Cytochrome p450 monooxygenase gene from ramie and the protein and recombinant plasmid encoded by the gene and application thereof

By obtaining the full-length coding sequence and recombinant plasmid of the ramie cytochrome P450 monooxygenase gene, the problem of the weakness of ramie in cadmium-contaminated soil remediation technology was solved, its cadmium tolerance and ecological restoration capacity were improved, and a basis for molecular improvement was provided.

CN120665903BActive Publication Date: 2026-02-10GUIZHOU INST OF PRATACULTURE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510608743.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2026-02-10
Estimated Expiration
2045-05-13

AI Technical Summary

Technical Problem

In the current technology, the technology and basic research on ramie remediation of cadmium-contaminated soil are weak, and no substantial breakthroughs have been made in the study of related molecular mechanisms, making it difficult to improve its cadmium tolerance and ecological restoration capacity.

Method used

The full-length coding sequence of the ramie cytochrome P450 monooxygenase gene (BnMAX1) was obtained using PacBio sequencing technology. Its function was cloned and identified, and a recombinant plasmid was constructed and applied to ramie to alleviate cadmium stress. Longer transcript data were obtained using PacBio Sequel sequencing, and gene annotation comparison and expression analysis were performed to verify its function.

Benefits of technology

This study provides fundamental theoretical support for improving cadmium tolerance in ramie, enhances its ecological restoration capacity under heavy metal cadmium stress, and provides a reference for improving drought resistance in other plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665903B_ABST
    Figure CN120665903B_ABST
Patent Text Reader

Abstract

The present application provides a kind of cytochrome P450 monooxygenase gene and the protein coded by it, recombinant plasmid and application derived from ramie, the coding region sequence of the cytochrome P450 monooxygenase gene derived from ramie is as shown in SEQ ID NO:1, the amino acid sequence of the protein coded by it is as shown in SEQ ID NO:2.The present application takes ramie as research object, obtains ramie cytochrome P450 monooxygenase gene (BnMAX1) by three generations sequencing and gene annotation comparison.Longer coding sequence of the target gene is obtained by PacBio Sequel sequencing, which is simple, fast and easy to operate.The function of the gene is verified by cloning identification, bioinformatics, expression pattern and genetic transformation analysis, which shows that the gene has the effect of relieving plant cadmium toxicity.The acquisition and application of the gene provide basic theoretical support for molecular improvement of cadmium tolerance of ramie, and provide new technical means for how to improve the ecological restoration ability of ramie under heavy metal cadmium stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and particularly to a cytochrome P450 monooxygenase gene derived from ramie, its encoded protein, recombinant plasmid, and applications. Background Technology

[0002] Cadmium is a highly toxic heavy metal element. As a non-essential nutrient element in plant growth and development, it is easily absorbed and accumulated by plants. Cadmium disrupts the plant's water balance, chlorophyll structure, and chlorophyll synthesis, inhibiting photosynthesis and thus affecting normal plant growth.

[0003] Ramie (Boehmeria nivea (L.) Gaudich), also known as "Chinese grass," is a fiber crop native to my country and a plant used for soil and water conservation in southern regions. Ramie exhibits strong tolerance and accumulation capacity for cadmium, making it an excellent plant for in-situ remediation of cadmium-contaminated soils. However, current research on ramie-based soil remediation technologies and basic studies is relatively weak, with no substantial breakthroughs achieved, and further in-depth research is needed on its molecular mechanisms. Therefore, identifying genes related to cadmium stress and precisely defining their functional genes is of great significance for improving cadmium tolerance and enhancing the ecological restoration capacity of ramie. Summary of the Invention

[0004] The purpose of this invention is to provide a cytochrome P450 monooxygenase gene derived from ramie, its encoded protein, recombinant plasmid, and applications. Using ramie as the research object, sequencing was performed using the PacBio platform and corrected using the sequencing results from the Illumina platform to obtain a longer transcript. After gene annotation and alignment, the CDS sequence of the ramie BnMAX1 gene was obtained. The function of this gene was verified through cloning identification, bioinformatics, expression pattern analysis, and genetic transformation analysis, indicating that this gene has the effect of alleviating cadmium toxicity in plants.

[0005] The technical problem solved by this invention is achieved by the following technical solution.

[0006] This invention proposes a cytochrome P450 monooxygenase gene derived from ramie, the coding sequence of which is shown in SEQ ID NO: 1. This invention obtained a longer coding sequence (average length 1933 bp) using PacBio Sequel sequencing. The high-quality full-length transcript data provides important genomic information for ramie, for which there is no reference genome.

[0007] This invention proposes a protein encoded by the cytochrome P450 monooxygenase gene derived from ramie, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0008] This invention proposes a recombinant plasmid containing the cytochrome P450 monooxygenase gene derived from ramie.

[0009] Furthermore, in a preferred embodiment of the present invention, the plasmid is pCAMBIA.

[0010] This invention proposes the application of the cytochrome P450 monooxygenase gene derived from ramie in alleviating cadmium stress in ramie.

[0011] The cytochrome P450 monooxygenase gene derived from ramie and its encoded protein, recombinant plasmid, and their beneficial effects in this invention are as follows:

[0012] This invention uses ramie as the research object and obtains the ramie cytochrome P450 monooxygenase gene (BnMAX1) through third-generation sequencing and gene annotation alignment. A longer coding sequence of the target gene was obtained using PacBio Sequel sequencing. This method is simple, rapid, and highly operable.

[0013] The sequence obtained in this invention is a novel cytochrome P450 monooxygenase gene (BnMAX1) amplified from ramie. Through BnMAX1 gene cloning, bioinformatics analysis, expression pattern analysis, and gene function verification, its corresponding gene function has been demonstrated. The acquisition and application of this ramie cytochrome P450 monooxygenase gene provides fundamental theoretical support for the molecular improvement of cadmium tolerance in ramie, offers a new technical means to enhance the ecological restoration capacity of ramie under heavy metal cadmium stress, and also provides important reference for improving the drought resistance of other plants. Attached Figure Description

[0014] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0015] Figure 1 This is a sequence alignment diagram of the homologous gene encoding the protein of the ramie cytochrome P450 monooxygenase gene.

[0016] Figure 2 A phylogenetic analysis diagram of BnMAX1;

[0017] Figure 3 The hydrophilicity / hydrophobicity diagram of BnMAX1;

[0018] Figure 4 This is the secondary structure diagram of BnMAX1;

[0019] Figure 5 This is a three-level structure diagram of BnMAX1;

[0020] Figure 6 Predicted transmembrane domains and subcellular localization of BnMAX1;

[0021] Figure 7 A diagram illustrating the expression patterns of BnMAX1;

[0022] Figure 8 RT-qPCR validation diagram of Arabidopsis thaliana overexpressing BnMAX1 gene;

[0023] Figure 9 The plant characteristics and staining reaction of Arabidopsis thaliana under Cd stress were shown in the diagram. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0025] The following describes in detail the cytochrome P450 monooxygenase gene derived from ramie, its encoded protein, recombinant plasmid, and applications according to embodiments of the present invention.

[0026] Example 1

[0027] This embodiment provides the ramie BnMax1 gene transcript sequence, which is obtained according to the following steps:

[0028] (1) Preparation of ramie materials: Ramie seedlings of uniform growth (ramie germplasm preserved by the Guizhou Provincial Grassland Research Institute) were selected, the soil around the roots was washed away, and they were transferred into a hydroponic device with Hoagland nutrient solution. The culture conditions were 25℃ / 20℃, and the light / dark cycle was 14h / 10h. Hoagland aqueous solution was used as the control group (Control, CK), and Hoagland aqueous solution + 0.75M CdCl2 was used as the treatment group, with the solution replenished regularly. After 60 days of treatment, samples from both treatment groups were selected for transcriptome sequencing.

[0029] (2) Construction of sequencing libraries: Total RNA was extracted according to the RNA extraction kit (OMEGA, China) instructions. Nano Drop 2000 (Thermo, USA) and agarose gel electrophoresis were used to check for RNA degradation and contamination. After the RNA was reverse transcribed into cDNA using the PCR cDNA Synthesis Kit, PCR amplification was performed using KAPA HiFi PCR Kits, fragment screening was performed using BluePippin, and finally, an SMRTbell library was constructed using the SMRTbell template prep kit 1.0.

[0030] (3) Sequencing data assembly and quality control: The constructed libraries were sequenced using a PacBio Sequel sequencer. The raw sequencing data was filtered to remove low-quality and short reads (minimum raw data length was 50 bp, minimum raw data accuracy was 0.8). Self-correction was performed based on the random error characteristics of PacBio sequencing (minimum full passes: 1; minimum prediction accuracy: 0.8; minimum ROI length: 200 nt) to obtain high-quality insert sequences (Reads of Insert, ROI). LIMA software was used to identify and remove adapter sequences to obtain complete insert sequences. The ICE algorithm was used to cluster redundant sequences together, and then the incomplete insert sequences were aligned back to the consistency sequence. Quiver was then used for correction to obtain high-quality transcripts (HQ) and low-quality transcripts (LQ) with an accuracy greater than 0.99.

[0031] (4) Transcript functional annotation: The obtained transcript sequences are compared with databases such as GO (Gene Ontology), KEGG (Kyoto Encyclopedia of Genes and Genomes), KOG (Clusters of Orthologous Groups), Pfam (Protein family), eggNOG (Evolutionary Genealogy of Genes: Non-supervised Orthologous Groups), NT (Non-Redundant Nucleotide sequence database), NR (Non-Redundant Protein Sequence Database), and TmHMM (Transmembrane Helix Hidden Markov Model) to obtain transcript annotation information.

[0032] (5) Fragment acquisition: The BnMax1 gene transcript sequence was obtained using the PacBio platform, and specific amplification primers were designed as follows:

[0033] Forward primer sequence (5′→3′): AGCTTTCGCGAGCTCGGTACCATGGCAGA GACTTGGC (SEQ ID NO: 3);

[0034] Reverse primer sequence (5′→3′): CTCGAGCTTGCATGCCTGCAGTTAAGCCC TGTTGATGAC (SEQ ID NO: 4).

[0035] PCR amplification and sequencing verification yielded the full-length 1611 bp coding region sequence of the BnMax1 gene (CDS, as shown in SEQ ID NO: 1), and the amino acid sequence of the protein (BnMAX1) it encodes is shown in SEQ ID NO: 2, with a length of 536 aa.

[0036] Example 2

[0037] This embodiment performs a homology comparison on BnMAX1, and the specific steps are as follows:

[0038] Sequence alignment was performed using the blastn tool on the NCBI website to find homologous proteins of BnMAX1 in species such as Arabidopsis thaliana, tomato, petunia, and rice. A phylogenetic tree was constructed using MEGA4.1 and multiple sequence alignment analysis was performed using DNAMAN.

[0039] like Figure 1The image shows a sequence alignment of the homologous gene encoding the protein of the ramie cytochrome P450 monooxygenase gene (BnMAX1). Figure 2 This is a phylogenetic analysis diagram of BnMAX1. From... Figure 1 and Figure 2 It can be seen that ramie is grouped with dicotyledonous plants such as hemp, peas, roses, and apples into one category. Figure 1 These plants share over 80% amino acid sequence homology. Figure 2 This indicates that MAX1 is evolutionarily conserved.

[0040] Example 3

[0041] In this embodiment, the physicochemical properties of BnMAX1 were analyzed online using EXPASY. Table 1 shows the physicochemical properties of BnMAX1. From Table 1, it can be seen that the molecular formula of BnMAX1 is C1. 2729 H 4304 N 736 O 767 S 17 With a relative molecular mass of 60.24 kD, a theoretical isoelectric point of 9.12, 54 negatively charged amino acid residues, 61 positively charged amino acid residues, an instability coefficient of 41.31, a lipophilic coefficient of 94.57, and an average hydrophilicity coefficient of -0.095, BnMAX1 is a positively charged, unstable, hydrophilic protein.

[0042] Table 1 Physicochemical Properties of BnMAX1

[0043]

[0044] Furthermore, the hydrophilicity and hydrophobicity of BnMAX1 were analyzed online using Protscale. For example... Figure 3 The diagram shows the hydrophilicity / hydrophobicity of BnMAX1. From... Figure 3 It can be seen that among all amino acid residues, the most hydrophilic is glutamic acid at position 462, while the most hydrophobic is isoleucine at position 252. The total score of hydrophobic amino acids is 199.544, while the total score of hydrophilic amino acid residues is -249.534, indicating that BnMAX1 is a hydrophilic protein.

[0045] Example 4

[0046] This embodiment uses Prabi online analysis of the BnMAX1 secondary structure.

[0047] like Figure 4 The diagram shows the secondary structure of BnMAX1. From... Figure 4It can be seen that the secondary structure of BnMAX1 consists of 43.28% α-helices, 16.79% extended chains, 6.72% β-turns and 33.21% random coils (SOPM method).

[0048] Example 5

[0049] In this embodiment, SWISS-MODEL is used to perform three-level structural homology modeling of BnMAX1 online, and VMD is used to render the model according to the color of the two-level structure.

[0050] like Figure 5 The diagram shows the three-level structure of BnMAX1. From... Figure 5 The study found that tobacco showed the highest sequence similarity to BnMAX1, with a sequence similarity of 74.53%, a sequence coverage of 99%, and a GMQE confidence level of 0.88. The model was evaluated online using SAVES (https: / / saves.mbi.ucla.edu / ), achieving an ERRAT score of 97.10, indicating the model's reliability. In the tertiary structure of BnMAX1, the N-terminus consists of an α-helix, with a β-sheet appearing at the 84th amino acid (isoleucine).

[0051] Example 6

[0052] This embodiment uses TMHMM and Cell-Ploc online analysis to determine the transmembrane domain and subcellular localization of BnMAX1. For example... Figure 6 The image shows a predicted map of the transmembrane domains and subcellular localization of BnMAX1. From... Figure 6 It is known that BnMAX1 has no transmembrane signal, does not have a transmembrane structure, and is located in chloroplasts.

[0053] Example 7

[0054] This embodiment analyzes the expression pattern of BnMAX1, and the specific steps are as follows:

[0055] Ramie seeds were sown in nutrient pots (humus:vermiculite = 3:1) and cultured under conditions of 25℃ / 20℃, relative humidity 50-70%, and light / dark cycles of 14h / 10h. After 30 days of growth, plants with uniform growth were selected and transferred to Hoagland nutrient solution for acclimatization. Seven days later, plants with uniform growth were selected and treated with 60 mg / L CdCl2 in Hoagland solution, while plants in Hoagland solution without CdCl2 were also planted. At 0h, 8h, 16h, 24h, and 48h, the aboveground and underground parts of the Cd-treated ramie plants were collected; and at 48h, roots, stems, and leaves of plants in Hoagland solution without CdCl2 were collected. All samples were used for RT-qPCR. The RT-qPCR steps are as follows:

[0056] (1) Design of specific primers for RT-qPCR

[0057] BnMAX1-specific primers were designed using the Primer-Blast online tool available on the NCBI website.

[0058] Table 2 RT-qPCR Primers

[0059]

[0060] (2) Sample addition system and reaction conditions

[0061] The reaction system is shown in Table 3.

[0062] Table 3 RT-qPCR reaction system

[0063]

[0064] Using CFX96 TM RT-qPCR was performed using a real-time quantitative PCR instrument (Bio-Rad, USA) under the following reaction conditions:

[0065] Table 4 RT-qPCR reaction conditions

[0066]

[0067] (3) Data processing methods

[0068] Use 2 -ΔΔCT The method is to process the data.

[0069] like Figure 7 The diagram shown is an analysis of the expression patterns of BnMAX1. Among them, Figure 7 -A is a diagram illustrating different tissue sites; Figure 7 -B is a graph showing the expression of the aboveground parts under Cd stress at different times; Figure 7 -C represents the expression of underground parts under Cd stress at different time points; the letters indicate significance analysis at the P < 0.05 level. From Figure 7 It can be seen that BnMAX1 is expressed in the root, stem, and leaf tissues. Figure 7 The presence of BnMAX1 (-A) indicates that BnMAX1 is involved in the growth and development of ramie, with the highest expression level observed in the roots, possibly related to the synthesis of SLs in the roots. Furthermore, BnMAX1 expression was induced under cadmium stress (-A). Figure 7 -B、 Figure 7 -C) indicates that BnMAX1 plays a role in ramie's response to cadmium stress.

[0070] Example 8

[0071] This embodiment uses the overexpression vector pCAMBIA-2300S preserved by the Guizhou Provincial Grassland Research Institute. The ORF of BnMAX1 was constructed into the pCAMBIA-2300S vector using homologous recombination. The specific process is as follows:

[0072] (1) Vector linearization by double enzyme digestion, the reaction system is as follows:

[0073]

[0074] After the reaction solution was mixed evenly and centrifuged, it was placed in a PCR instrument and digested at 37°C for 60 min. After the digestion reaction was completed, 1% agarose gel electrophoresis was performed, and the gel was excised and purified.

[0075] (2) The gene coding sequence with restriction enzyme sites was obtained, and the amplification system is as follows:

[0076]

[0077]

[0078] After mixing and centrifuging all components, PCR reaction was performed. The system is as follows:

[0079]

[0080] After the PCR reaction was completed, electrophoresis was performed on a 1% agarose gel, and the correct bands were cut and recovered.

[0081] (3) Homologous recombination reaction between the carrier and the product, the reaction system is as follows (carried out on ice):

[0082]

[0083] After the system is prepared, mix it thoroughly by pipetting and then place it in a PCR instrument at 50°C for 30 min.

[0084] (4) Transformation of recombinant products into competent E. coli cells

[0085] After the reaction in step (3) is completed, add the reaction solution to 100 μL of Escherichia coli (DH5α) competent cells, mix gently, place on ice for 30 min, activate at 42℃ for 60 s, incubate on ice for 5 min, add 800 μL of liquid culture medium, place in a shaker at 37℃ and 200 rpm for 1 h, take an appropriate amount of bacterial solution and spread it on LB solid medium containing Kan, and place in a constant temperature incubator at 37℃ for 16 h.

[0086] (5) Bacterial PCR

[0087] A single colony was selected using a pipette tip and added to 1 mL of LB liquid medium containing Kan. The culture was shaken at 37°C and 200 rpm for 6 hours until the culture became turbid. PCR was then performed using primers for the BnMAX1 gene cloning. The reaction system and procedure were as described in step (2). After the reaction, agarose gel electrophoresis was performed. Bacterial cultures with the correct band size were selected for testing. After successful sequencing, the cultures were shaken, and recombinant plasmids were extracted according to the plasmid extraction kit instructions (Beijing, Tiangen).

[0088] (6) Transformation of Agrobacterium tumefaciens with recombinant plasmids

[0089] Add 2-3 μL of recombinant plasmid to 100 μL of Agrobacterium (GV3101) competent cells, then incubate on ice for 5 min, freeze in liquid nitrogen for 5 min, incubate in water at 37℃ for 5 min, incubate on ice for 5 min, then add blank LB liquid medium and shake at 28℃ and 220 rpm for 2-3 h. Spread evenly on LB solid medium containing Kan and Rif, and incubate in the dark at 28℃ for 2-3 days. Pick bacteria and perform bacterial PCR verification in the same reaction system as in (2). Add glycerol to the bacterial solution with the correct band size and store it in a -80℃ refrigerator.

[0090] (7) Transformation of Arabidopsis thaliana plants by flower immersion method

[0091] Agrobacterium tumefaciens BnMAX1-2300S was activated for 2 days on LB solid medium containing Kan and Rif. The bacterial cells were scraped and placed in 15 mL of LB liquid medium containing Kan and Rif. The culture was incubated at 28℃ and 200 rpm for 8-10 h in a shaker. After centrifugation at 5000 rpm for 5 min, the supernatant was removed, and the bacterial cells were resuspended in 1 / 2 MS medium. The OD600 was adjusted to approximately 0.8-1.0, and surfactant SilwetL-77 (Solarbio) was added to a final concentration of 200 μL / L. Arabidopsis thaliana flower buds (preserved by Guizhou Provincial Grassland Research Institute, Col-0) at full bloom were immersed in the bacterial solution and allowed to stand for 1 min. After infection, they were placed in a light incubator for cultivation. A second infection was performed after 7 days, and a third infection after 14 days. After seed maturation, T0 generation seeds were collected and post-ripened in a 37℃ constant temperature incubator for 14 days before being stored in a seed cabinet.

[0092] T0 generation seeds were disinfected with 75% alcohol for 1 min, then with 5% sodium hypochlorite for 15 min, and washed 5 times with sterile water before being spotted onto MS medium containing 36 mg / L Hyg and 100 mg / L Kan for screening. After 20 days, normally growing Arabidopsis thaliana plants were transplanted into a peat moss:vermiculite (1:2) substrate for culture. After 28 days of growth, DNA was extracted for identification. Seeds from the identified plants were designated T1. After multiple generations of screening, homozygous seeds were obtained for subsequent experiments. AtActin was used as an internal control gene, and positive plants were identified using RT-qPCR, following the same method as in Example 7. The primer sequences are as follows:

[0093] AtActin2-F: ACCTTGCTGGACGTGACCTTACTGAT (SEQ ID NO: 9);

[0094] AtActin2-R: ACCTTGCTGGACGTGACCTTACTGAT (SEQ ID NO: 10).

[0095] like Figure 8 The image shown is an RT-qPCR validation diagram of Arabidopsis thaliana overexpressing the BnMAX1 gene. From... Figure 8 It can be seen that the BnMAX1 gene can be stably expressed in Arabidopsis thaliana.

[0096] Example 9

[0097] In this embodiment, wild-type Arabidopsis thaliana (WT), the max1 Arabidopsis thaliana mutant (mutant number: SALK_209654C, sourced from: China Arabidopsis Mutant Sharing Center, https: / / www.arashare.cn / ), and BnMAX1 overexpressing Arabidopsis thaliana (BnMAX1-OE) were spotted in MS medium and MS medium + 25 mg / L CdCl2. After 7 days of culture, the root length of each Arabidopsis material was observed, and the plants were transplanted into nutrient pots (humus:vermiculite = 3:1) and cultured for another 21 days. Then, Cd treatment (25 mg / L CdCl2) was applied, with CdCl2 solution sprayed every other day. The control group was sprayed with the same volume of water. After 7 days of treatment, leaves were collected for staining with nitrotetrazolium chloride (NBT) and dithizone. The specific methods are as follows:

[0098] (1) NBT staining: Arabidopsis leaves were stained in 0.1 g / L NBT solution for 12-18 h. After staining, the leaves were placed in 75% ethanol and heated at 60 °C until the leaves were completely decolorized.

[0099] (2) Dithizone staining: Arabidopsis leaves were stained in 0.4 g / L NBT solution for 4-6 h. After staining, the leaves were placed in 75% ethanol for 1-2 h to decolorize until the leaves were completely decolorized.

[0100] like Figure 9 The image shows the plant traits and staining reactions of Arabidopsis thaliana overexpressing Cd under stress. Figure 9 -A~ Figure 9 -B is a graph showing the plant growth status on MS medium; Figure 9 -C~ Figure 9 -D is a graph showing the growth of plants on MS medium with 25 mg / L CdCl2. Figure 9 -E represents the NBT staining results; Figure 9 -F shows the results of dithizone staining. From Figure 9 It can be seen that under Cd stress, the root length of BnMAX1-OE plants is longer than that of WT and max1. After staining with NBT and dithizone, the staining degree of BnMAX1-OE is lower than that of WT and max1. This indicates that BnMAX1-OE plants have reduced reactive oxygen species accumulation and fewer Cd complexes in their bodies under Cd stress. This proves that the expression of BnMAX1 improves the plant's ability to scavenge reactive oxygen species and reduces the accumulation of Cd in the plant. Therefore, BnMAX1-transformed Arabidopsis can alleviate Cd toxicity.

[0101] The embodiments described above are some, but not all, embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

Claims

1. A cytochrome P450 monooxygenase gene derived from ramie, characterized in that, The coding region sequence of the cytochrome P450 monooxygenase gene derived from ramie is shown in SEQ ID NO:

1.

2. A protein encoded by the cytochrome P450 monooxygenase gene derived from ramie as described in claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO:

2.

3. A recombinant plasmid containing the cytochrome P450 monooxygenase gene derived from ramie as described in claim 1.

4. The recombinant plasmid according to claim 3, characterized in that, The plasmid is pCAMBIA.

5. The application of the cytochrome P450 monooxygenase gene derived from ramie as described in claim 1 in alleviating cadmium stress in ramie.

Citation Information

Patent Citations

  • Method of improving cadmium resistant capability of plants by using ramie BnXTH1 gene

    CN108998472A

  • Method for improving cadmium sensitivity of plants by BnXTH5 gene of ramie

    CN110004172A