Application of GPR161 as diagnosis marker and treatment target of acute distress syndrome

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of GPR161 as an acute distress syndrome diagnostic marker and a therapeutic target. Experiments prove that the expression level of GPR161 in peripheral blood mononuclear cells of a patient with the acute respiratory distress syndrome is remarkably increased, and the expression quantity of the GPR161 is positively correlated with the severity of the disease, so that the GPR161 gene or GPR161 protein can be used as a molecular marker for screening or diagnosis or prognosis evaluation of the acute respiratory distress syndrome; a reagent for inhibiting GPR161 gene expression or protein activity can be used for preparing a medicine for treating the acute respiratory distress syndrome. The invention provides a new strategy for diagnosis, monitoring and targeted drug development of ARDS, and has important clinical application value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and particularly relates to the application of GPR161 as a diagnostic marker and therapeutic target for acute distress syndrome. Technical Background

[0002] Acute respiratory distress syndrome (ARDS) is a critical clinical illness characterized by non-cardiogenic pulmonary edema due to alveolar-capillary barrier disruption, diffuse alveolar damage caused by inflammatory cell infiltration, and progressive, refractory hypoxemia. Epidemiological surveys show that the incidence of ARDS in intensive care units is as high as 10.4%, with a mortality rate ranging from 35% to 45%. Survivors often suffer from severe sequelae of pulmonary dysfunction.

[0003] Currently, the clinical treatment of ARDS mainly relies on supportive measures such as mechanical ventilation, and there is a lack of specific drug treatment options. In addition, the lack of reliable early diagnostic markers has led to delays in clinical intervention for ARDS, and existing treatments are unable to effectively control the development of the inflammatory storm. Although some studies have reported some potential diagnostic markers, such as patent CN111135289A disclosing the use of FUNDC1 in the treatment of acute respiratory distress syndrome and patent CN119555924A disclosing the use of sIL-2Rα in preparations for early prediction of acute respiratory distress syndrome, these markers all have technical bottlenecks such as insufficient specificity and poor detection stability, making it difficult to meet clinical needs.

[0004] In recent years, with the advancement of technology, our understanding of the pathogenesis of ARDS has continued to deepen. Alveolar macrophages have been revealed to play an important role in the pathogenesis of ARDS, and abnormally activated macrophages have become one of the main culprits of ARDS. However, specific targets for regulating macrophage activation have not yet been identified. Summary of the Invention

[0005] One of the purposes of the present invention is to provide the use of GPR161 gene or GPR161 protein as a molecular marker for screening, diagnosis or prognosis evaluation of acute respiratory distress syndrome.

[0006] A second object of the present invention is to provide the use of the GPR161 gene or GPR161 protein in the preparation of products for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome.

[0007] Preferably, the product includes reagents and kits.

[0008] A third object of the present invention is to provide a product for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome, wherein the product is a reagent for detecting the expression level of the GPR161 gene and / or the content of the GPR161 protein, or the product comprises a reagent for detecting the expression level of the GPR161 gene and / or the content of the DHX58 protein.

[0009] Preferably, the product is a primer or probe that specifically detects GPR161 mRNA, and / or an antibody or antigen-binding fragment thereof that specifically binds to GPR161 protein.

[0010] Preferably, the object of detection is peripheral blood or isolated peripheral blood mononuclear cells.

[0011] Preferably, when the test results show that the expression level of the GPR161 gene and / or the content of the GPR161 protein is significantly higher than the preset threshold of the healthy control group, it indicates that the test subject is at risk of acute respiratory distress syndrome.

[0012] The present invention also provides the use of GPR16 as a therapeutic target for acute respiratory distress syndrome. Inhibiting GPR161 gene expression or inhibiting GPR161 protein activity can be used to treat acute respiratory distress syndrome.

[0013] Based on this, the fourth object of the present invention is to provide a reagent for inhibiting GPR161 gene expression or inhibiting GPR161 protein activity for use in the preparation of a drug for treating acute respiratory distress syndrome.

[0014] Preferably, the agent for inhibiting GPR161 gene expression comprises siRNA, shRNA or antisense nucleic acid molecules targeting the GPR161 gene, and the agent for inhibiting GPR161 protein activity comprises a neutralizing antibody or protein antagonist that specifically binds to the GPR161 protein.

[0015] Preferably, the target cells for inhibiting GPR161 gene expression or inhibiting GPR161 protein activity are alveolar macrophages or lung tissue epithelial cells, preferably alveolar macrophages.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] GPR161 (G Protein-Coupled Receptor 161) is an orphan receptor in the G protein-coupled receptor family and is widely involved in physiological functions and signaling regulation networks. GPR161 maintains basal cAMP levels by activating the Gs protein-AC-cAMP-PKA pathway. It also negatively regulates the Hh pathway through β-arrestin-mediated internalization, thereby regulating immune cell activation, proliferation, and differentiation. Aberrant expression of GPR161 is associated with various diseases, particularly tumors, developmental disorders, and metabolic diseases.

[0018] This application experimentally confirms that the level of GPR161 in peripheral blood mononuclear cells of ARDS patients is significantly higher than that of normal people. The expression level of GPR161 is positively correlated with the occurrence and development of acute respiratory distress syndrome, and can be used as a molecular marker for screening, diagnosis or prognosis evaluation of acute respiratory distress syndrome.

[0019] Experiments have shown that knocking down GPR161 in alveolar macrophages (MH-S) can inhibit MH-S activation and inflammatory responses; mice with myeloid GPR161 knockout showed significant reductions in inflammation and symptom relief. Therefore, targeting GPR161 may be an effective approach for treating acute respiratory distress syndrome (ARDS). This application is of great significance for studying the role of GPR161 in ARDS, understanding the disease mechanisms, and developing new treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1-Figure 2 The purpose of this study was to analyze the correlation between GPR161 mRNA expression in peripheral blood mononuclear cells of ARDS patients and ARDS disease activity and inflammatory factors. Figure 1 To investigate the correlation between GPR161 mRNA expression in PBMCs of ARDS patients and ARDS disease activity; Figure 2 To investigate the correlation between GPR161 mRNA expression in PBMCs of ARDS patients and inflammatory factors and chemokines.

[0021] Figure 3-Figure 4 The expression of GPR161 in the lung tissue of LPS-induced ARDS mouse model. Figure 3 Figure A in the middle shows the infiltration of inflammatory cells in the lung tissue of ARDS mice detected by HE staining; Figure B shows the expression of GPR161 in the lung tissue of ARDS mice detected by immunohistochemical staining; Figure 4 Immunofluorescence double staining (IF) was used to detect the expression of GPR161 in lung tissues of ARDS mice. Scale bars: 100 μm (10×), 20 μm (63×).

[0022] Figure 5Panel A shows the expression of GPR161 in lung tissues of control and ARDS mice, as well as in MH-S stimulated with LPS, by Western blot. Panel B shows the expression of GPR161 mRNA in lung tissues of control and ARDS mice, as well as in MH-S stimulated with LPS, by qRT-PCR. Data are expressed as mean ± SD; **P < 0.01.

[0023] Figure 6 The experimental results show that knocking down GPR161 can inhibit the activation and inflammatory response of alveolar macrophages MH-S. Figure 6 A shows the effect of GPR161 knockdown on the protein expression of inflammatory factors in MH-S cells after LPS activation by Western blot. B shows the effect of GPR161 knockdown on the mRNA expression of inflammatory factors in MH-S cells after LPS activation by qRT-PCR. C shows the effect of GPR161 knockdown on the release of inflammatory factors in MH-S cells after LPS activation by ELISA. Data represent a single replicate experiment with three samples per group and are expressed as mean ± SD. * P<0.05, ** P<0.01, # P<0.05, ## P<0.01.

[0024] Figure 7-Figure 8 The effect of systemic knockout of GPR161 on alveolar inflammation in mice. Figure 7 Figure A is a schematic diagram of mouse modeling; Figure B shows the inflammatory cell infiltration in the lung tissues of the control group and the tamoxifen group detected by HE staining, scale bar: 20 μm (63×); Figure C shows the expression of Il-1β in the lung tissues of the control group and the tamoxifen group detected by immunohistochemistry, scale bar: 20 μm (63×); Figure 8 A is the lung wet weight / dry weight ratio; B is the ELISA test of the effect of systemic knockdown of GPR161 on the release of alveolar inflammatory factors in ARDS mice; compared with the control group: * P<0.05, ** P<0.01.

[0025] Figure 9-10 The effect of myeloid-specific knockout of GPR161 on alveolar inflammation in mice. Figure 9 Figure A is a schematic diagram of mouse modeling; Figure B is HE staining to detect inflammatory cell infiltration in the lung tissues of the control group and the knockout group, scale bar: 20 μm (63×); Figure C is immunohistochemical detection of Il-1β expression in the lung tissues of the control group and the tamoxifen group, scale bar: 20 μm (63×); Figure 10A shows the effect of myeloid knockout of GPR161 on the mRNA expression of inflammatory factors and chemokines in the lung tissue of ARDS mice detected by qRT-PCR; B shows the ratio of lung wet weight to dry weight, which evaluates the degree of lung tissue edema; C shows the effect of myeloid knockout of GPR161 on the release of alveolar inflammatory factors in ARDS mice detected by ELISA; compared with the control group: * P<0.05, ** P<0.01, # P<0.05, ## P<0.01. DETAILED DESCRIPTION

[0026] The technical solution of this application is described in more detail below with reference to experiments and drawings.

[0027] Unless otherwise specified, the terms used herein have the meanings commonly understood by those skilled in the art.

[0028] The comparison between the abbreviations and the Chinese names in the examples is as follows:

[0029] ARDS:Acute Respiratory Distress Syndrome, acute respiratory distress syndrome.

[0030] GPR161: G protein-coupled receptor 161, G protein-coupled receptor family member 161.

[0031] PBMC: Peripheral blood mononuclear cells.

[0032] HE staining: Hematoxylin-Eosin staining.

[0033] IHC: Immunohistochemistry.

[0034] IF: Immunofluorescence.

[0035] IL1β: Nterleukin 1β, interleukin 1β.

[0036] IL6: Interleukin 6, interleukin 6.

[0037] TNFα: tumor necrosis factor-α, tumor necrosis factor.

[0038] CCL2: Chemokine ligand 2.

[0039] CCL3: Chemokine ligand 3.

[0040] CCL4: Chemokine ligand 4, chemokine ligand 4.

[0041] 1. Correlation analysis between GPR161 mRNA expression in peripheral blood mononuclear cells of ARDS patients and ARDS disease activity and inflammatory factors

[0042] Peripheral blood was collected from patients in the Health Examination Center and ICU of Anhui Chest Hospital (clinically diagnosed with ARDS). Mononuclear cells were isolated by Ficoll density gradient centrifugation, and RNA was extracted using conventional methods. qRT-PCR was used to evaluate the expression of GPR161 mRNA in PBMCs of the control group and ARDS patients.

[0043] The correlation between GPR161 mRNA expression and clinical disease activity of ARDS (PCT, CRP and PaO2 / FiO2, etc.), inflammatory factors (TNFα, IL6, IL1β) and chemokines (CCL2, CCL3 and CCL4, etc.) was further analyzed by qRT-PCR.

[0044] Figure 1 The results of the correlation analysis with ARDS disease activity are shown in the figure. AC represents PaO2 / FiO2 (oxygen partial pressure / inspired oxygen concentration ratio), PCT (Procalcitonin) and CRP (C-reactive protein), respectively. It can be seen that the expression of GPR161 mRNA is positively correlated with PCT and CRP, and negatively correlated with PaO2 / FiO2 with statistical significance, suggesting that GPR161 may play a role in the inflammatory response and lung damage of diseases such as ARDS. The results of the correlation analysis with ARDS alveolar inflammatory factors are shown in the figure. Figure 2 The expression of GPR161 mRNA was positively correlated with TNFα, IL6, IL1β, CCL2, CCL3 and CCL4, and the correlation was statistically significant, indicating that GPR161 may promote the occurrence and development of inflammation by affecting the production of inflammatory cytokines or the release of chemokines.

[0045] 2. Expression of GPR161 in lung tissue of ARDS model mice induced by intratracheal instillation of LPS

[0046] An ARDS mouse model was established by intratracheal instillation of LPS. Lung tissues were extracted from mice using conventional methods and embedded in paraffin. Immunohistochemistry and immunofluorescence were used to evaluate the expression of GPR161 in the lung tissues of ARDS mice.

[0047] See also Figure 3 Middle A, HE staining results showed that mice in the LPS-induced ARDS model group showed obvious inflammatory cell infiltration; see Figure 3 In middle B, immunohistochemistry results showed that the positive staining degree of lung tissue in ARDS mice was significantly higher than that in control mice, indicating that the expression of GPR161 in lung tissue of ARDS mice was significantly higher than that in control mice. Figure 4 , it can be seen that GPR161 is highly expressed in the lung tissue of ARDS mice, and partially overlaps with the expression of F4 / 80, showing the same trend, indicating that GPR161 can be used as a marker for the detection, diagnosis or evaluation of ARDS.

[0048] 3. In vitro study on the regulatory effect of targeting GPR161 on the activation and inflammatory response of alveolar macrophages MH-S.

[0049] GPR161-shRNA1 (F: TCGAGGCCCTTCAAGGAGTGGTCTATT CTCGAGAATAGACCACTCCTTGAAGGGTTTTTTA; R: AGCTTAAAAAACC CTTCAAGGAGTGGTCTATTCTCGAGAATAGACCACTCCTTGAAGGGCC) and GPR161-shRNA2 adenovirus (F: TCGAGGAGGAGGAGCTCCGTGACATTTCTCGAGAAATGTCACGGAGCTCCTCCTTTTTTTA; R: AGCTTAAAAAGGAGGA GCTCCGTGACATTTCTCGAGAAATGTCACGGAGCTCCTCCTCC) were constructed to knock down the expression of GPR161 in MH-S, respectively. Ad-GPR161 (F: CTGTTTGTATTATAAGTAAGG ACTAGTGATTCGCCACCATGGACTTCGTC; R: ATCCTTGTCATCGTCATCC TTGTAGTCGGATCCTCTCTGTTCTGCAGCTAAGACATTGCCTTCTT) was constructed to overexpress GPR161. After induction with 1 μg / mL LPS (to simulate the inflammatory microenvironment in ARDS patients), the expression and release of inflammatory factors (IL1β and IL6) after GPR161 knockdown were evaluated by Western blot, qRT-PCR, and ELISA.

[0050] Figure 5 Figure (A) shows Western blot analysis of GPR161 expression in lung tissues of control and ARDS mice, as well as in MH-S cells activated with LPS. Figure (B) shows qRT-PCR analysis of GPR161 mRNA expression in lung tissues of control and ARDS mice, as well as in MH-S cells activated with LPS. The results showed that GPR161 protein and mRNA expression in the lungs of ARDS mice was significantly higher than in the control group. Similarly, GPR161 expression was significantly elevated in MH-S cells activated by LPS.

[0051] Figure 6 To investigate the expression and release of inflammatory factors (IL1β, IL6) after knockdown of GPR161. Figure 6 A shows the effect of GPR161 knockdown on protein expression of inflammatory factors in MH-S cells after LPS activation by Western blot; B shows the effect of GPR161 knockdown on mRNA expression of inflammatory factors in MH-S cells after LPS activation by qRT-PCR; C shows the effect of GPR161 knockdown on the release of inflammatory factors in MH-S cells after LPS activation by ELISA. It can be seen that the expression and release of inflammatory factors in macrophages were significantly reduced after GPR161 knockdown.

[0052] 4. Effects of systemic GPR161 knockout on alveolar inflammation in ARDS mice

[0053] To investigate the role of GPR161 in alveolar inflammation in ARDS, we injected tamoxifen (with corn oil as solvent and vehicle) intraperitoneally into 8-week-old Gpr161 rats. F / F,R26+ Systemic knockout of GPR161 was achieved in mice. Local and systemic inflammatory responses were assessed 24 hours after intratracheal instillation of LPS.

[0054] Specifically, the transgenic mouse Gpr161 was constructed by using the R26-CreERT2 tool mouse F / F,R26+ , GPR161 conditional knockout mice (Gpr161 F / f ) was obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and R26-CreERT2 tool mice were obtained from Shanghai South Model Organisms Science Co., Ltd. Gpr161 was obtained by breeding conditional knockout mice with tool mice. F / f Cre+ , Gpr161 was obtained by self-breeding F / F,R26-ERT2+ , Gpr161 F / F,R26-ERT2+ After 5 consecutive days of intraperitoneal injection of 75 mg / kg tamoxifen (MCE, No. HY-13757A), systemic GPR161 knockout mice were obtained. The modeling diagram is shown in Figure 7 Middle A.

[0055] HE staining was used to detect the inflammatory cell infiltration in the lung tissues of the control group (corn oil) and the tamoxifen group. Figure 7 Middle B: HE staining showed that the alveolar inflammatory cell infiltration of the model group mice was significantly improved after systemic knockout of GPR161. Immunohistochemical analysis of the expression of Il1β in the lung tissues of the control group and tamoxifen group mice was performed. Figure 7 Middle C, IL1β secretion was reduced in the model group mice after GPR161 knockout.

[0056] Figure 8 Figure A is the lung wet / dry weight ratio. After the mouse was killed by dislocation, the right lung tissue was taken and the liquid and blood on the surface of the lung tissue were wiped clean with clean filter paper. Because the lung tissue was too light, the weight of the slide was weighed first, and then the weight of the slide plus the lung tissue was weighed, and recorded as the wet weight of the lung. The lung tissue was placed in a drying oven at 65°C, taken out and weighed every 24 hours until the weight of the lung tissue block no longer changed, and recorded as the dry weight of the lung. The reduction in the wet / dry weight ratio of the mouse lung indicated that pulmonary edema was improved after knocking out GPR161; Figure 8 Figure B shows ELISA detection of the effect of systemic knockdown of GPR161 on the release of alveolar inflammatory factors in ARDS mice. It can be seen that after knockdown of GPR161, the secretion of IL-1β and IL-6 in the alveolar lavage fluid of the model group mice was significantly reduced.

[0057] 5. Effects of myeloid-specific knockout of GPR161 on alveolar inflammation in ARDS mice

[0058] To investigate the role of macrophage GPR161 in alveolar inflammation, Lyz-Cre mice were used to construct myeloid GPR161 knockout mice. F / F lyz+ , local and systemic inflammatory responses were assessed 24 hours after intratracheal instillation of LPS.

[0059] The Gpr161 gene was constructed by using Lyz-Flox Cre tool mice F / F,Lyz+ , GPR161 myeloid-specific knockout mice (Gpr161 F / f ) was obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and Lyz-Flox Cre tool mice were obtained from Shanghai South Model Organisms Science Co., Ltd. Gpr161 was obtained by breeding conditional knockout mice with tool mice. F / f Cre+ , Gpr161 was obtained by self-breeding F / F,Lyz+ , modeling diagram see Figure 9 Middle A.

[0060] HE staining was used to detect the infiltration of inflammatory cells in the lung tissues of the control group and the knockout group. Figure 9 Middle B, HE staining showed that the alveolar inflammatory cell infiltration of the model group mice was significantly improved after systemic knockout of GPR161. Figure 9 Middle C, IL-1β secretion was reduced in model group mice after myeloid knockout of GPR161.

[0061] like Figure 10 As shown in A, qRT-PCR detection of the effect of myeloid knockout of GPR161 on the mRNA expression of inflammatory factors and chemokines in the lung tissue of ARDS mice showed that the mRNA expression of inflammatory factors and chemokines was reduced; the mice were killed by dislocation and the right lung was removed, and the wet weight and dry weight of the mouse lung were weighed. Figure 10 Middle B shows the wet / dry weight ratio of mouse lungs. The decreased ratio indicates that pulmonary edema is improved after myeloid knockout of GPR161. Figure 10 Middle C shows an ELISA assay to examine the effect of myeloid knockout of GPR161 on the release of alveolar inflammatory factors in ARDS mice. ELISA results showed that myeloid knockout of GPR161 significantly reduced the secretion of IL1β and IL6 in the bronchoalveolar lavage fluid of the model mice, suggesting that GPR16 has potential as a therapeutic target for ARDS.

[0062] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of GPR161 gene or GPR161 protein as a molecular marker for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome.

2. Use of the GPR161 gene or GPR161 protein in the preparation of products for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome.

3. The use according to claim 2, characterized in that The products include reagents and kits.

4. A product for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome, characterized in that: The product is a reagent for detecting the expression level of the GPR161 gene and / or the content of the GPR161 protein, or the product contains a reagent for detecting the expression level of the GPR161 gene and / or the content of the DHX58 protein.

5. A product for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome, characterized in that: The product is a primer or probe for specifically detecting GPR161 mRNA, and / or an antibody or antigen-binding fragment thereof that specifically binds to GPR161 protein.

6. A product for screening, diagnosis or prognosis assessment of acute respiratory distress syndrome according to claim 4, characterized in that: The object of the detection is peripheral blood or separated peripheral blood mononuclear cells.

7. The product according to claim 6, characterized in that When the test results show that the expression level of the GPR161 gene and / or the content of the GPR161 protein are significantly higher than the preset threshold of the healthy control group, it indicates that the subject being tested is at risk of acute respiratory distress syndrome.

8. Use of an agent that inhibits GPR161 gene expression or GPR161 protein activity in the preparation of a drug for treating acute respiratory distress syndrome.

9. The use according to claim 7, characterized in that The reagents for inhibiting GPR161 gene expression include siRNA, shRNA or antisense nucleic acid molecules targeting the GPR161 gene, and the reagents for inhibiting GPR161 protein activity include neutralizing antibodies or protein antagonists that specifically bind to GPR161 protein.

10. The use according to claim 9, characterized in that The target cells for inhibiting GPR161 gene expression or inhibiting GPR161 protein activity are alveolar macrophages or lung tissue epithelial cells.

Images