Obtaining of corn kernel protein major QTL qHP5 and development and application of molecular marker primer of corn kernel protein major QTL qHP5

Abstract

The invention belongs to the field of molecular biology, and discloses acquisition of corn kernel protein major QTL qHP5 and development and application of molecular marker primers of the corn kernel protein major QTL qHP5. The major QTL qHP5 for controlling the corn kernel protein is located at the fifth chromosome of the corn, the major QTL locus for controlling the variation of the corn kernel protein is an excellent haplotype SNP marker which is closely linked with the major QTL locus and is located at the 166392631th basic group of the fifth chromosome of a corn B73 reference genome, the explained phenotype contribution rate of the corn kernel protein is 9.8%, and the explained phenotype contribution rate of the corn kernel protein is 9.8%. The PARMS marker designed by using the SNP is used for detecting a corn inbred line group, is simple and convenient to operate and clear in typing, has a good selection effect on yield traits and growth period traits such as corn ear weight, hundred-grain weight, single-ear grain weight, row number of ears, row number of grains and the like, and can be used for molecular marker-assisted selection breeding of the corn kernel protein content.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to the acquisition of a major effect QTL qHP5 for maize grain protein and the development and application of its molecular marker primers. Background Art

[0002] As a key global food resource, the nutritional composition of corn plays a fundamental supporting role in human diet and livestock and poultry farming. Protein, as the core nutrient for life activities, plays an irreplaceable role in the metabolic regulation of organisms, and the protein accumulation level of corn kernels directly determines its economic value in food processing and feed applications. In the livestock industry, high-quality, high-protein corn raw materials can significantly improve the growth efficiency of livestock and poultry and enhance disease resistance. However, existing corn varieties generally have the defect of low grain protein content (the average content is about 8-10%), forcing feed companies to add an additional 30-35% of soy protein and other auxiliary materials to meet nutritional needs. The structural imbalance of feed raw materials has become a key bottleneck restricting the sustainable development of animal husbandry.

[0003] Although a small number of genes regulating maize kernel protein content have been reported, the functional genes that regulate kernel protein content in maize have been identified to date, and the molecular mechanisms of kernel protein formation in maize are still largely unknown. Therefore, accurately identifying high-protein kernel traits is of great significance for creating new high-yield, high-quality maize varieties and providing target selection for breeding new high-protein varieties.

[0004] Based on this, this study widely collected 588 backbone inbred lines from corn producing areas including the southwest and Huanghuaihai regions, established associated groups of excellent germplasm with different characteristics, completed 20X deep resequencing of the whole genome based on the DNBSEQ-T7 / PE150 sequencing platform, and used a near-infrared spectrometer to determine the protein content of the grains. Further, through association analysis, excellent allelic variations were identified, specific functional markers were developed and used to create breeding intermediate materials, providing excellent allelic resources for the development of high-protein molecular breeding of corn. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of a reagent for detecting base 166392631 of the fifth chromosome of the corn genome in screening and breeding of corn kernel protein content.

[0006] Another object of the present invention is to provide a use of a reagent for detecting base 166392631 of chromosome 5 of the corn genome in the preparation of a kit for screening corn kernel protein content.

[0007] The last object of the present invention is to provide a method for screening and breeding corn kernel protein content.

[0008] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0009] Obtaining the major QTL qHP5 controlling maize grain protein:

[0010] 1) Through genome-wide association analysis, the present invention detected a major QTL qHP5 regulating maize grain protein on chromosome 5 of maize. This interval contains 5 tightly linked SNP sites with a total length of 382.5Kb (Chr5:166010268-166392786).

[0011] 2) The applicant developed a functional molecular marker closely linked to the optimal haplotype PARMS marker, with the physical location being (Chr5: 166392631). The PARMS marker primers are: qHP5R: GCTGATCCATCGACACATTCTCTA, qHP5F1 (haplotype C with low protein content): GAAGGTGACCAAGTTCATGCTAGTACGAGTACCAATCAATGAAAGTGAAC, and qHP5F2 (haplotype T with high protein content): GAAGGTCGGAGTCAACGGATTAGTACGAGTACCAATCAATGAAAGTGAAT.

[0012] 3) The applicants analyzed the kernel protein phenotype of the 588 maize inbred line under eight different environments and confirmed that the superior haplotype qHP5 contributes 9.8% to the kernel protein phenotype in natural populations and is strongly selected in breeding practices. This superior haplotype provides a genetic resource for the development of high-protein maize lines.

[0013] The protection content of the present invention also includes:

[0014] Application of a reagent for detecting base 166392631 of chromosome 5 of the maize genome in screening and breeding for maize grain protein content.

[0015] Application of a reagent for detecting base 166392631 of chromosome 5 of the maize genome in preparing a screening kit for maize grain protein content.

[0016] In the above application, if the base 166392631 of the fifth chromosome of the corn genome is detected to be T, the corn is determined to be a high-protein sample. Preferably, the high-protein refers to a protein content greater than or equal to 12%.

[0017] In the above application, if the base 166392631 of the fifth chromosome of the corn genome is detected to be C, the corn is determined to be a low-protein sample. Preferably, the low-protein refers to a protein content of less than 12%.

[0018] In the above application, the reagent is preferably a primer.

[0019] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: qHP5R: GCTGA TCCATCGACACATTCTCTA, qHP5F1 (low protein haplotype C): GAAGGTGACCAAGTTCATGCTAGT ACGAGTACCAATCAATGAAAGTGAAC and qHP5F2 (high protein haplotype T): GAAGGTCGGAGTCAAC GGATTAGTACGAGTACCAATCAATGAAAGTGAAT.

[0020] A method for screening and breeding corn kernel protein content traits comprises detecting bases 166,392,631 of chromosome 5 of the corn genome using conventional protocols in the art, wherein the conventional protocols include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0021] The reference genome of maize used in the present invention is Zm-B73-REFERENCE-NAM-5.0.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] This invention is the first to finely locate a new major QTL controlling maize grain protein based on whole-genome association analysis. The major QTL is located on chromosome 5. This interval contains 5 tightly linked SNP sites with a total length of 382.5Kb (Chr5:166010268-166392786). These sites are all major QTL sites controlling the phenotypic variation of maize grain protein content, and the explained phenotypic contribution rate is 9.8%. The PARMS marker developed based on its optimal allele type can be used for molecular marker-assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a normal distribution box plot of maize kernel protein content in 588 inbred line related populations under 8 environments;

[0025] Figure 2 This is the BLUP value distribution diagram of grain protein content in the associated population.

[0026] Figure 3 Schematic diagram of association analysis of qHP5 locus in Ezhou, Hubei;

[0027] Association analysis between 13.2 million polymorphic variant sites with a minimum allele frequency greater than 0.05 at the qHP5 locus and grain protein content phenotype in 588 different inbred lines. Each dot represents a polymorphic site.

[0028] Figure 4 Schematic diagram of association analysis of qHP5 locus in the environment of Gucheng, Hubei;

[0029] Association analysis between 13.2 million polymorphic variant sites with a minimum allele frequency greater than 0.05 at the qHP5 locus and grain protein content phenotype in 588 different inbred lines. Each dot represents a polymorphic site.

[0030] Figure 5 Schematic diagram of qHP5 superior haplotype effect analysis;

[0031] Comparative analysis of protein content among 50 inbred lines of the qHP5 genotype and 511 inbred lines of the qhp5 genotype. Each box represents the median and interquartile range and extends to the maximum and minimum values. The significance of the differences was estimated by one-way analysis of variance.

[0032] Figure 6 This is a hierarchical haplotype frequency analysis diagram of the qHP5 protein content gradient.

[0033] Figure 7 Schematic diagram of the evaluation of the genetic effects of qHP5 in other traits;

[0034] The scatter plots represent the distribution of protein content in the families. T represents the favorable haplotype of qHP5, and C represents the unfavorable haplotype of qHP5. Each box represents the median and interquartile range and extends to the maximum and minimum values. The error bars represent the SD. The significance of the differences was estimated by one-way analysis of variance. Figure 8 Schematic diagram for the development and utilization of optimal haplotype functional markers for qHP5;

[0035] In the figure: Left: qHP5F2 type family has high grain protein content, right: qHP5F1 type family has low grain protein content. DETAILED DESCRIPTION

[0036] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the art; the reagents or materials described are all publicly available unless otherwise specified.

[0037] The reference genome of the maize of the present invention is Zm-B73-REFERENCE-NAM-5.0 (MaizeGDB GenomeCenter).

[0038] Example 1:

[0039] Obtaining the major QTL qHP5 for maize grain protein:

[0040] 1. Materials and Methods

[0041] 1.1 Materials

[0042] We collected 588 backbone inbred lines from corn-producing areas in Southwest China and the Huanghuai-Haihe region, established associated groups of excellent germplasm with different characteristics, and completed 20X whole-genome resequencing based on the DNBSEQ-T7 / PE150 sequencing platform, obtaining 13.2 million high-quality SNP markers.

[0043] 1.2 Experimental methods

[0044] 1.2.1 Phenotypic identification

[0045] The protein content of corn kernels was determined using a near-infrared spectrometer. Each sample was measured twice and the average value was taken. 1.2.1 Genome-wide association analysis of corn kernel protein loci

[0046] For the raw sequencing data, data quality control was performed to obtain high-quality clean data. The clean data was then aligned to the reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. PEreads were aligned with the B73 reference genome sequence using BWA software to obtain the alignment results in AM format. The SAM format file was converted to BAM format using samtools. Then, SortSam in the Picard tool was used to sort the reads in the BAM file, remove PCR duplicates, and obtain the final BAM file that can be used for variant calling. Finally, the HaplotypeCaller module of GATK was used to detect variants, including SNPs and InDels. Q and K were calculated by the software STRUCTURE and TESSEL5.0, respectively. After correction, we set P = 1.0×10 -5 As the significance threshold of GWAS results.

[0047] 1.2.2 Development of optimal haplotype molecular markers

[0048] Based on the B73 genome and the differential locus information provided by qHP5 sequencing, specific primers were designed using PARMS detection technology, a PCR-based detection technique developed to specifically resolve single-base variants. The PARMS SNP PCR reaction uses five primers, two of which are fluorescent universal primers included in the PARMS2X Master Mix. The remaining three are marker-specific primers and require custom design and synthesis based on the experimental objectives. One of these three primers is locus-specific, and the other two are allele-specific. Each of these two primers has a 21-base universal adapter sequence added to its 5' end to mate with the fluorescent universal primers. The adapter sequence mates with the FAM fluorophore: GAAGGTGACCAAGTTCATGCT, and the adapter sequence mates with the HEX fluorophore: GAAGGTCGGAGTCAACGGATT.

[0049] 1.2.3 Genotype analysis

[0050] The CTAB (Cetyltrimethyl Ammonium Bromide) method was used for small-scale DNA extraction of corn (Saghai-Maroof et al 1984).

[0051] PARMS SNP Detection Principle: Allele 1 and Allele 2, specific amplification primers with two different universal adapter primer sequences, bind to the corresponding SNP DNA template after DNA annealing. The PARMS PCR enzyme and buffer system ensure strict allele-specific amplification. Combined with the Locus-specific amplification primers, after the first two rounds of PCR, a PCR amplification product with a universal adapter sequence is formed. At this point, a universal probe with a reporter fluorescence and a fluorescence quencher group (no fluorescence signal due to the FRET effect when no amplification is taking place) can be used for PCR amplification using the PCR amplification product with the universal adapter sequence as a template. Once amplification is successful, the fluorescence quencher group on the fluorescent probe dissociates from the reporter group, and the FRET effect disappears. Fluorescence scanning can then detect the corresponding fluorescence signal, thereby determining the presence of the corresponding allele.

[0052] 2. Results and Analysis

[0053] 2.1 Identification of grain protein content in 588 inbred line-associated populations

[0054] The grain protein data of 588 inbred line populations were tested in 8 environments in Shihezi, Xinjiang (XJ), Lingshui, Hainan (HN), Ezhou, Hubei (EZ) and Gucheng, Hubei (GC) over two years (2022 to 2024). The results are shown in Table 1. The phenotypic variation of grain protein content was 8.28% to 15.75%. Figure 1 It can be seen that the protein content in the eight environments is normally distributed, and the population phenotypic variation is rich.

[0055] Table 1 Statistical analysis of association population phenotypes

[0056]

[0057] CK represents the normal growth group, and Stess represents the waterlogging stress treatment. BLUP values ​​of grain protein content of the associated population materials under 8 environments were calculated. Figure 2 It can be seen that the protein content has an obvious normal distribution, among which there are 3 inbred lines with protein content ≥14%, 25 inbred lines with protein content between 13%-14%, 144 inbred lines with protein content between 12%-13%, 274 inbred lines with protein content between 11%-12%, 130 inbred lines with protein content between 10%-11%, and 12 inbred lines with protein content <10%.

[0058] 2.2 Identification and genetic effect analysis of the major QTL qHP5 for maize grain protein

[0059] Based on genome-wide association analysis, this application identified a new major QTL controlling maize grain protein, which is located on chromosome 5. The interval contains five tightly linked SNPs with a total length of 382.5 kb (Chr5: 166010268-166392786) and is named qHP5. (Table 2, Figure 3 、 4 ).

[0060] qHP5 locus leadSNP 166392631(T / C) Significantly associated at p=8.91E-07, located at base 166392631 of chromosome 5 of the maize genome (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to as the maize B73V5 reference genome in this paper)

[0061] PARMS primers were designed for the above SNP sites as follows:

[0062] (1) Marking lead SNPs for peak SNPs that are closely linked to qHP5 166392631(T / C), extract the sequence of 150 bp upstream and downstream of base 166392631 of chromosome 5 of the maize B73V5 reference genome. According to the primer design principles, the PARMS marker detection primer sequence is obtained as follows:

[0063] qHP5R: GCTGATCCATCGACACATTCTCTA;

[0064] qHP5F1: GAAGGTGACCAAGTTCATGCT AGTACGAGTACCAATCAATGAAAGTGAAC;qHP5F2: GAA GGTCGGAGTCAACGGATT AGTACGAGTACCAATCAATGAAAGTGAAT;

[0065] The underlined sequence of the reverse primer is the linker sequence.

[0066] (2) Using the genomic DNA of the maize inbred line population as a template, the above primers were used for fluorescence quantitative PCR amplification, and the FAM and HEX signals were scanned and the results were output using Tecan F200, and finally converted into genotypes.

[0067] Using the above primers, the sequence amplified from the low-protein material Dan598 (Danyu series male parent) is:

[0068] GAAGGTGACCAAGTTCATGCT AGTACGAGTACCAATCAATGAAAGTGAA C GGCGAAAGATTCATAGGAGGCGGCTGTTTTTTTTTTTTTGCTTGTCTTAGAATAGAGAATGTGTCGATGGATCAGC

[0069] The sequence of the amplified product in the high-protein material HZ32 (Huayu No. 3 male parent) is:

[0070] GAAGGTCGGAGTCAACGGATT AGTACGAGTACCAATCAATGAAAGTGAA T GGCGAAAGATTCATAGGAGGCGGCTGTTTTTTTTTTTTTGCTTGTCTTAGAATAGAGAATGTGTCGATGGATCAGC

[0071] Amplification system:

[0072]

[0073] Amplification parameters:

[0074]

[0075] According to SNP 166392631(T / C) The results showed that the maize kernel protein content in the two haplotypes was significantly different from that in the control group. 166392631(T / T) Also known as qHP5 allele type, 511 materials are SNPs 166392631(C / C) In the eight environments, the average protein content of the qHP5 haplotype inbred lines was significantly higher than that of the qhp5 haplotype (p < 0.05, Figure 5 ), so it is the superior haplotype of qHP5. Figure 6 , the stratified haplotype frequency analysis of the high-protein locus qHP5 in the protein content gradient showed that the qHP5 superior haplotype accounted for 17.75% in materials with protein content >12%, 6.46% in materials with protein content 11%-12%, 2.43% in materials with protein content 10%-11%, and 0% in materials with protein content less than 10%, indicating that qHP5 is a key gene locus for improving the protein content of corn grains, and is enriched to a certain extent in high-protein materials and has great potential for high-protein genetic improvement. At the same time, qHP5 is a pleiotropic gene locus that regulates corn yield traits such as growth period, number of kernels per row, ear weight, 100-kernel weight, and ear length ( Figure 7 ).

[0076] Table 2 SNPs significantly associated with grain protein content in the qHP5 interval

[0077]

[0078] a a Physical location of the qHP5 locus (V5), b single nucleotide variant, c minor allele, d minor allele frequency.

[0079] Example 2:

[0080] Application of Molecular Marker Primers for the Elite Haplotype of the Major QTL qHP5 for Maize Kernel Protein:

[0081] From a population of 588 inbred lines, 55 inbred lines were randomly selected. Eight lines from each family were pooled and DNA was extracted. The grain protein content of the samples listed in Table 3 was measured using a near-infrared spectrometer. Each sample was measured twice, and the average value was taken. Comparison revealed that samples with a T allele at position 166,392,631 were high-protein materials, while samples with a C allele at position 166,392,631 were low-protein materials. High-protein samples had a protein content of ≥12%, while low-protein samples had a protein content of <12%.

[0082] The above results confirm that the developed functional markers can be used for molecular marker-assisted selection for genetic improvement of maize grain protein traits, providing selection targets for creating new high-protein maize germplasm and breeding new high-protein varieties. 166392631(C / T) PARMS markers were designed and genotyped in 55 randomly selected inbred lines from the association population, as shown in Table 3. Comparing the genotype results of resequencing, it was found that the results of typing using PARMS markers were 100% consistent with the resequencing results, as shown in Table 3. Figure 8 .exist Figure 8 In the figure, the green dots indicate that the linker primer sequence is HEX fluorescence, that is, the qHP5F2 type family has a high grain protein content; the blue dots indicate that the linker primer sequence is FAM fluorescence, that is, the qHP5F1 type family has a low grain protein content, which shows that the PARMS marker can effectively distinguish the two haplotypes.

[0083] Table 3 Identification and evaluation of corn kernel protein content

[0084]

[0085]

[0086]

Claims

1. Application of a reagent for detecting base 166392631 of chromosome 5 of the maize genome in screening and breeding for maize grain protein content.

2. Application of a reagent for detecting base 166392631 of chromosome 5 of the corn genome in the preparation of a screening kit for corn grain protein content traits.

3. The use according to claim 1 or 2, characterized in that: If the base 166392631 of the fifth chromosome of the corn genome is detected to be T, the sample to be tested is determined to be a high-protein sample.

4. The use according to claim 1 or 2, characterized in that: If the base 166392631 of the fifth chromosome of the corn genome is detected to be C, the sample to be tested is determined to be a low-protein sample.

5. The use according to claim 1 or 2, characterized in that: The reagent is a primer.

6. The use according to claim 5, wherein the primer is: QUR :GCTGATCCATCGACACATTCTCTA, qHP5F1 : GAAGGTGACCAAGTTCATGCTAGTACGAGTACCAATCAATGAAAGTGAAC and qHP5F2 :GAAGGTCGGAGTCAACGGATTAGTACGAGTACCAATCAATGAAAGTGAAT.

7. A method for screening and breeding for the protein content trait of corn kernels, comprising detecting base 166392631 of chromosome 5 of the corn genome using conventional protocols in the art, wherein the conventional protocols include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

Images