Related gene LsGLK for regulating bolting time of leaf lettuce and application of related gene LsGLK

By regulating the lettuce bolting time-related gene LsGLK, gene knockout or overexpression, the problem of lettuce being prone to bolting under high temperatures was solved, and the nutritional growth and quality of lettuce were improved.

CN120648740APending Publication Date: 2025-09-16BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510948712.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-10
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Lettuce is prone to bolting under high temperature conditions, resulting in reduced nutritional growth and accumulation of bitter substances, affecting its commercial value. Existing technologies lack effective gene regulation methods.

Method used

By exploring and utilizing the gene LsGLK related to the bolting time of leaf lettuce (lettuce), gene knockout or overexpression is performed to regulate the bolting time of lettuce, including designing gene knockout targets, constructing gene knockout or overexpression vectors, and transferring them into lettuce plants.

Benefits of technology

It can effectively delay or advance the bolting time of lettuce, provide a theoretical basis for breeding bolting-resistant varieties, and improve the nutritional growth and commercial value of lettuce.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648740A_ABST
    Figure CN120648740A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant genetic engineering, and provides a protein amino acid sequence coded by a leaf lettuce bolting time related gene LsGLK, a CDS sequence / DNA full-length sequence of the leaf lettuce bolting time related gene LsGLK and application of the leaf lettuce bolting time related gene LsGLK. According to the invention, related genes for controlling bolting and flowering of leaf lettuce (lettuce) are excavated and studied, the internal mechanism and regulation and control network of bolting and flowering of leaf lettuce are explored, a theoretical basis is provided for cultivating bolting-resistant varieties, and the development of premature bolting-resistant lettuce varieties is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and in particular relates to a gene LsGLK for regulating the bolting time of leaf lettuce (romaine lettuce) and an application thereof. Background Art

[0002] Leaf lettuce (Lactuca sativa L.), commonly known as lettuce, is an annual or biennial herbaceous crop of the genus Lactuca in the Asteraceae family. It prefers cool climates and is called "romaine lettuce" because it is eaten raw in Western cuisine, often peeled from the leaves. It is currently one of the most consumed leafy vegetables worldwide. According to the "2024-2029 China Lettuce Industry Market In-depth Research and Investment Strategy Forecast Report" by the China Research Institute of Industry and Information Technology, the global lettuce market will continue to grow in 2024. In recent years, the Chinese lettuce market has also continued to expand, demonstrating strong growth momentum.

[0003] Lettuce prefers cool temperatures, with an optimum growing temperature of 15-20°C. It is prone to bolting under high temperatures. Bolting, the transition from vegetative to reproductive development, is a key step in flowering. The edible part of lettuce is its rosette leaves, and bolting marks the end of vegetative leaf production and the beginning of flowering. Premature bolting significantly reduces the vegetative biomass of lettuce. Furthermore, bolting and the initiation of flowering signals trigger a series of physiological and biochemical changes, leading to the accumulation of various secondary metabolites, such as latex, in the leaves. This creates an unpleasant bitter taste, impairs crop quality, and affects the commercial value of lettuce.

[0004] Therefore, it is of great theoretical and practical significance to explore and study the genes that regulate lettuce bolting and flowering. Summary of the Invention

[0005] In order to solve the above problems existing in the prior art, the present invention provides a gene LsGLK for regulating the bolting time of leaf lettuce (romaine lettuce) and its application.

[0006] The first aspect of the present invention provides an amino acid sequence of a protein encoded by a leaf lettuce bolting time-related gene LsGLK, the amino acid sequence composition of which is shown in Sequence 1 in the sequence listing;

[0007] Or: the amino acid sequence composition has greater than or equal to 95% homology with Sequence 1 in the sequence listing;

[0008] Or: An amino acid sequence having the same function as the protein encoded by the LsGLK gene obtained by replacing, and / or deleting, and / or adding one or more amino acid residues based on sequence 1 in the sequence table.

[0009] The second aspect of the present invention provides a CDS sequence of a leaf lettuce bolting time-related gene LsGLK, the nucleotide sequence of which is shown in Sequence 2 in the sequence listing;

[0010] Or: the nucleotide sequence composition of the CDS sequence has greater than or equal to 95% homology with Sequence 2 in the sequence listing;

[0011] Or: A nucleotide sequence encoding a protein having the same function as the protein encoded by the LsGLK gene, obtained by replacing, and / or deleting, and / or adding one or more nucleotides based on sequence 2 in the sequence table.

[0012] The third aspect of the present invention provides a full-length DNA sequence of the leaf lettuce bolting time-related gene LsGLK. The nucleotide sequence composition of the full-length DNA sequence of the gene is shown in Sequence 3 in the sequence listing;

[0013] Or: the nucleotide sequence composition of the gene has greater than or equal to 95% homology with Sequence 3 in the sequence listing;

[0014] Or: A nucleotide sequence encoding a protein having the same function as the protein encoded by the LsGLK gene, obtained by replacing, and / or deleting, and / or adding one or more nucleotides based on sequence 3 in the sequence table.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention explores and studies the genes related to controlling the bolting and flowering of leaf lettuce, which is helpful to explore the intrinsic mechanism and regulatory network of its bolting and flowering, and at the same time provides a theoretical basis for breeding bolting-resistant varieties, which is helpful to develop lettuce varieties that are resistant to premature bolting. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the locations of the two target sites of LsGLK gene knockout in Example 3 on the nucleotide sequence.

[0018] Figure 2 Schematic diagram of the structure of the gene knockout vector LsGLK-pZDK672 in Example 3.

[0019] Figure 3 These are photos showing the phenotypes of the gene knockout plants and overexpression plants in Example 4 during the vegetative growth period.

[0020] Figure 4 Part A is a photograph of the phenotype of the wild type and overexpression plants at the bolting stage in Example 4; Part B is a bar graph of the LsGLK gene expression levels of the wild type and overexpression plants; Part C is a bar graph of the bolting time of the wild type and overexpression plants.

[0021] Figure 5 Schematic diagram of the knockout target analysis of the LsGLK gene knockout plants in Example 4.

[0022] Figure 6 Part A is a photograph of the bolting phenotype of the wild-type and LsGLK gene knockout plants in Example 4; Part B is a bar graph of the bolting time of the wild-type and LsGLK gene knockout plants. DETAILED DESCRIPTION

[0023] To make the technical solutions, objectives and advantages of the present invention more clear, the present invention is further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0024] In a first aspect, the present invention provides an amino acid sequence of a protein encoded by a leaf lettuce (lettuce) bolting time-related gene LsGLK, the amino acid sequence of which is shown in Sequence 1 in the sequence listing;

[0025] Or: the amino acid sequence composition has greater than or equal to 95% homology with Sequence 1 in the sequence listing;

[0026] Or: An amino acid sequence having the same function as the protein encoded by the LsGLK gene obtained by replacing, and / or deleting, and / or adding one or more amino acid residues based on sequence 1 in the sequence table.

[0027] In a second aspect, the present invention provides a CDS sequence of a leaf lettuce (lettuce) bolting time-related gene LsGLK, the nucleotide sequence of which is shown in Sequence 2 in the sequence listing;

[0028] Or: the nucleotide sequence composition of the CDS sequence has greater than or equal to 95% homology with Sequence 2 in the sequence listing;

[0029] Or: A nucleotide sequence encoding a protein having the same function as the protein encoded by the LsGLK gene, obtained by replacing, and / or deleting, and / or adding one or more nucleotides based on sequence 2 in the sequence table.

[0030] In a third aspect, the present invention provides a full-length DNA sequence of the leaf lettuce (lettuce) bolting time-related gene LsGLK, the nucleotide sequence of the full-length DNA sequence of the gene is shown in Sequence 3 in the sequence listing;

[0031] Or: the nucleotide sequence composition of the gene has greater than or equal to 95% homology with Sequence 3 in the sequence listing;

[0032] Or: A nucleotide sequence encoding a protein having the same function as the protein encoded by the LsGLK gene, obtained by replacing, and / or deleting, and / or adding one or more nucleotides based on sequence 3 in the sequence table.

[0033] In a fourth aspect, the present invention provides PCR amplification primers for amplifying the full-length DNA sequence of the leaf lettuce (lettuce) bolting time-related gene LsGLK (sequence 3 in the sequence listing), comprising:

[0034] Forward primer: 5′-TATAATAAGAAAAAAAATCCAA-3′;

[0035] Reverse primer: 5′-ACTGCAAATCTAATTTGTTTGTTG-3′.

[0036] In a fifth aspect, the present invention provides PCR amplification primers for amplifying the CDS sequence (sequence 2 in the sequence listing) of the leaf lettuce (lettuce) bolting time-related gene LsGLK, comprising:

[0037] Forward primer: 5′-ATGTTAGCTGTTGTGTCACCACT-3′;

[0038] Reverse primer: 5′-TCAGACACATGTCGTAGGTGGTA-3′.

[0039] In a sixth aspect, the present invention provides an application of a leaf lettuce (romaine lettuce) bolting time-related gene LsGLK, comprising:

[0040] By knocking out the LsGLK gene, inhibiting the expression of the LsGLK gene, or silencing the LsGLK gene, the content and / or activity of the LsGLK protein in the plant is reduced, and the bolting time of leaf lettuce is postponed.

[0041] Or: by overexpressing the LsGLK gene, the bolting time of leaf lettuce (lettuce) is advanced;

[0042] The above-mentioned LsGLK gene knockout operation includes: designing the LsGLK gene knockout target, constructing the LsGLK gene knockout vector (the framework vector can be a pZDK672 vector or other gene knockout vectors), and then transferring the gene knockout vector into leaf lettuce to obtain transformed plants.

[0043] Among them, the above-mentioned LsGLK gene knockout targets include:

[0044] Target 1: 5′-ACGAATCTCCGGTGTAGCTC-3′;

[0045] Target 2: 5'-AGCCAGCGACGTCAAATGTA-3'.

[0046] The above-mentioned target 1 and target 2 can be constructed in two framework vectors respectively, or can be constructed in the same framework vector.

[0047] The above-mentioned LsGLK gene overexpression operation includes: constructing an overexpression vector of the LsGLK gene CDS sequence (the framework vector can be pRI101-AN vector or other plant expression vectors), and then transferring the overexpression vector into plants to obtain transgenic plants overexpressing the LsGLK gene.

[0048] Unless otherwise specified, the various reagents, materials, etc. used in the following examples are all products that can be obtained from commercial channels; unless otherwise specified, the various tests and detection methods used in the following examples are all conventional tests and detection methods in the field, which can be obtained from textbooks, reference books or academic journals.

[0049] Example 1

[0050] This example is used to illustrate the discovery of the LsGLK gene.

[0051] The inventors identified the gene LsGLK, which is associated with bolting time in leaf lettuce, through reverse genetics. To genetically engineer leaf color in lettuce, the inventors searched the lettuce genome for genes involved in leaf color regulation and created new CRISPR-generated lettuce germplasm. They discovered that homologs of the Arabidopsis GLK1 and GLK2 genes are associated with bolting time. BLAST analysis of the lettuce genome based on the amino acid sequence of the Arabidopsis GLK protein revealed a single GLK homolog, designated LsGLK, located on chromosome 4.

[0052] The amino acid sequence composition of the protein encoded by the above-mentioned gene LsGLK is shown in sequence 1 in the sequence listing; the nucleotide sequence composition of the CDS sequence of the above-mentioned gene LsGLK is shown in sequence 2 in the sequence listing; the nucleotide sequence composition of the full-length DNA sequence of the above-mentioned gene LsGLK is shown in sequence 3 in the sequence listing.

[0053] PCR primers for amplifying the CDS sequence of the gene LsGLK include:

[0054] Forward primer: 5′-ATGTTAGCTGTTGTGTCACCACT-3′;

[0055] Reverse primer: 5′-TCAGACACATGTCGTAGGTGGTA-3′.

[0056] PCR primers for amplifying the full-length DNA sequence of the gene LsGLK include:

[0057] Forward primer: 5′- TATAATAAGAAAAAAAATCCAA -3′;

[0058] Reverse primer: 5'-ACTGCAAATCTAATTTGTTTGTTG-3'.

[0059] The PCR amplification reaction for amplifying sequence 2 and sequence 3 can adopt a conventional reaction system and a conventional PCR reaction procedure.

[0060] For example: Use Novozymes 2×Phanta Flash Master Mix high-fidelity enzyme for PCR amplification reaction.

[0061] The PCR reaction system for amplifying sequence 2 or sequence 3 includes: 25 μL of 2×Phanta Flash Master Mix, 1 μL of forward primer, 1 μL of reverse primer, 100 ng of DNA, and ddH2O to 50 μL.

[0062] The PCR reaction program for amplifying sequence 2 includes:

[0063] 98℃ 30 s; 98℃ 10 s, 56℃ 10 s, 72℃ 15 s, 34 cycles in total; 72℃ 1 min.

[0064] The PCR reaction program for amplifying sequence 3 included:

[0065] 98℃ 30 s; 98℃ 10 s, 56℃ 10 s, 72℃ 40 s, 34 cycles in total; 72℃ 1 min.

[0066] Example 2

[0067] This example is used to describe the application of the LsGLK gene: overexpression of the LsGLK gene in lettuce.

[0068] 1. Construction of LsGLK overexpression vector

[0069] 1. Young leaves of the lettuce variety "Luya" were used as tissue material. They were quickly placed in liquid nitrogen and ground into powder. Total RNA was then extracted using the All-in-One Gold Plant Total RNA Extraction Kit. The obtained total RNA was used as a template and reverse transcribed using the Novozymes HiScript III All-in-one RT SuperMix Perfect for qPCR Reverse Transcription Kit to obtain cDNA.

[0070] The above-mentioned lettuce variety "Luya" was purchased from Jingyan Yinong (Beijing) Seed Technology Co., Ltd., telephone number 010-51502536. Anyone can freely obtain the above-mentioned variety for the purpose of achieving the purpose of the present invention.

[0071] 2. Using the above cDNA as a template, PCR amplification was performed using the following specific primers pRI101-GLK-KpnI_F and pRI101-GLK-EcoRI_R, which contain Kpn I and EcoR I restriction sites and pRI101-AN vector homology arm sequences, and using Novozymes 2×PhantaFlash Master Mix high-fidelity enzyme to obtain the LsGLK full-length cDNA fragment with the above restriction sites and vector homology arms.

[0072] pRI101-GLK-KpnI_F:

[0073] 5'- GTCGACCCCGGGGGTACC ATGTTAGCTG TTGTGTCACC-3′;

[0074] pRI101-GLK-EcoRI_R:

[0075] 5'- GTTGTTGATTCAGAATTC TCAGACACAT GTCGTAGGTG G-3'.

[0076] The homology arm sequences to the vector are underlined.

[0077] The PCR amplification reaction system (50 μL) includes:

[0078] cDNA 3 μL, 2× Phanta Flash Master Mix (Dye Plus) 25 μL, pRI101-GLK-KpnI_F 2 μL, pRI101-GLK-EcoRI_R 2 μL, and ddH2O to make up to 50 μL.

[0079] The procedure for the above PCR amplification reaction is:

[0080] 98℃ 30 s; 98℃ 10 s, 56℃ 5 s, 72℃ 10 s, a total of 34 cycles; 72℃ 1 min.

[0081] 3. The pRI101-AN plasmid vector (purchased from Beijing Huayueyang Biological VECT0420) was double-digested with KpnⅠ and EcoRⅠ. After digestion, agarose gel electrophoresis was performed to identify and recover the large fragment (about 10 kb, i.e., the linearized pRI101-AN plasmid vector).

[0082] The above enzyme digestion reaction system (30 μL) includes: KpnⅠ endonuclease (NEB) 1 μL, EcoRI endonuclease (NEB) 1 μL, 10× cutsmart buffer 3 μL, plasmid pRI101-AN 2 μg, and ddH2O to 30 μL.

[0083] The above enzyme digestion reaction procedure: digest at 37℃ for 1~2h.

[0084] 4. The sequence obtained in step 1 was ligated with the double-enzyme-digested plasmid obtained in step 2 (i.e., the large fragment, linearized pRI101-AN plasmid vector) by homologous recombination to obtain a circular plasmid, which is the LsGLK overexpression vector.

[0085] The above ligation reaction system: 5 μL of 2× Seamless Cloning mix (Beijing Biomed), a molar ratio of 3:1 between the CDS sequence and the enzyme-digested vector (i.e., the large fragment, linearized pRI101-AN plasmid vector) (total volume of 5 μL).

[0086] The above ligation reaction procedure: 50°C for 15 min.

[0087] 2. Obtaining genetically modified lettuce plants

[0088] 1. The LsGLK overexpression vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing Huayueyang Biotechnology) to obtain recombinant Agrobacterium. The recombinant Agrobacterium was then transformed into the lettuce variety Luya (purchased from Beijing Yanyinong).

[0089] The above transformation method refers to the following literature: Zhang, H., X. Si, X. Ji, R. Fan, J. Liu et al., 2018 Genome editing of upstream open reading frames enables translational control in plants. Nat Biotechnol 36: 894-898.

[0090] 2. Extract genomic DNA from the transformed T0 generation plants, perform PCR reaction, and identify positive plants.

[0091] The above PCR reaction used the following primers:

[0092] pRI101-GLK-KpnI_F:

[0093] 5'- GTCGACCCCGGGGGTACC ATGTTAGCTGTTGTGTCACC-3';

[0094] M13R:

[0095] 5′-CAGGAAACAGCTATGACC-3′.

[0096] The above-mentioned PCR reaction system includes:

[0097] 2× Taq PCR Star Mix (GenStar, Kangrun Biotechnology) 10 μL, F primer 1 μL, R primer 1 μL, DNA 100 ng, ddH2O to 20 μL.

[0098] The above PCR reaction procedure includes:

[0099] 95℃ for 5 min; 95℃ for 20 s, 56℃ for 20 s, 72℃ for 20 s, for a total of 34 cycles; 72℃ for 5 min.

[0100] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was the full-length cDNA sequence of the LsGLK gene, as shown in Sequence 2 in the sequence table.

[0101] 3. Total RNA was extracted from the leaves of the above-mentioned positive plants using the All-Gold Plant Total RNA Extraction Kit; the obtained total RNA was used as a template and reverse transcribed using the HiScript III All-in-one RT SuperMix Perfect for qPCR Reverse Transcription Kit from Novozymes to obtain cDNA.

[0102] 4. Use the Novozymes Taq Pro Universal SYBR qPCR Master Mix kit to perform qRT-PCR experiments, using the cDNA obtained in step 3 as the template, and calculate the relative expression level of LsGLK in transgenic lettuce.

[0103] The above qRT-PCR reaction uses lettuce Actin as the internal reference gene and the primers are saActin-F / R. The primers for the above qRT-PCR reaction are:

[0104] LsaActin-F: 5'-CTGGTGTGATGGTAGGTATGG-3';

[0105] LsaActin-R: 5'-CTCGTTGTAGAAAGTGTGATGC-3'.

[0106] GLK-qPCR-F: 5'-AGGAAAGAGGAAAGTGAAGGTTG-3';

[0107] GLK-qPCR-R: 5'-GTTATGACGAGTGAGACAGCC-3'.

[0108] The above qRT-PCR reaction system (20 μL) includes:

[0109] 2×PerfectStart Green qPCR Super Mix 10 μL, Primer-F 1 μL, Primer-R 1 μL, cDNA 200 ng, ddH2O to make up to 20 μL.

[0110] The qRT-PCR reaction procedure mentioned above includes:

[0111] 95℃ 3 min; 95℃ 10 s, 60℃ 30 s, 40 cycles; 95℃ 10 s, 60℃ 1min; 95℃ 15s.

[0112] 5. After the qRT-PCR reaction, use 2 -ΔΔCt The relative expression level of LsGLK in transgenic lettuce was calculated by the method described in Example 4.

[0113] 6. Harvest the seeds of the above-mentioned positive plants after planting them in a greenhouse for about 4 months; sow them to obtain T1 generation plants, and perform the above-mentioned PCR reaction test (genomic DNA) to obtain more than 3 T1 generation positive plants; then cultivate the T1 generation positive plants and harvest the seeds, sow them to obtain T2 generation plants, perform the above-mentioned PCR reaction test to obtain T2 generation positive plants.

[0114] Example 3

[0115] This example is used to describe the application of the LsGLK gene: knocking out the LsGLK gene in lettuce.

[0116] 1. Construction of gene knockout vector

[0117] 1. Design the target sequence of LsGLK gene:

[0118] Enter the genomic sequence of this gene (sequence 3) on the CRISPOR (ucsc.edu) website and design the following two sgRNA targets. The two targets are located on the genome as follows: Figure 1 shown.

[0119] Target 1: 5′-ACGAATCTCCGGTGTAGCTC-3′;

[0120] Target 2: 5'-AGCCAGCGACGTCAAATGTA-3'.

[0121] 2. Based on the nucleotide sequences of the above two targets, 4 sgRNA sequences containing their reverse complementary sequences and enzyme cleavage sites were designed; these 4 sgRNA sequences were synthesized separately.

[0122] sgRNA sequence for target 1:

[0123] sgRNA1-F: 5'-TGCA ACGAATCTCCGGTGTAGCTC-3';

[0124] sgRNA1-R: 5'-AAAC GAGCTACACCGGAGATTCGT-3'.

[0125] sgRNA sequence for target 2:

[0126] sgRNA2-F: 5'-TGCA AGCCAGCGACGTCAAATGTA-3';

[0127] sgRNA2-R: 5'-AAACTACATTTGACGTCGCTGGCT-3'.

[0128] 3. Anneal the above sgRNA1-F and sgRNA1-R, sgRNA2-F and sgRNA2-R to form double-stranded structures.

[0129] The annealing reaction includes: mixing 30 μL of the F sequence and R sequence of each sgRNA in equal proportions; annealing on a PCR instrument: 95°C for 5 minutes, 90°C for 1 minute, 80°C for 1 minute, 70°C for 1 minute, 60°C for 1 minute, 50°C for 1 minute, 40°C for 1 minute, 30°C for 1 minute, 20°C for 1 minute, and 10°C for 1 minute.

[0130] 4. The gene editing vector pZDK672 was digested with Bsa I endonuclease to obtain a linearized vector.

[0131] The gene editing vector pZDK672 is described in "Establishment of an Efficient GenomeEditing System in Lettuce Without Sacrificing Specificity," Wenbo Pan et al., Frontiers in Plant Science; the website is: https: / / doi.org / 10.3389 / fpls.2022.930592.

[0132] The above enzyme digestion reaction system (30 μL) includes: 1 μL of BsaI endonuclease (NEB), 3 μL of 10× cutsmart buffer, 2 μg of plasmid pRI101-AN, and ddH2O to make up to 30 μL.

[0133] The above enzyme digestion reaction procedure: digest at 37℃ for 1-2h.

[0134] 5. The linearized vector and the two double-stranded structures obtained in step 3 were ligated using T4 ligase (NEB T4 DNALigase (M0202)) to obtain two LsGLK gene knockout vectors LsGLK-pZDK672 targeting target 1 and target 2, respectively.

[0135] The ligation reaction (20 μL) includes: 2 μL of T4 DNA Ligase Buffer (10X), 5-12 μL of linearized vector and annealed double-stranded oligo at a molar ratio of 1:3, 1 μL of T4 DNA Ligase, and nuclease-free water to 20 μL.

[0136] The above ligation reaction procedure: 16 ℃ overnight ligation.

[0137] The structural diagrams of the two LsGLK gene knockout vectors LsGLK-pZDK672 are shown in the figure below: Figure 2 The vector LsGLK-pZDK672 includes, from upstream to downstream, 35S promoter, tRNA, sgRNA, tRNA, Cas9, and E9t.

[0138] 2. Obtaining genetically modified lettuce plants

[0139] 1. Referring to the method of Example 2, the two LsGLK gene knockout vectors LsGLK-pZDK672 were introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was then transformed into the lettuce variety Luya.

[0140] 2. Extract genomic DNA from the transformed T0 generation plants, perform PCR reaction, and identify mutant plants.

[0141] In the above PCR reaction, the primers for target 1 are:

[0142] GLK-seqF1: TATTAGTTTCACGGGTTGCCAAT,

[0143] GLK-seqR1:CGAGTAATGTTATATTGTTATAG.

[0144] The primers for target 2 are:

[0145] GLK-seqF2:ATTCGTAGAACATGAAGTTTCCT,

[0146] GLK-seqR2: CTGGTGATGATGATGCCAAGATG.

[0147] The PCR reaction system (50 μL) includes:

[0148] 2×Taq PCR StarMix (GenStar Kangrun Biotechnology) 25μL, F primer 1μL, R primer 1μL, DNA 100ng, ddH2O to 50μL.

[0149] The above PCR reaction procedure includes:

[0150] 95℃ for 5 min; 95℃ for 20 s, 56℃ for 20 s, 72℃ for 15 s, for a total of 34 cycles; 72℃ for 5 min.

[0151] The PCR reaction products were then sequenced using the F-terminal primers, and the results were as described in Example 4.

[0152] 3. Plant the identified mutant plants (T0 generation) for about 4 months and harvest the seeds; continue planting to obtain T1 generation plants, perform the above PCR reaction to identify the mutant plants and harvest the seeds; continue planting to obtain T2 generation plants, perform the above PCR reaction to identify the mutant plants among them.

[0153] Example 4

[0154] This example is the observation and detection results of the transgenic lettuce plants in Example 2 and Example 3; the wild type (WT) of Luya lettuce was used as a control.

[0155] 1. Phenotypic analysis of LsGLK knockout and overexpression plants (T2 generation) during the vegetative growth period (approximately 40 days from seed sowing)

[0156] like Figure 3 As shown in the left half, the rosette leaves of the LsGLK overexpressing plant LsGLK-OX are significantly more luxuriant than those of the wild type WT, while the rosette leaves of the wild type WT are significantly more luxuriant than those of the knockout plant LsGLK-KO. Figure 3 As shown in the right half, the height of the LsGLK overexpressing plant LsGLK-OX is significantly greater than that of the wild type WT, and the height of the wild type WT is also significantly greater than that of the knockout plant LsGLK-KO.

[0157] 2. Analysis of the bolting period of LsGLK knockout plants and overexpression plants.

[0158] like Figure 4 As shown in A (105 days after sowing), the LsGLK-OX overexpressing plants showed obvious bolting, while the WT plants did not show bolting.

[0159] like Figure 4 As shown in Figure B (105 days after sowing), LsGLK expression levels were detected using the qRT-PCR methods described in Examples 2-4 and 2-5. LsGLK expression levels in the three overexpressing plants were significantly higher than in the wild-type plants. The figure shows average expression levels of 2.156921, 1.000151, and 0.892836 for the wild-type plants WT-1, WT-2, and WT-3, respectively. Average expression levels for the overexpressing plants 35S-GLK-1, 35S-GLK-2, and 35S-GLK-3 were 39.11785, 17.26695, and 22.23848, respectively.

[0160] like Figure 4 As shown in C, the bolting time of LsGLK overexpressing plant 35SGLK (average 98 days) was significantly earlier than that of wild type WT (average 112 days).

[0161] 3. Knockout target analysis of LsGLK knockout plants

[0162] According to the PCR and analysis of Example 3, Figure 5 As shown, the TAGCTC of target 1 mutated to TACTC, lacking G; the ACGTCAAATGTA of target 2 mutated to ACGTTGTA, lacking CAAA.

[0163] 4. Phenotypic Analysis of LsGLK Knockout Plants

[0164] like Figure 6 As shown in A, 125 days after sowing, the plant height of the wild type WT was significantly greater than that of the knockout plant LsGLK-KO, indicating that the bolting of the WT plant was very obvious, while the bolting of the LsGLK-KO plant was not obvious.

[0165] 5. Comparison of bolting time between LsGLK knockout plants and wild-type plants

[0166] like Figure 6 As shown in B, the bolting time of wild-type plants (average 112 days) was significantly earlier than that of LsGLK-KO knockout plants (average 117 days).

[0167] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. Genes related to leaf lettuce bolting time LqCy The amino acid sequence of the encoded protein, the amino acid sequence composition of which is shown in Sequence 1 in the sequence listing; Or: the amino acid sequence composition has greater than or equal to 95% homology with Sequence 1 in the sequence listing; Or: Based on the sequence 1 in the sequence table, one or more amino acid residues are substituted, and / or deleted, and / or added, and having LqCy An amino acid sequence with the same function as the protein encoded by a gene.

2. Genes related to bolting time in leaf lettuce LqCy The CDS sequence of the CDS sequence has a nucleotide sequence as shown in Sequence 2 in the sequence table; Or: the nucleotide sequence composition of the CDS sequence has greater than or equal to 95% homology with Sequence 2 in the sequence listing; Or: Based on the sequence 2 in the sequence table, one or more nucleotides are substituted, and / or deleted, and / or added to encode a sequence having LqCy The nucleotide sequence of a protein with the same function as the protein encoded by a gene.

3. Genes related to bolting time in leaf lettuce LqCy The full-length DNA sequence of the gene has a nucleotide sequence as shown in Sequence 3 in the sequence listing; Or: the nucleotide sequence composition of the gene has greater than or equal to 95% homology with Sequence 3 in the sequence listing; Or: Based on sequence 3 in the sequence table, one or more nucleotides are substituted, and / or deleted, and / or added to encode a sequence having LqCy The nucleotide sequence of a protein with the same function as the protein encoded by a gene.

4. The leaf lettuce bolting time-related gene according to claim 2 LqCy Primers for PCR amplification of CDS sequences include: Forward primer: 5′- ATGTTAGCTGTTGTGTCACCACT -3′; Reverse primer: 5′-TCAGACACATGTCGTAGGTGGTA-3′.

5. The leaf lettuce bolting time-related gene according to claim 3 LqCy Primers for PCR amplification of the full-length DNA sequence include: Forward primer: 5′- TATAATAAGAAAAAAAATCCAA -3′; Reverse primer: 5'-ACTGCAAATCTAATTTGTTTGTTG-3'.

6. Genes related to bolting time in leaf lettuce LqCy Applications include: pass LqCy Gene knockout, or inhibition LqCy Gene expression, or LqCy Gene silencing reduces the LqCy The protein content and / or activity can delay the bolting time of leaf lettuce; Or: by LqCy Overexpression of the gene advances the bolting time of leaf lettuce.

7. The leaf lettuce bolting time-related gene according to claim 6 LqCy The application is characterized by: described LqCy Gene knockout operations, including: LqCy Gene knockout target, construction LqCy A gene knockout vector is prepared for the gene, and the gene knockout vector is then transferred into leaf lettuce to obtain a transformed plant.

8. The use of the leaf lettuce bolting time-related gene LsGLK according to claim 7, characterized in that: described LqCy Gene knockout targets include: Target 1: 5′-ACGAATCTCCGGTGTAGCTC-3′; Target 2: 5'-AGCCAGCGACGTCAAATGTA-3'.

9. The leaf lettuce bolting time-related gene according to claim 8 LqCy The application is characterized by: The target 1 and target 2 are constructed in two framework vectors respectively.

10. Use of the leaf lettuce bolting time-related gene LsGLK according to any one of claims 6 to 9, characterized in that: described LqCy Gene overexpression operations, including: LqCy An overexpression vector of the gene CDS sequence is prepared, and the overexpression vector is then transformed into leaf lettuce to obtain a transformed plant.