. They were then germinated and rooted in the dark at 30°C ± 2°C for 1-2 days. Seedlings were then sown in hydroponic boxes and cultured in water for another 2 days. After 2 days, if obvious taproot elongation was observed, seedlings with uniform growth were transferred to a modified Kimura medium containing 0 mM and 125 mM NaCl for 5 days. After 5 days, the taproots of rice seedlings were sampled and fixed in FAA solution. Lateral roots and root primordia on the taproots were observed using DAPI staining. The fixed roots were first rinsed several times with PBS and then immersed in a 5 μg / ml DAPI solution for 48 hours. They were then dehydrated using various concentrations of ethanol (0%, 10%, 30%, 50%, 70%, 90%, and 100%) for 15 minutes each, with two dehydration cycles using anhydrous ethanol. The sample was then transferred to a translucent solution (anhydrous ethanol: methyl salicylate = 1:1) for 1-2 hours. Finally, the sample was preserved in pure methyl salicylate and counted using a fluorescence microscope excited by ultraviolet light.
[0045] The results are as follows Figure 2 A and Figure 2 As shown in Figure B, under salt stress, the lateral root density of the seminal roots of the OsGSK1 mutant osgsk1-1 was 19.90 cells / cm, and that of the seminal roots of osgsk1-2 was 20.50 cells / cm, significantly higher than the 17.34 cells / cm of the wild-type Taichung 65. Under normal conditions, the average lateral root density of Taichung 65 is 24.38 cells / cm, while that of osgsk1-1 and osgsk1-2 is 24.75 and 24.94 cells / cm, respectively.
[0046] The formula of the improved Kimura culture medium is as follows:
[0047] Macroelements: 0.18mM KH2PO4, 0.09mM K2SO4, 0.36mM CaCl2, 0.54mM MgSO4.
[0048] Trace elements: 46.2μM H3BO3, 0.32μM CuSO4, 0.76μM ZnSO4, 9.14μM MnCl2, 0.08μM (NH4)6Mo7O 24 ,300mg / LNa2SiO3,1ml / LFe-EDTA,1mM KCl.
[0049] N source: 1 mM NH4Cl, 1 mM KNO3.
[0050] Example 3 Detection of total nitrogen content in rice seedlings under salt stress
[0051] Taichung 65 and the OsGSK1 knockout mutant in this background were selected and soaked in clean water at 30℃±2 for 2 days, then rooted in the dark for 1 day, and then sown in hydroponic boxes for 14 days. After 14 days, uniformly grown seedlings were selected and transferred to 0mM and 150mM NaCl solutions for 5 days of stress treatment. The aboveground leaves were sampled and dried at 80℃ after sampling. The samples were digested under H2SO4-H2O2, and the supernatant after digestion was diluted 10 times with water and added to a 50ml volumetric flask. EDTA-methyl red solution and sodium hydroxide solution were then added in sequence to pH=6, and the solution turned from red to yellow. Finally, phenol solution, sodium hypochlorite and water were added in sequence to make the volume 50ml. After reacting at room temperature for 1 hour, the absorbance at a wavelength of 625nm was detected, and the total nitrogen content was calculated according to the standard curve (completed by Huaxiang Geological Environment Testing Company).
[0052] The results of the total nitrogen content test of rice seedlings under salt stress in this example are as follows: Figure 3 As shown in Figure A, under normal conditions, there was no significant difference in total nitrogen content in the shoots of wild-type Taichung 65, the osgsk1-1, and the osgsk1-2 mutants. After five days of treatment in a high-salt environment (150 mM NaCl), the shoot total nitrogen content of wild-type Taichung 65 was 2.30%. Under salt stress, the total nitrogen contents of the osgsk1-1 and osgsk1-2 mutants were 2.68% and 2.51%, respectively, significantly higher than those of the wild-type strain.
[0053] Example 4 Detection of Nitrogen Absorption Rate of Rice Roots
[0054] Ten-day-old uniformly grown seedlings of Taichung 65 and OsGSK1 mutants were cultured in Kimura nutrient solution lacking nitrate nitrogen containing 0 mM and 150 mM NaCl for 2 days, and then transferred to a medium containing K 15 Kimura nutrient solution of NO3, and K 15 NO3 + After 30 minutes of treatment in a 150mM NaCl nutrient solution, samples were collected and tested for NUE. NUE, or nitrogen use efficiency, refers to the efficiency with which a crop absorbs and utilizes nitrogen to produce biomass or yield under specific nitrogen supply conditions. NUE can be measured using a variety of indicators, including nitrogen uptake efficiency, nitrogen use efficiency, and physiological nitrogen use efficiency.
[0055] The results of the rice root nitrogen absorption rate test in this example are as follows: Figure 3As shown in B, under normal circumstances, the average absorption rate of nitrate nitrogen by the aboveground part of Taichung 65 is 4.31 mmol h -1 g -1 DW, while the average nitrate nitrogen absorption rate of the aboveground part of osgsk1-1 was 4.24 mmol h -1 g -1 The average nitrate nitrogen absorption rate of the aboveground parts of DW and osgsk1-2 was 3.83 mmol h -1 g - 1 After treatment with 150 mM salt, the nitrate nitrogen absorption rate of the three plants decreased, and the average nitrate nitrogen absorption rate of the wild type was 0.35 mmol h -1 g -1 DW, osgsk1-1 is 0.48 mmol h -1 g -1 DW, osgsk1-2 is 0.52 mmol h -1 g -1 DW, demonstrated that knocking out the OsGSK1 gene in rice can significantly improve the rice's ability to absorb nitrate nitrogen under salt stress.
[0056] In summary, in modern stress-tolerant breeding, the OsGSK1 gene can be knocked out using the gene editing technology CRISPR / Cas9, resulting in salt-tolerant rice with high nitrogen uptake rates. This invention provides an effective technical means for rapidly creating rice varieties that efficiently absorb and utilize nitrogen under salt stress.
[0057] It is understandable that the above embodiments only express the preferred implementation modes of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the patent scope of the present invention. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present invention, the above technical features can be freely combined, and several deformations and improvements can be made, all of which fall within the scope of protection of the present invention. Therefore, all equivalent changes and modifications made to the scope of the claims of the present invention should fall within the scope of coverage of the claims of the present invention.
Claims
1. A gene that regulates nitrogen absorption and root growth under salt stress, characterized in that: The OsGSK1 gene is knocked out in rice to obtain an OsGSK1 mutant rice; the nucleotide sequence of the OsGSK1 gene is shown in SEQ ID NO:
1.
2. The gene for regulating nitrogen absorption and root growth under salt stress according to claim 1, characterized in that The amino acid sequence of the protein encoded by the OsGSK1 gene is shown in SEQ ID NO:
2.
3. The gene for regulating nitrogen absorption and root growth under salt stress according to claim 1, characterized in that The OsGSK1 mutant rice is obtained by knocking out the OsGSK1 gene in rice using the CRISPR / Cas9 system, so that the amino acid sequence of the rice produces a frameshift mutation.
4. Use of the gene for regulating nitrogen absorption and root growth under salt stress according to claim 1 in rice breeding, characterized in that: The functions of the protein encoded by the OsGSK1 gene include: regulating the rate of rice absorption of nitrate nitrogen, and regulating the growth of rice roots under salt stress.
5. The use according to claim 4, characterized in that The regulating the nitrate nitrogen absorption rate of rice includes increasing or decreasing the nitrogen absorption rate and total nitrogen content of the rice root system under normal environment and high-salt environment.
6. The use according to claim 4, characterized in that The rice variety is Taichung 65.
7. A method for constructing an OsGSK1 mutant rice having the gene for regulating nitrogen absorption and root growth under salt stress according to any one of claims 1 to 3, characterized in that: include: Total RNA was extracted from rice seedlings; Convert total DNA into cDNA; Primers GSK1-cds-F and GSK1-cds-R were designed; Using cDNA as template, PCR amplification was performed using GSK1-cds-F and GSK1-cds-R to obtain amplified products; The OsGSK1 knockout vector was constructed based on the amplified product; The OsGSK1 knockout vector was used to transform rice, and an OsGSK1 homozygous mutant was screened.
8. The method according to claim 7, characterized in that The primer sequences for PCR amplification are: GSK1-cds-F: ATGGAGGCGCCGCCGGGGCCGG; GSK1-cds-R:TTAGCTCCCAGCATGCGCAAAG.