Method for identifying eye color character genotype of peacock
Through specific primer combinations and PCR amplification technology, the mutation sites of the OCA2 and TYR genes of guppies are directly detected, which solves the problems of low efficiency and poor genetic stability in purebred breeding of guppies, and realizes rapid and accurate identification of eye color traits and purebred breeding.
Patent Information
- Application Number
- CN202510763698.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-09-19
AI Technical Summary
The existing methods for purebred breeding and cultivation of guppies have the problems of low efficiency, high cost, and poor genetic stability. There is a lack of rapid and accurate molecular identification and breeding methods, making it difficult to effectively screen and fix excellent traits.
Specific primer combinations were used, combined with PCR amplification and Sanger sequencing technology, to directly detect the mutation sites of the OCA2 gene and TYR gene in guppies. The eye color genotype of guppies was quickly identified by agarose gel electrophoresis and Sanger sequencing.
It has achieved rapid and accurate identification of the eye color genotype of guppies, shortened breeding time, saved manpower and space costs, and improved the success rate and genetic stability of purebred breeding.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of animal genetic breeding, and in particular relates to a method for identifying the genotype of eye color traits of guppies. Background Art
[0002] The purebred breeding of various commercially available guppy strains and the development of new strains have always been important issues in guppy farming. However, current purebred breeding and cultivation methods have many limitations. There is a lack of efficient means to screen and maintain desirable traits, resulting in significant uncertainty in breeding results, long breeding cycles, and low success rates. Furthermore, traditional purebred breeding techniques struggle to ensure genetic stability, making strain characteristics susceptible to variation and degeneration. Molecular breeding technology is undoubtedly an important approach to addressing these issues. For quality traits controlled by a small number of genes, marker-assisted selection using a few molecular markers can rapidly develop pure lines within one to two generations without testcrossing, improving breeding success rates and reducing breeding costs.
[0003] The red eye of guppies is a form of albinism. Due to the lack of melanin in their eyeballs, light entering the eye is not absorbed, resulting in a red reflection in the blood vessels. Currently, research on guppy eye color is relatively limited, and effective molecular identification and breeding methods are lacking, hindering practical breeding and selection. Our recent research has revealed that guppy eye color is controlled by two genetic variants: the OCA2 gene (GeneID: 103463915) and the TYR gene (Gene ID: 103474486). Homozygous mutants in either gene exhibit red eyes, while heterozygous mutants exhibit black eyes (wild type). This explains why offspring with red eyes may exhibit wild-type behavior when both parents are red-eyed. This finding enables the development of a rapid, accurate, and easy-to-use method for genotyping guppy eye color, which has important implications and practical applications for fixing the red eye trait in different guppy strains or rapidly developing and purifying red-eyed guppy strains. Summary of the Invention
[0004] The purpose of the present invention is to provide a method for identifying the genotype of eye color trait of guppy fish.
[0005] To achieve the purpose of the present invention, in a first aspect, the present invention provides a primer set for detecting the genotype of the OCA2 gene in guppies, wherein the primer set includes three primers shown in SEQ ID NOs: 1-3.
[0006] In a second aspect, the present invention provides a primer pair for detecting the genotype of the TYR gene in guppies, wherein the primer pair comprises two primers shown in SEQ ID NO: 4-5.
[0007] In a third aspect, the present invention provides a primer combination for detecting the genotype of the eye color trait of guppy fish, wherein the primer combination includes the primer group shown in SEQ ID NO: 1-3 and / or the primer pair shown in SEQ ID NO: 4-5.
[0008] In a fourth aspect, the present invention provides a detection reagent or kit containing the primer combination.
[0009] In a fifth aspect, the present invention provides the use of the primer combination or the detection reagent or kit in identifying the eye color trait genotype of guppy.
[0010] In a sixth aspect, the present invention provides a method for detecting the genotype of eye color traits of guppies, comprising the following steps: (1) Extracting genomic DNA of the guppy to be tested; (2) using the DNA extracted in step (1) as a template, performing PCR amplification using the primer set shown in SEQ ID NOs: 1-3 and / or the primer pair shown in SEQ ID NOs: 4-5; (3) Analyze the PCR amplification products.
[0011] Furthermore, the OCA2 gene genotype was detected by agarose gel electrophoresis, and the TYR gene genotype was detected by Sanger sequencing.
[0012] The OCA2 gene genotype was determined as follows: heterozygous individuals with the wild-type OCA2 gene showed two bands of 889 bp and 581 bp; homozygous individuals with the wild-type OCA2 gene showed only one band of 889 bp; and homozygous individuals with the OCA2 gene mutation corresponding to the red-eye mutation type showed only one band of 581 bp.
[0013] The TYR gene genotype was determined as follows: if a C base deletion occurred at position 538 of the PCR amplification product, the individual was homozygous for the TYR gene mutation corresponding to the red-eye mutation type; if there was no C base deletion at this site, the individual was wild-type; if the sequencing results at and after this site were a single peak, the individual was homozygous for the wild-type TYR gene; if the sequencing results after this site showed overlapping peaks, the individual was heterozygous for the wild-type TYR gene.
[0014] Preferably, the PCR amplification system for detecting the OCA2 genotype is as follows: 10 μL of 2× Taq PCR Mix, 0.5 μL of 10 pmol / μL of the primers set forth in SEQ ID NO: 1, 0.25 μL of the primers set forth in SEQ ID NO: 2, and 0.25 μL of the primers set forth in SEQ ID NO: 3, respectively, 1 μL of DNA template, and 8 μL of ddH2O. Preferably, the PCR amplification program is as follows: 95°C for 5 minutes; 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; 72°C for 5 minutes; Preferably, the PCR amplification system for detecting the TYR genotype is as follows: PCR amplification system: 10 μL of 2× Taq PCRMix, 0.5 μL and 0.5 μL of the primers set forth in SEQ ID NO: 4 and SEQ ID NO: 5, respectively, at 10 pmol / μL, 1 μL of DNA template, and 8 μL of ddH2O. Preferably, the PCR amplification program is as follows: 95°C for 5 min; 35 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 1 min; and 72°C for 5 min.
[0015] In a seventh aspect, the present invention provides application of the method in identifying the genotype of eye color traits in guppies.
[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (1) The present invention provides specific primers and a detection method for identifying the genotype of the eye color trait of guppies. Compared with conventional methods, this method can quickly and accurately identify the eye color type without the need for hybridization tests, shortening the time for breeding red-eye strains and purifying black-eye strains, and saving the manpower and space costs required for hybridization tests.
[0017] (2) Based on the insertion fragment of the OCA2 gene and the single-base deletion of the TYR gene of the guppy, the present invention has developed specific primers for identifying the eye color genotype of the guppy. The primers have good specificity and can identify the eye color genotype through PCR amplification and simple agarose gel electrophoresis or conventional Sanger sequencing. It has the advantages of easy operation, rapidity, efficiency and high accuracy.
[0018] (3) The present invention can carry out identification in large quantities quickly, causes little physiological damage to the guppies being tested, and basically does not affect the health status of the individuals being tested. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is an agarose gel electrophoresis detection diagram of the PCR amplification products of primer combination 1 of some samples involved in Example 1 of the present invention, that is, the OCA2 genotyping result diagram.
[0020] Figure 2 This is the Sanger sequencing peak diagram of the PCR amplification products of the primer combination 2 of some samples involved in Example 1 of the present invention, that is, the TYR genotyping diagram.
[0021] Figure 3 This is the PCR amplification product of the wild-type TYR gene corresponding to the second primer combination of some samples involved in Example 1 of the present invention. DETAILED DESCRIPTION
[0022] The present invention provides a method for rapidly identifying the eye color genotype of guppies. This method utilizes specific primer combinations based on PCR and Sanger sequencing. Based on two eye color variant sites in guppies, located on the OCA2 gene and the TYR gene, the present invention provides two sets of primers (primer combination 1: SEQ ID NOs: 1-3, primer combination 2: SEQ ID NOs: 4-5) for detecting and identifying the genotypes at these two variant sites. This method can rapidly identify the eye color genotype of guppies without testcrossing, enabling purebred breeding of guppies with different eye colors. In practical applications, the method is simple to operate and highly accurate.
[0023] The present invention adopts the following technical solutions: In the first aspect, the present invention provides two sets of primer combinations for detecting the eye color trait genotype of guppies, namely, primer combination 1 as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, for detecting the OCA2 genotype; primer combination 2 as shown in SEQ ID NO:4 and SEQ ID NO:5, for detecting the TYR genotype.
[0024] In a second aspect, the present invention provides a detection reagent or kit containing the primer combination.
[0025] In a third aspect, the present invention provides the use of the primer combination or a detection reagent or kit containing the primer combination in identifying the genotype of the eye color trait of guppy.
[0026] In a fourth aspect, the present invention provides a method for detecting the genotype of eye color traits of guppies, comprising the following steps: (1) Extracting genomic DNA from the guppy to be tested: Collect 10-20 mg of the guppy tail fin and extract genomic DNA using the traditional phenol-chloroform method, or purchase a commercial kit and extract genomic DNA according to the kit's instructions; (2) using the DNA extracted in step (1) as a template and performing PCR amplification using the primer combination; (3) Identification of OCA2 genotype: PCR amplification system 1: 2× Taq PCR Mix 10 μL, 10 pmol / μL primers SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 0.5 μL, 0.25 μL, and 0.25 μL, respectively, DNA template 1 μL, and ddH2O 8 μL; PCR amplification program 1: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min; store at 4°C; The OCA2 genotype was determined by agarose gel electrophoresis. The agarose gel electrophoresis includes: the concentration of agarose gel is 1%, the sample volume is 5 μL, the electrophoresis voltage is 120V, and the electrophoresis time is 30 minutes. After electrophoresis, the image is displayed on a gel imager. The genotyping results are as follows: Figure 1 As shown, the wild-type heterozygous individual showed two bands of 889 bp and 581 bp; the wild-type homozygous individual showed only one band of 889 bp; and the red-eye mutant homozygous individual showed only one band of 581 bp.
[0027] (4) Identification of TYR genotype: PCR amplification system 2: 2× Taq PCR Mix 10 μL, 10 pmol / μL primers SEQ ID NO: 4 and SEQ ID NO: 5 0.5 μL and 0.5 μL respectively, DNA template 1 μL, ddH2O 8 μL; PCR amplification program 2: 95°C for 5 min; 95°C for 30 s, 50°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min; store at 4°C. The PCR amplification product of primer set 2 was detected by Sanger sequencing (if a Sanger sequencer is not available, the PCR amplification product can be sent to a commercial company for Sanger sequencing, and the sequencing primer is SEQ ID NO: 4). The TYR gene genotype was identified based on the Sanger sequencing peak graph. Figure 2 As shown, if a C base deletion occurs at position 538 of the PCR product reference sequence (the sequence is shown in SEQ ID NO: 6), it is a homozygous individual for the red-eye mutation at this site; if there is no C base deletion at this site, it is a wild type. If the nucleic acid sequence at and after this site is a single peak, it is a wild type homozygous individual; if an overlapping peak appears after this site, it is a wild type heterozygous individual.
[0028] In a fifth aspect, the present invention provides application of the method in identifying the genotype of eye color traits in guppies.
[0029] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0030] Example 1 Method for Identifying the Genotype of Eye Color Traits in Guppies 1. Primer design and preparation The two genetic variation sites of the guppy eye color trait discovered in the present invention, located in the OCA2 gene and the TYR gene, were used as molecular markers. Five primers were designed using Primer 5 software. The primers are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, respectively. The primer sequences are as follows (5′-3′): SEQ ID NO:1 AGAGAGCAGCTTTTGTTACA SEQ ID NO:2 CAGTTCAAAGATTACAGCGG SEQ ID NO:3 CTGTCGCTGCAAACTTAAAA SEQ ID NO:4 CTTGCCACTCAATCTTCTAAGC SEQ ID NO:5 CAGATTTGTTGATTTGAAAGACAT The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0031] 2. Extraction of genomic DNA from guppy tail fin tissue 10-20 mg of tail fin tissue was collected from each guppy, and genomic DNA was extracted using the Marine Animal Tissue Genomic Extraction Kit (#DP324) from Tiangen Biochemical Technology Co., Ltd. The extraction steps were carried out according to the kit instructions.
[0032] 3. Identification of OCA2 genotype PCR amplification system: The entire reaction system (20 μL) includes 10 μL of standard 2× Taq PCR Mix, 0.5 μL of 10 pmol / μL primers (SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3), 0.25 μL, and 0.25 μL, respectively, of 10 pmol / μL, 1 μL of DNA template, and 8 μL of ddH2O. The manufacturer of 2× Taq PCR Mix is Beijing Huitian Dongfang Technology Co., Ltd., product number HT201, and the specification is 1 × 1 ml / tube. The DNA concentration should be at least 20 ng / μL.
[0033] PCR amplification program: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min; and storage at 4°C.
[0034] Agarose gel electrophoresis detection: The concentration of agarose gel is 1%, the sample volume is 5μL, the electrophoresis voltage is 120V, and the electrophoresis time is 30min. After electrophoresis, the image is displayed on a gel imager. The judgment criteria are: if the PCR product has two bands of 889bp and 581bp, it is a wild-type heterozygous individual; if the PCR product has only one band of 889bp, it is a wild-type homozygous individual; if the PCR product has only one band of 581bp, it is a homozygous individual of the red eye mutation at this site. Genotyping results are as follows Figure 1 shown.
[0035] 4. Identification of TYR genotype PCR amplification system: The entire reaction system (20 μL) includes 10 μL of standard 2× Taq PCR Mix, 0.5 μL and 0.5 μL of 10 pmol / μL primers SEQ ID NO: 4 and SEQ ID NO: 5, respectively, 1 μL of DNA template, and 8 μL of ddH2O. The manufacturer of 2× Taq PCR Mix is Beijing Huitian Oriental Technology Co., Ltd., product number HT201, and the specification is 1 × 1 ml / tube. The DNA concentration should be at least 20 ng / μL.
[0036] PCR amplification program: 95°C for 5 min; 95°C for 30 s, 50°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min; and storage at 4°C.
[0037] Sanger sequencing to detect TYR genotype: The PCR amplification product was submitted to the commercial sequencing company Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing, and the sequencing primer was SEQ ID NO: 4. After the commercial sequencing company returned the sequencing results, the TYR gene genotype was identified based on the Sanger sequencing peak graph. The judgment criteria were: if there was a C base deletion at position 538 of the PCR product reference sequence (the sequence is shown in SEQ ID NO: 6), it was a homozygous individual of the red-eye mutant type; if there was no C base deletion at this site, it was a wild type. If the nucleic acid sequence peak graph at and after this site was a single peak, it was a wild type homozygous individual; if there was an overlapping peak after this site, it was a wild type heterozygous individual. The genotyping results are as follows: Figure 2 shown.
[0038] The reference sequence of the PCR amplification product of primer combination 2 (SEQ ID NO: 6; position 538 is the variant site, indicated in red font) is as follows Figure 3 shown.
[0039] Example 2 Genotyping of Multiple Guppy Strains Using the method of Example 1, genotype identification was performed on 243 guppies from 13 strains, including 142 red-eyed guppies from seven strains: Sky Blue, Yellow Dress White, Gold, Golden Mosaic, Fortune Dangtou, Full Red, and Blood Red, and 101 black-eyed guppies from six strains: Ivory White, Red Dot, Brazilian Red Fan, Ice Blue, Blue Dress, and Yellow Tiger. Genotype identification revealed that both loci in all black-eyed guppies were wild-type. Of the 142 red-eyed guppies, 141 were found to have the aforementioned genetic variants: 86 were homozygous for the OCA2 gene mutation and all were wild-type homozygous for the TYR gene; 52 were homozygous for the TYR gene mutation, 10 of which were also heterozygous for the OCA2 gene wild-type, and the remaining 42 were homozygous for the OCA2 gene wild-type; and 3 were homozygous for both the OCA2 gene mutation and the TYR gene mutation. The phenotype and genotype consistency of all individuals was 99.6%. There was one red-eyed individual sample with a phenotype and genotype that did not match, which was presumably caused by accidental factors such as recording errors or sample contamination.
[0040] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A primer set for detecting the genotype of the OCA2 gene in guppy fish, characterized in that: The primer set includes three primers shown in SEQ ID NO: 1-3.
2. A primer pair for detecting the genotype of the TYR gene of guppy fish, characterized in that: The primer pair includes two primers shown in SEQ ID NO: 4-5.
3. A primer combination for detecting the genotype of eye color traits of guppies, characterized in that: The primer combination includes the primer set according to claim 1 and / or the primer pair according to claim 2.
4. A detection reagent or kit containing the primer combination according to claim 3.
5. Use of the primer combination according to claim 3 or the detection reagent or kit according to claim 4 in identifying the eye color genotype of guppy.
6. A method for detecting the genotype of eye color traits of guppies, characterized in that: The following steps are involved: (1) Extracting genomic DNA of the guppy to be tested; (2) using the DNA extracted in step (1) as a template, and performing PCR amplification using the primer set of claim 1 and / or the primer pair of claim 2; (3) Analyze the PCR amplification products.
7. The method according to claim 6, characterized in that The OCA2 gene genotype was detected by agarose gel electrophoresis, and the TYR gene genotype was detected by Sanger sequencing.
8. The method according to claim 7, characterized in that The OCA2 gene genotype was determined as follows: heterozygous individuals with the wild-type OCA2 gene showed two bands, 889 bp and 581 bp; homozygous individuals with the wild-type OCA2 gene showed only one band, 889 bp; and homozygous individuals with the OCA2 gene mutation corresponding to the red-eye mutation showed only one band, 581 bp. The TYR gene genotype was determined as follows: if a C base deletion occurred at position 538 of the PCR amplification product, the individual was homozygous for the TYR gene mutation corresponding to the red-eye mutation type; if there was no C base deletion at this site, the individual was wild-type; if the sequencing results at and after this site were a single peak, the individual was homozygous for the wild-type TYR gene; if the sequencing results after this site showed overlapping peaks, the individual was heterozygous for the wild-type TYR gene.
9. The method according to claim 8, characterized in that The PCR amplification system for detecting the OCA2 genotype was as follows: 2× Taq PCR Mix 10 μL, 10 pmol / μL of primers shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 (0.5 μL, 0.25 μL, and 0.25 μL, respectively), DNA template 1 μL, and ddH2O 8 μL. The PCR amplification program was as follows: 95°C for 5 min; 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and 72°C for 5 min. The PCR amplification system used to detect the TYR gene genotype was as follows: PCR amplification system: 2× Taq PCR Mix 10 μL, 10 pmol / μL primers shown in SEQ ID NO: 4 and SEQ ID NO: 5, 0.5 μL and 0.5 μL, respectively, DNA template 1 μL, ddH2O 8 μL; PCR amplification program: 95°C 5 min; 95°C 30 s, 50°C 30 s, 72°C 1 min, 35 cycles; 72°C 5 min.
10. Use of the method according to any one of claims 6 to 9 in identifying the genotype of eye color traits in guppies.