Method for detecting abnormal RNA (Ribonucleic Acid) removal mechanism of termination codon deletion in mammal oocytes
By constructing a GFP sequence plasmid without a stop codon and injecting it into oocytes, combined with actinomycin treatment, the problem of detecting the RNA clearance mechanism in mammalian oocytes was solved, and the evaluation of egg quality and early embryonic development potential was achieved.
Patent Information
- Application Number
- CN202510751100.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies have not yet provided an accurate method to detect the abnormal RNA clearance mechanism of stop codon deletion in mammalian oocytes, which affects the assessment of egg quality and the judgment of early embryonic developmental potential.
By constructing a GFP sequence plasmid without a stop codon, polyadenylated mRNA was transcribed in vitro and injected into oocytes. Combined with actinomycin treatment, the activation of the NSD pathway was detected, and the activation pattern of the NSD pathway was evaluated using GFP fluorescence intensity and qPCR methods.
The detection of NSD pathway levels in eggs and screening of activation patterns have been achieved, which can determine the impact of abnormal maternal mRNA degradation on embryonic development and provide an assessment of the early embryonic developmental potential.
Smart Images

Figure GXBRLNWTJGJUG6XPJTDQL3W5NLAKYCD12P4WYCDN 
Figure TD1UO0G8L5MF97IHBNK4XIJAQH70GMPWF7KW8TPE 
Figure U3U75WC59BRI39NPGR5VPCVZQVXA2OAJN6PFVLLF
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene detection technology, and more particularly to a method for detecting an abnormal RNA clearance mechanism of a stop codon-deficient mammalian oocyte. Background Art
[0002] Normal fertilization and reproduction in mammals are crucial for maintaining and continuing the species, and egg quality is crucial to this process.
[0003] Numerous factors affect egg quality in female mammals, primarily characterized by egg immaturity or, after fertilization, poor egg quality that further impairs embryonic development and can lead to premature birth. Accurately assessing egg quality is crucial for understanding the mechanisms of oogenesis and early embryonic development. The transition of gene expression from the oocyte to the early embryo, known as the maternal-to-zygotic transition (MZT), is the first critical event in early embryonic development. Timely degradation of maternal mRNA is a crucial prerequisite for transcriptional activation of the embryo's own genome. Translation-coupled mRNA quality control mechanisms ensure the timely degradation of abnormal mRNAs, playing a crucial role in maintaining RNA homeostasis in the oocyte.
[0004] The non-stop mRNA decay pathway (NSD) is a key mRNA quality control mechanism in eukaryotes. The NSD pathway is responsible for eliminating aberrant mRNA molecules lacking stop codons. When stop codons are missing, ribosomes continue to read through to the 3' poly(A) tail and stall, causing ribosome collisions. Subsequently, the NSD pathway is activated, degrading the aberrant RNA. The NSD pathway is crucial for RNA homeostasis, but methods for measuring NSD pathway levels in oocytes and early embryos are currently lacking. Summary of the Invention
[0005] In view of the shortcomings of the existing technology, the purpose of the present invention is to provide a detection method for detecting the clearance level of abnormal mRNA in eggs that is easy to operate and has clear effects.
[0006] The above technical objectives of the present invention are achieved through the following technical solutions: A method for detecting the abnormal RNA clearance mechanism of stop codon-deficient mammalian oocytes, comprising the following steps: S1, amplify the complete GFP sequence and the GFP sequence without the stop codon (TAA), and then ligate them into the plasmid backbone with a FLAG-tag; S2, polyadenylated mRNA was obtained by in vitro transcription and injected into GV-stage oocytes and zygotes, and the level of RNA clearance in oocytes was shown by the brightness of GFP; S3, oocytes were injected with in vitro transcribed reporter plasmids and treated with cycloheximide (CHX). Fluorescence intensity quantification and qPCR levels were used to detect whether the NSD pathway in oocytes is coupled to translation. S4, 30 A bases and 60 A bases were inserted upstream of the stop codon encoding GFP, respectively, to encode 10 or 20 lysines. After in vitro transcription and adding a Poly A tail, it was injected into GV stage oocytes, and the degree of activation of the NSD pathway was detected by measuring the fluorescence intensity.
[0007] Furthermore, it includes the following features in step S1: a GFP sequence without a stop codon is amplified by designing specific primers, and is connected to a plasmid backbone containing a FLAG-tag to construct a reporter plasmid without a stop codon.
[0008] Furthermore, the reporter plasmid contains GFP protein, and the activation of the NSD pathway can be determined by the fluorescence level of GFP.
[0009] Furthermore, in step S2, in addition to injecting the plasmid constructed in step S1, a plasmid expressing mCherry is also injected.
[0010] Furthermore, in step S3, cycloheximide (CHX) is added to the oocyte culture medium to inhibit ribosome sliding and thus inhibit translation. After the reporter plasmid is injected, the expression changes of GFP mRNA are detected to verify whether the NSD pathway can be activated under the condition of translation inhibition.
[0011] In summary, the present invention has the following beneficial effects: The present invention is used to detect the level of the NSD pathway in the egg and the activation pattern of the NSD pathway in the egg.
[0012] The present invention relates to a method for screening for post-fertilization embryonic arrest caused by incomplete degradation of abnormal maternal mRNA. Later, the developmental potential of early embryos can be determined by detecting whether target genes of the NSD pathway are degraded normally. Abnormal expression of these genes in embryos may lead to embryonic developmental arrest.
[0013] The present invention relates to the construction of a plasmid for detecting the level of NSD pathway in oogenesis and exploring the activation rules of the NSD pathway in eggs.
[0014] The present invention relates to detecting the coupling of NSD pathway activation and translation in eggs by CHX treatment.
[0015] The present invention relates to in vitro transcription of plasmids and microinjection of oocytes. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 Schematic diagram for the construction of NSD pathway reporter plasmid and microinjection; Figure 2 The fluorescence intensity and expression analysis diagram of the NSD pathway reporter plasmid after in vitro transcription and injection into mouse oocytes; Figure 3 The fluorescence intensity and mRNA quantitative analysis of NSD pathway reporter plasmids after in vitro transcription and injection into mouse oocytes and simultaneous treatment with CHX; Figure 4 The fluorescence intensity analysis of the NSD pathway reporter plasmid with different numbers of A bases is shown. DETAILED DESCRIPTION
[0017] The present invention is described in detail below with reference to the accompanying drawings and examples. In the examples, if specific conditions are not specified, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.
[0018] In addition, the technical solutions of the various embodiments may be combined with each other, but this must be based on the fact that a person of ordinary skill in the art can implement the solution. If the combination of technical solutions is mutually inconsistent or cannot be implemented, it shall be deemed that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by a person of ordinary skill in the art without making any creative effort shall fall within the scope of protection of the present invention.
[0019] Example: A method for detecting the clearance mechanism of abnormal RNA with missing stop codons in mammalian oocytes, such as Figure 1 As shown, the present invention proposes a method for detecting the clearance mechanism of abnormal mRNA in oocytes, aiming to solve the problem that there is currently no kit on the market that can accurately detect the degree of clearance of maternal mRNA in oocytes. In one embodiment, the method for detecting the degree of clearance of abnormal mRNA in oocytes includes the following steps: The stop codon of a pRK5-Flag-Gfp vector containing an SP6 transcription initiation sequence was deleted, and polyadenylated mRNA was generated by in vitro transcription, resulting in a translational readthrough effect. Simultaneously, plasmids containing 30 and 60 A bases were constructed before the stop codon of the normal pRK5-Flag-Gfp vector to simulate the effect of different A base lengths on ribosome blockade. Successful plasmid construction was confirmed by sequencing.
[0020] See also Figure 1 , Figure 1Schematic diagrams of plasmids containing and not containing a stop codon are shown, respectively.
[0021] In a specific embodiment, the main steps include: To construct the control plasmid, a PCR reaction system was prepared using a PCR SuperMix kit (Vazyme). Using an existing plasmid containing the GFP sequence as a template, a normal GFP sequence with restriction sites added at both ends and a GFP sequence without a stop codon were amplified. The primer sequences for amplifying the normal GFP were: F: CCGGAATTCGATATCAGATCTGTGAGCAAG; R: CCCAAGCTTCTTGTACAGCTCGTCCATG. The primer sequences for amplifying the GFP without a stop codon were: F: CCGGAATTCGATATCAGATCTGTGAGCAAG; R: CCCAAGCTTTTACTTGTACAGCTCGTCCATG.
[0022] The PCR products were subjected to agarose gel electrophoresis, and the target bands were recovered using a gel recovery kit (AXYGEN) under ultraviolet light.
[0023] In one embodiment, the gel recovery process includes: excising the gel containing the target fragment and transferring it to a 1.5 ml centrifuge tube (the tube has been weighed). Weighing the gel piece yields an approximate volume calculated based on the equation 100 mg = 100 μL. Adding three volumes of Buffer DE-A and incubating the tube in a 65°C water bath for approximately 7 minutes until the gel is completely melted, shaking the tube every 2-3 minutes. Adding half the volume of Buffer DE-B and mixing thoroughly. Transferring a DNA preparation tube to a 2 ml collection tube, transfer the entire molten gel to the preparation tube. Centrifuging at 12,000 x g for 1 minute at room temperature. Discarding the filtrate from the collection tube and placing the preparation tube back into a 2 ml collection tube. Adding 500 μL of Buffer W1 to the preparation tube and centrifuging at 12,000 g for 1 minute. Discarding the filtrate from the collection tube and placing the column back into a 2 ml collection tube. Adding 700 μL of Buffer W2 to the preparation tube. Centrifuge at 12,000 g for 1 minute at room temperature. Discard the filtrate from the collection tube, place the column back into a 2 ml collection tube, and repeat this step once. Discard the filtrate from the collection tube and place the preparative tube back into the 2 ml collection tube. Centrifuge at 13,000 g for 2 minutes to remove any residual liquid. Place the preparative tube in a 1.5 ml centrifuge tube, add 20 μL of water, let stand at room temperature for 1 minute, and centrifuge at 13,000 g for 1 minute to elute the DNA. Measure the concentration using a Nanodrop.
[0024] This DNA fragment and the PRK5-Flag plasmid backbone already available in our laboratory were double-digested simultaneously to produce the same sticky ends.
[0025] In one embodiment, the double enzyme digestion process includes: 1 μg of the DNA fragment and the PRK5-Flag backbone plasmid are placed in two PCR tubes, followed by the addition of 1 μL of EcoRI, 1 μL of HindIII, 5 μL of 10× MBuffer, and water to 50 μL. After mixing, the mixture is incubated in a PCR instrument at 37°C for 2 hours. The target DNA fragment is then subjected to agarose gel electrophoresis and recovered from the gel as described above, and the concentration is measured using a Nanodrop.
[0026] The digested products were ligated using a T4 ligase kit (Thermo). The specific procedure was as follows: 50 ng of the double-digested DNA fragment and 150 ng of the plasmid were placed in PCR tubes. Then, 1 μL of T4 DNA Ligase and 2 μL of T4 DNA Ligase Buffer were added, and the volume was made up to 20 μL with water. After mixing, the tubes were incubated in a PCR machine at 37°C for 30 minutes and then pre-chilled on ice for 5 minutes.
[0027] The ligation product was transformed, plated, and single colonies were picked. The culture was expanded in LB medium before being sent for testing. The specific process was as follows: Remove the competent culture (100 μL / tube) from -80°C, add 20 μL of the ligation product, and gently tap the tube several times to mix. Place on ice for 30 minutes, incubate in a 42°C water bath for 45 seconds, and then place on ice for 2 minutes. Add 900 μL of LB medium to the EP tube and incubate at 37°C at 220 rpm for 1 hour. Centrifuge at 5000 rpm for 3 minutes. Aspirate 900 μL of the supernatant, then pipette the remaining 100 μL of the pellet and resuspend. Spread the supernatant evenly on a plate containing the corresponding antibiotic. Incubate the plate inverted at 37°C overnight (at least 12 hours). Pick a single colony and transfer it to 3 mL of LB medium containing 1‰ of the corresponding antibiotic. Incubate at 37°C at 220 rpm for 10 hours, then remove 1 mL and send it to the company for sequencing.
[0028] After sequence alignment, plasmids were extracted using a kit (OMEGA) to obtain PRK5-Flag-GFP plasmids containing a stop codon and a stop codon-deficient plasmid.
[0029] In one specific embodiment, the process includes: 100 μL of the bacterial culture from the previous step is added to 30 mL of LB medium containing 1‰ Amp-resistant strains and cultured at 37°C at 220 rpm for 16 hours. The cells are collected by centrifugation at 4000 x g for 10 minutes at room temperature. The culture medium is discarded, and 2.5 mL of Solution I / RNase A mixture is added to the pellet. The cells are vortexed to completely resuspend the cells. 2.5 mL of Solution II is added and the tube is gently inverted 8-10 times to mix thoroughly. 1.25 mL of pre-chilled N3 Buffer is added and the tube is gently inverted several times to mix thoroughly until a white, flocculent precipitate forms. The tube can be incubated at room temperature for 2 minutes, followed by centrifugation at 4°C at 15,000 g for 10 minutes to remove impurities from the precipitate. The supernatant is then aspirated into a collection tube. 0.1 volume of ETR Solution is added and the tube is mixed 10 times by inversion. The tube is then incubated on ice for 10 minutes. Place the lysate in a 42°C water bath for 5 minutes. Centrifuge at 4000xg for 5 minutes at room temperature. The ETR solution will form a blue layer at the bottom of the tube. Transfer the supernatant to another new 15mL tube, add 0.5 times the volume of anhydrous ethanol, and gently saturate the tube. Invert the tube 6-7 times and let it sit at room temperature for 1-2 minutes. Place the HiBind® DNA Midi Binding Column in a 15 mL collection tube. Transfer 3.5 mL of the mixture from the previous step to the column. Centrifuge at 5,000 x g for 3 minutes at room temperature and discard the filtrate. Place the column in the collection tube, add 3 mL of HBC Buffer, centrifuge at 4,000 x g for 3 minutes at room temperature and discard the filtrate. Place the column in the collection tube, add 3.5 mL of DNA Wash Buffer (diluted with anhydrous ethanol), centrifuge at 4,000 x g for 3 minutes at room temperature and discard the filtrate. Repeat this step. Place the column in the collection tube and centrifuge at 4,000 x g for 10 minutes at room temperature to dry the column matrix. Place the binding column in a clean 15 mL centrifuge tube, add 0.5 mL of Endo-Free Elution Buffer to the binding column matrix, let it stand at room temperature for 3 minutes, centrifuge at 4,000 x g for 5 minutes to elute the DNA, and measure the concentration using Nanodrop.
[0030] See also Figure 2 , Figure 2 The researchers demonstrated that microinjection of a plasmid containing a normal in vitro transcribed PRK5-Flag-GFP gene resulted in normal GFP expression in oocytes and embryos. However, injection of a plasmid lacking a stop codon significantly weakened GFP expression in oocytes and embryos, demonstrating the presence of the NSD pathway in oocytes and its degradation of the abnormal mRNA.
[0031] In a specific embodiment, the main steps include: GV-stage oocytes were obtained: Four-week-old female mice were injected with 5 units of PMSG (pregnant mareserum gonadotropin, Ningbo Sansheng Pharmaceutical Co., Ltd.) to simulate the effects of FSH in vivo and promote follicular development. After 44-48 hours of PMSG exposure, the mice were sacrificed by cervical dissection, and the ovaries were removed by abdominal dissection and placed in M2 medium (Sigma). To prevent spontaneous GVBD in oocytes in vitro, milrinone was added to the medium at a final concentration of 1 μM to inhibit GVBD. Large follicles in the ovaries were then punctured with a 1-ml syringe needle in M2 medium to release cumulus-oocyte complexes (COCs). The COCs were collected and repeatedly pipetted with a mouth pipette 1.5 times the diameter of the oocyte until the surrounding cumulus cells were removed. The oocytes were then collected, washed with clean M2 medium, and placed in a drop of M16 (Sigma) medium containing milrinone for further culture. The ratio of oocytes to M16 culture medium is approximately 1 oocyte to 2 μl of culture medium, and mineral oil is added to form a liquid seal to maintain the long-term stability of the culture medium. The cells are then cultured in a constant temperature of 37°C and 5% high-purity CO2 incubator.
[0032] Fertilized eggs were obtained from four-week-old female mice and injected with 5 units of PMSG (pregnant mare serum gonadotropin, Ningbo Sansheng Pharmaceutical Co., Ltd.) to simulate the effects of FSH in vivo and promote follicular development. 44-48 hours after the PMSG treatment, 5 units of hCG (human chorionic gonadotropin, Ningbo Sansheng Pharmaceutical Co., Ltd.) were injected to simulate the effects of LH and promote ovulation. The mice were then cohabitated with three-month-old male mice. Twenty hours later, the female mice were sacrificed by cervical dissection, and the oviductal magnum was removed by abdominal dissection. The fertilized egg clusters were then punctured with a needle in M2 culture medium to release the fertilized egg clusters. After adding hyaluronidase to digest the granulosa cells, the fertilized eggs were washed and cultured in KSOM (Sigma) culture drops. The ratio of zygote to KSOM culture medium was approximately 1 zygote to 2 μL of culture medium. Mineral oil was added to form a liquid seal to maintain long-term stability of the culture medium. The cells were then incubated at 37°C in a 5% high-purity CO2 incubator.
[0033] Plasmid linearization: Place 10 μg of plasmid in a PCR tube, add 5 μL of HindIII endonuclease (Takara), 15 μL of buffer, and finally make up to 150 μL with water. Place in a 37°C oven for 4 hours. Purify the DNA using an Axygen PCR cleanup kit and elute with 20 μL of nuclease-free water into a nuclease-free microcentrifuge tube. In vitro transcription is performed using the Invitrogen SP6 (AM 1340) kit. Place 1 μg of linearized plasmid in a 1.5 mL microcentrifuge tube, add 10 μL of 2X NTP / CAP, 2 μL of 10X Reaction Buffer, and 2 μL of Enzyme Mix, and make up to 20 μL with water. Mix thoroughly by pipetting and incubate at 37°C for 4 hours. Add 1 μL of TURBO DNase and return to the 37°C incubator for another 15 minutes to digest the DNA template.
[0034] To improve translation efficiency, in vitro poly(A) tailing was performed using the Invitrogen AM1350 kit. To the centrifuge tube from the previous step, 36 μL of Nuclease-Free Water, 20 μL of 5X E-PAP Buffer, 10 μL of 25 mM MnCl₂, 10 μL of 10 mM ATP, and 4 μL of E-PAP were added. Mix thoroughly by pipetting and incubate at 37°C for 1 hour. Add 50 μL of LiCl and place in a -20°C refrigerator for 1 hour to precipitate RNA. Centrifuge the sample at maximum speed at 4°C for 15 minutes. A white RNA precipitate will be visible at the bottom of the tube. Discard the supernatant, add 1 mL of 70% ethanol, and invert the tube to resuspend the RNA. Centrifuge the sample at maximum speed at 4°C for 15 minutes. Discard the ethanol and return the tube to the centrifuge at 12,000 g for 1 minute. Remove any liquid from the tube walls and aspirate thoroughly with a pipette. Place at room temperature for 10 to 20 minutes until the white precipitate at the bottom of the tube becomes transparent. Add 20 μL of water to dissolve the RNA and store in a -80°C refrigerator.
[0035] Microinjection was performed using an Eppendorf microinjector. GV-stage oocytes or fertilized eggs were placed in a 10 μL micromanipulation droplet filled with M2 culture medium and sealed with mineral oil to maintain a constant osmotic pressure. Milrinone (Thermo) was added to the culture medium at a final concentration of 1 μM to inhibit GVBD. Approximately 7 μL of milrinone was injected into each oocyte. After injection, oocytes with good condition and activity were selected and transferred to the appropriate culture medium. The oocytes were cultured in a 37°C, 5% CO2 incubator for 24 hours before fluorescence intensity measurement.
[0036] To examine the expression level of the FLAG-GFP fusion protein by Western blot, first obtain oocytes and zygotes using the method described above. Lyse the oocytes and zygotes in SDS loading buffer and treat at 95°C for 10 minutes to denature the proteins. Prepare an SDS-PAGE gel with an appropriate concentration (10%-15%) based on protein size. Flatten the gel surface with n-butanol and incubate at room temperature for at least half an hour. Rinse off the n-butanol and prepare a 5% top stacking gel. Insert a sample comb and incubate at room temperature for at least half an hour. After loading the sample, run the gel at a constant voltage of 140V for a time determined by the location of the target band. Transfer the protein sample from the gel to a PVDF membrane at 300mA. Block the membrane with 5% milk (skim milk powder dissolved in TBST buffer) for half an hour. Dilute the primary antibody to the appropriate concentration in blocking buffer and incubate the membrane in primary antibody buffer overnight at 4°C. Wash the PVDF membrane three times with TBST buffer, each time for 5 minutes. Dilute the corresponding secondary antibody at a 1:5000 dilution in TBST buffer and incubate the membrane at room temperature for half an hour. Wash the PVDF membrane three times with TBST buffer, each time for 5 minutes. Apply an appropriate amount of X-ray film to the ECL-reacted PVDF membrane and briefly expose for development.
[0037] See also Figure 3 , Figure 3 The effects of CHX on the NSD pathway in oocytes were demonstrated. When oocytes were injected with mRNA expressing GFP and mCherry, and CHX was added, neither GFP nor mCherry expression was observed, demonstrating the effectiveness of CHX. Next, GV-stage oocytes were injected with an NSD pathway reporter plasmid and CHX was added simultaneously. After 14 hours of culture, qPCR was performed to measure GFP expression in the three groups, using mCherry expression as an internal control. The group without a stop codon showed significantly lower GFP mRNA expression than the control group. However, CHX significantly increased GFP mRNA expression, indicating that inhibition of translation blocks NSD pathway activation.
[0038] In a specific embodiment, the main steps include: GV-stage oocytes were obtained according to the method described above. Micro-reverse transcription of oocyte samples was performed as follows: After washing with 0.2% BSA / PBS, samples were harvested. Lysis buffer (0.2% Triton X-100, 10 mmol dNTPs, and 10 mmol random primer) was prepared and added to the PCR tube containing the sample. The system was mixed and centrifuged, and then incubated at 72°C for 3 minutes. Reverse transcription was then performed using the TaKaRa PrimeScript™ II 1st Strand cDNA Synthesis Kit (containing PrimeScript II RTase, 5× PrimeScript II Buffer, RNase Inhibitor, MgCl2, and Betamine). The system was mixed and centrifuged, and then incubated at 42°C for 90 minutes and 70°C for 15 minutes.
[0039] RT-qPCR was used to detect mRNA expression levels in oocytes and embryos. The specific steps were as follows: Quantitative primers for detecting mCherry were designed with the following sequences: F: CTACTTGAAGCTGTCCTTCCCC; R: CTTGTAGATGAACTCGCCGTCC. Quantitative primers for detecting GFP were designed with the following sequences: F: TACAACAGCCACAACGTCTATATCA; R: GGTGTTCTGCTGGTAGTGGTC. RT-qPCR was performed using the Power SYBR Green PCR Master Mix (Thermo) and an Applied Biosystems 7500 Real-Time PCR System. Relative GFP expression levels were calculated in each group using mCherry expression as an internal control.
[0040] See also Figure 4 , Figure 4 The activation pattern of the NSD pathway was demonstrated. 30 or 60 A bases were inserted before the stop codon encoding GFP, encoding 10 or 20 lysines, respectively. After injection into GV-stage oocytes, GFP expression was slightly higher in the A30 group than in the control group, while GFP expression was completely absent in the A60 group. This indicates that 10 lysines can partially activate the NSD pathway, while 20 lysines can fully activate it.
[0041] In a specific embodiment, the process includes: when constructing a plasmid containing multiple A bases, first synthesize fragments of 30 A bases and 60 A bases respectively at Youkang Biological Company, and use the enzyme cutting-ligation method to connect this fragment to the stop codon of the plasmid containing a normal stop codon. According to the method mentioned above, transformation, plating, picking single clones, expanding culture, and extracting the plasmid can obtain NSD pathway reporter plasmids containing 30 A bases and 60 A bases.
[0042] Poly (A)-tailed A30 and A60 mRNAs were obtained using the in vitro transcription method described above and microinjected into oocytes using mCherry as an internal control. Milrinone (Thermo) was added to the culture medium at a final concentration of 1 μM to inhibit GVBD. Approximately 7 μl was injected into each oocyte. After injection, oocytes with good viability and good health were selected and transferred to the appropriate culture medium. The oocytes were incubated at 37°C with 5% CO2 for 24 hours before fluorescence intensity measurement.
[0043] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiment. All technical solutions based on the concept of the present invention are within the scope of protection of the present invention. It should be noted that for those skilled in the art, various improvements and modifications that do not depart from the principles of the present invention should also be considered within the scope of protection of the present invention.
Claims
1. A method for detecting the clearance mechanism of abnormal RNA with missing stop codons in mammalian oocytes, characterized by: The following steps are involved: S1, amplify the complete GFP sequence and the GFP sequence without the stop codon (TAA), and then ligate them into the plasmid backbone with a FLAG-tag; S2, polyadenylated mRNA was obtained by in vitro transcription and injected into GV-stage oocytes and zygotes, and the level of RNA clearance in oocytes was shown by the brightness of GFP; S3, oocytes were injected with in vitro transcribed reporter plasmids and treated with cycloheximide (CHX). Fluorescence intensity quantification and qPCR levels were used to detect whether the NSD pathway in oocytes is coupled to translation. S4, 30 A bases and 60 A bases were inserted upstream of the stop codon encoding GFP, respectively, to encode 10 or 20 lysines. After in vitro transcription and adding a Poly A tail, it was injected into GV stage oocytes, and the degree of activation of the NSD pathway was detected by measuring the fluorescence intensity.
2. The method for constructing a plasmid capable of activating the NSD pathway according to claim 1, comprising the following features: in step S1: a GFP sequence without a stop codon is amplified by designing specific primers, and is linked to a plasmid backbone containing a FLAG-tag to construct a reporter plasmid without a stop codon.
3. The plasmid for activating the NSD pathway according to claim 2, characterized in that: The reporter plasmid contains GFP protein, and the activation status of the NSD pathway can be determined by the fluorescence level of GFP.
4. The detection method according to claim 1, wherein: In step S2, in addition to injecting the plasmid constructed in step S1, a plasmid expressing mCherry is also injected.
5. The detection method according to claim 1, wherein: In step S3, cycloheximide (CHX) is added to the oocyte culture medium to inhibit ribosome sliding, thereby inhibiting translation. After the reporter plasmid is injected, the expression changes of GFP mRNA are detected to verify whether the NSD pathway can be activated under the condition of translation inhibition.