TaIMPA1 gene and application thereof in improving plant genetic transformation efficiency

Abstract

The invention discloses a TaIMPA1 gene and application of the TaIMPA1 gene in improvement of plant genetic transformation efficiency. The nucleotide sequence of the gene is shown as SEQ ID No: 1 in a sequence table. According to the invention, the key gene TaIMPA1 is cloned from a plant body to delivery for the first time, and the genetic transformation performance is enhanced by remarkably improving the delivery efficiency of exogenous DNA (Deoxyribose Nucleic Acid). The discovery fills up the research blank of plant endogenous delivery regulatory factors, and an original solution is provided for overcoming the core problem of genotype dependence.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to TaIMPA1 Genes and their applications in improving the efficiency of plant genetic transformation. Background Art

[0002] As a key technology and foundational component of biobreeding, transgenic technology has become a strategic priority for strengthening the international competitiveness of agriculture and striving for a technologically advanced future in the agricultural sector. The key to its success lies in the establishment of efficient genetic transformation systems. Genotype dependence has long been a bottleneck in plant genetic transformation, and genetic transformation in model plants such as tobacco, Arabidopsis, and rice also exhibits strong genotype dependence, limiting the breadth and depth of genetic improvement of high-quality crop varieties using transgenic technology. With the increasing maturity and widespread application of transgenic and gene editing technologies, addressing the challenge of genotype dependence has become increasingly urgent.

[0003] The complex process of plant genetic transformation usually covers two key stages: the precise delivery of genetic elements and the effective regeneration of the plant body. Among them, the delivery of genetic elements is the primary challenge of genetic transformation, and this bottleneck directly restricts the efficiency of the entire transformation process. Traditional genetic element delivery is mainly mediated by Agrobacterium and gene guns. Its technology is mature and widely used, but it also has constraints such as low efficiency, small carrying capacity and species restrictions. By optimizing Agrobacterium strains, improving binary, super-binary and ternary vector systems that introduce additional Vir gene auxiliary plasmids, the efficiency of genetic element delivery and genetic transformation can be improved. The Nobel Institute in the United States discovered that the T3SS gene can be normally expressed in Agrobacterium and can be used to deliver T3Es or plant protein H2A-1 into plant cells, thereby improving the efficiency of Agrobacterium-mediated plant genetic transformation. The field of plant regeneration has been a research hotspot in recent years and is currently the main technical means to expand the range of plant genetic transformation receptor genotypes. Corteva (formerly DuPont Pioneer) in the United States was the first to use key genes for plant stem cell development Bbm ( Baby boom )and Wus2 ( Wuschel2 ) has successfully improved the genetic transformation efficiency of multiple commercial corn inbred lines and expanded the genotype range of corn genetic transformation. Bbm and Wus2A method for obtaining transgenic and gene-edited plants using leaves was established and verified in nine grass plants, including barley, corn, rice, and ryegrass. Jorge Dubcovsky and others from the University of California, Davis found that GRF-GIF fusion protein can greatly improve the regeneration efficiency of monocotyledonous and dicotyledonous plants such as wheat, rice, and citrus. Wang Ke's research team at the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences has been committed to the establishment of a wheat genetic transformation technology system and the mining of regeneration genes, and found TaWOX5 The gene can greatly improve the genetic transformation efficiency of wheat and expand the range of wheat genetic transformation genotypes. The use of this gene can also significantly improve the genetic transformation efficiency of monocotyledonous plants such as barley, triticale, rye, cultivated einkorn and corn. This gene has been patented in China, the United States and Australia, and has been successfully licensed to Japan Tobacco / Zhonghua Company, France Limagrain Company and China Quanmai Agricultural Technology Co., Ltd. (Shandong) and other units. Li Chuanyu's team at Shandong Agricultural University identified for the first time the original injury signal molecule that induces plant regeneration-regeneration factor REF1, and systematically revealed the signal transduction network that REF1 regulates tissue repair and organ regeneration. By applying REF1 externally, not only can the regeneration ability and genetic transformation efficiency of tomatoes be significantly improved, but also the regeneration ability and genetic transformation efficiency of crops such as soybeans, wheat and corn can be greatly improved. In addition, studies have reported that TaDOF5.6 、 TaDOF3.4 and TaLAX1 Isogenic genes can also significantly improve the efficiency of genetic transformation in plants. Summary of the Invention

[0004] The object of the present invention is to provide TaIMPA1 Genes and their applications in improving the efficiency of plant genetic transformation.

[0005] A sort of TaIMPA1 gene, the TaIMPA1 The polynucleotide of the gene is shown as (a), (b), (c) or (d): (a) the polynucleotide shown in SEQ ID No: 1 in the sequence listing; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, wherein the protein encoded by the polynucleotide still has the function of improving the efficiency of plant genetic transformation; (c) a polynucleotide having at least 90% homology with the polynucleotide represented by SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of improving the efficiency of plant genetic transformation.

[0006] A TaIMPA1 protein, wherein the amino acid sequence of the TaIMPA1 protein is shown in (a), (b) or (c): (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% or more identity with the amino acid represented by SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids in the protein shown in SEQ ID No: 2, and the protein still has the function of improving the efficiency of plant genetic transformation.

[0007] The plant is a wheat or avena plant; the wheat plant is wheat, and the avena plant is oats. Preferably, the wheat is Zhengmai 7698, Aikang 58, Kenong 199, Jimai 22, or Jing 411; and the oats are Mufeng, Zhongyan No. 1, or Galileo.

[0008] Contains the TaIMPA1 Recombinant gene vector.

[0009] Contains the TaIMPA1 Engineering bacteria with recombinant gene vectors.

[0010] Contains the TaIMPA1 Gene-transgenic plant cell lines.

[0011] Detection TaIMPA1 Primers for any fragment of the gene.

[0012] described TaIMPA1 Application of genes in improving the efficiency of plant genetic transformation.

[0013] A method for improving the transformation efficiency of nucleic acid molecules into plants, comprising: TaIMPA1 The gene is introduced into the plant via a plant expression vector.

[0014] The plant expression vector is pWMB110 vector.

[0015] A novel method for improving the efficiency of plant genetic transformation, characterized in that the method comprises simultaneously introducing a gene for improving delivery efficiency and a gene for improving regeneration ability into a plant via a plant expression vector; the gene for improving delivery efficiency is TaIMPA1 Gene; The gene that improves regeneration ability is TaWOX5 Gene.

[0016] Beneficial effects of the present invention: The present invention constructs pWMB110- TaIMPA1 、pWMB110- TaIMPA1-TaWOX5 、pWMB110- Ruby、pWMB111- TaWOX5 、pWMB110-SpCas9- TaIMPA1 Gene editing vectors were respectively transformed into Agrobacterium C58C1. TaIMPA1 Gene editing vectors were created by Fielder TaIMPA1 Then, pWMB110- Ruby Agrobacterium, pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1 、pWMB110- Ruby Agrobacterium and pWMB111- TaWOX5 and pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1-TaWOX5 The mixed bacteria were introduced into wheat and TaIMPA1 The mutants were obtained and the transient infection efficiency was statistically analyzed. Finally, the transgenic positive plants were obtained and the transformation efficiency was statistically analyzed. The results showed that TaIMPA1 Among the mutants of the gene, pWMB110- Ruby The transient infection efficiency of Agrobacterium was seriously reduced when pWMB110- TaIMPA1 or pWMB110- TaIMPA1-TaWOX5 When the infection rate was 1.5%, the transient infection efficiency could be restored to the control level. TaIMPA1 The gene seriously affects the transient infection efficiency. In Fielder, pWMB110 -Ruby Compared with Agrobacterium C58C1 infection, pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1 The transient and genetic transformation efficiency of wheat was greatly improved after infection with mixed bacteria. Ruby Agrobacterium and pWMB110- TaIMPA1-TaWOX5 The mixed bacteria had the highest instantaneous infection efficiency and final genetic transformation efficiency. TaIMPA1 The gene can improve the final transformation efficiency of plants by improving the delivery efficiency. Ruby Vector / Agrobacterium C58C1 and pWMB110- TaIMPA1-TaWOX5 Agrobacterium infection of oats, the results showed that with pWMB110- Ruby Compared with Agrobacterium C58C1 infection, infection with pWMB110- TaIMPA1-TaWOX5 The genetic transformation efficiency of oats infected with Agrobacterium was significantly improved. TaIMPA1 Genes can improve the final transformation efficiency of plants by increasing delivery efficiency; TaIMPA1 Gene solution delivery, TaWOX5 Gene solution to regeneration, TaIMPA1 and TaWOX5 The best effect is achieved when used together and they can be used to overcome genotype limitations in plant transformation, especially in wheat, most notably oats or wheat. TaIMPA1 and TaWOX5 The gene can be mixed with the target gene in different vectors and then transformed with the target gene to promote the transformation efficiency of the target gene and expand the genotype range. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 For pWMB110- TaIMPA1 Schematic diagram of the vector.

[0018] Figure 2 For pWMB110- TaIMPA1-TaWOX5 Vector diagram 。

[0019] Figure 3 pWMB110-SpCas9- TaIMPA1 Schematic diagram of the vector.

[0020] Figure 4 Homozygous mutant sequences for frameshift mutations were generated simultaneously for the A, B, and D genomes.

[0021] Figure 5 TaIMPA1 Comparison of regeneration capacity between gene mutants and controls.

[0022] Figure 6 TaIMPA1 Effect of genes on transient delivery efficiency. DETAILED DESCRIPTION

[0023] To facilitate understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0024] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0025] The plasmids and strains described in the following examples are intended only to further illustrate the present invention and are not intended to limit the scope of the present invention. Where specific experimental conditions are not specified, those familiar to those skilled in the art were used according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

[0026] The plasmids and strains mentioned in the experimental examples are from the following sources: The plant expression vectors pWMB110 and pWMB110-Cas9 are described in the following literature: Liu et al. 2020 Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium -mediated CRISPR system. Journal of Experimental Botany, 71:1337-1349. The name in this document is plasmid pWMB110 , or you can buy it through regular channels.

[0027] Plant expression vectors pWMB110-Ruby, pMB110-GUS Hezhongyan No. 1 is described in the following references: Shi K, Huang WH, Zhu MX, Teng SZ, Zhang JL, Duan ZZ, Zhu CC, Hu T, Wang K, Wang Z. Efficient genetic transformation and genome editing via an Agrobacterium ‐mediated in commercial oat( Avena sativa L.) cultivars. Journal of Integrative Plant Biology, 2025, 67(7): 1697-1699.

[0028] Escherichia coli TOP10: a commercial product of Beijing Quanshijin Company; Escherichia coli PRK2013 and preserved by this laboratory, both are commercial products.

[0029] Plant expression vectors pWMB111-TaWOX5Zhengmai 7698, Aikang 58, Kenong 199, Jimai 22 and Jing 411 are all recorded in the following literature: Wang et. al 2022 The gene TaWOX5 overcomes genotype dependencyin wheat genetic transformation. Nature Plants, 8:110-117, Zhengmai 7698, Aikang 58, Kenong 199, Jimai 22 and Jing 411 can also be purchased through conventional channels.

[0030] The pWMB123 vector and helper bacteria PRK2013 are described in the following document: Wang et al. Al 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties Plant biotechnology journal 15:614-623, and are referred to as the pWMB123 vector in this document.

[0031] Agrobacterium rhizogenes C58C1 is described in the following literature: Wang et al. 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacterium -mediated co-transformation strategy in commercial Chinese wheat varieties Plantbiotechnology journal 15:614-623, and can also be purchased through conventional channels.

[0032] Example 1, wheat TaIMPA1 Functional verification of genes in wheat 1. Wheat TaIMPA1 Gene cloning and transgenic vector construction Design primers: TaIMPA1 F: TGCAGGTCGACTCTAGAGGATCCATGCCGCAGACGC CATC (SEQ ID No: 4); TaIMPA1R: ACGATCGGGGAAATTCGAGCTCCTAGTTTGTGGAGGTGG AGCAAG (SEQ ID No: 5).

[0033] The genomic DNA of wheat line CB037 was extracted as a template and the above primers were used to TaIMPA1 F and TaIMPA1 R was amplified by AS-PCR to obtain a PCR product (SEQ ID No: 3) for future use; BamH I and Sac The pWMB110 vector was digested with restriction endonuclease I to obtain a linearized vector.

[0034] The PCR product and the linearized vector were connected by infusion method, and the reaction solution was transformed into Escherichia coli Top10. After resistance screening and sequencing, the plasmid with the correct sequencing was named pWMB110- TaIMPA1 Vector ( Figure 1 ). TaIMPA1 The strain was named pWMB110- TaIMPA1 / E. coli Top 10, spare.

[0035] TaIMPA1 The coding region of the gene is 1605 bp long and encodes 534 amino acids. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2. The protein is named TaIMPA1 protein.

[0036] according to TaIMPA1 The gene sequence design base was used as a template and primers (UBIF: AAACGACGGCCAGTGCCAAGCTTGCAGCGTGACCCGGTCGTG; SEQ ID No: 6; Nos R: CTGCACTGCAGGCATGCAAGCTTGATCTAGTAACATAGATGA; SEQ ID No: 7), the entire UBI-TaWOX5-NOS was amplified and compared with Hind pWMB110- TaIMPA1 The vector was subjected to infusion connection to obtain pWMB110- TaIMPA1-TaWOX5 Vector ( Figure 2 Due to the edited sgRNA sequence (AGAGCGAAGCCCTCCAATTGAGG; SEQ ID No: 8), according to Liu et. al2020 Efficient induction of haploid plants in wheat by editing of TaMTL usingan optimized Agrobacterium -mediated CRISPR system. Journal of Experimental Botany, 71:1337-1349. A gene-editing vector was constructed using the first round of PCR: 3 ng of TaU3 plasmid was used as template, and four primers (0.1 μM each) were used in a single reaction: UF (CTCCGTTTTACCTGTGGAATCG; SEQ ID No: 9), gR-R (CGGAGGAAAATTCCATCCAC; SEQ ID No: 10), IMPAF (GAGCGAAGCCCTCCAATTGgttttagagctagaaat; SEQ ID No: 11), and IMPAR (CAATTGGAGGGCTTCGCTCTGCTTCTTGGTGCCGCGCCTCC; SEQ ID No: 12). 35 cycles were performed: 94°C for 10 s, 58°C for 15 s, and 68°C for 20 s. Then, a second round of PCR was performed: 1 μl of the first-round PCR product was diluted 10-fold with H2O, and 1 μl was used as a template using primers ZWHind-UF (CTGCACTGCAGGCATGCAAGCTTAGTATGGAATCGGCAGCA AAGG; SEQ ID No: 13) and ZWHindR (AAACGACGGCCAGTGCCAAGCTTACGCGTATCCATCCACTCCAAGCTCTTG; SEQ ID No: 14). 35 cycles were performed: 94°C for 10s, 58°C for 15s, and 68°C for 20s. The product was run on a gel and purified. The product was then separated and compared with the sample. Hind The pWMB-110-Cas9 vector digested with III enzyme was infused with enzyme to generate pWMB-110-Cas9- TaIMPA1 Vector ( Figure 3 ).

[0037] 2. Transform the recombinant plasmid into Agrobacterium rhizogenes C58C1 1) Cultivate Agrobacterium rhizogenes C58C1 (abbreviated as Agrobacterium C58C1) in a 4 ml tube of LB medium containing Rif (rifampicin) and Gen (gentamicin) at 180 rpm at 28°C for 40 h to obtain an Agrobacterium C58C1 bacterial suspension. Cultivate the above-mentioned vector-carrying Escherichia coli Top10 and helper bacteria PRK2013 in 4 ml tubes of LB medium containing Kan (kanamycin) at 225 rpm at 37°C for 16 h to obtain the above-mentioned vector-carrying Escherichia coli Top10 and helper bacteria PRK2013 bacterial suspensions. 2) Add 100 μl each of the Agrobacterium C58C1 culture, the carrier E. coli Top10, and the helper bacteria PRK2013 to a 1.5 ml centrifuge tube and mix thoroughly to obtain mixed bacterial solution 1 (target bacteria). 3) Discard the supernatant and aspirate the remaining supernatant with a pipette. Add 50 μl of LB medium without antibiotics and resuspend the cells to obtain the resuspended cells of the target bacteria. 4) Use a pipette to add the resuspended cells of the target bacteria to the LB solid medium without antibiotics. Do not shake the plate to allow the cells to form a ball. After the plate is dry, seal it with sealing film and culture it at 28°C for 24 h to obtain the Agrobacterium cells of the target bacteria. Use an inoculation needle to pick up a small amount of cells from the Agrobacterium cell pellet of the target bacteria and inoculate it in a medium containing Rif (50 mg L -1 )、Gen(50 mg L -1 )、Kan(50 mg L -1 ) on LB solid medium and cultured at 28°C for 48 h to obtain a triparental hybridization plate.

[0038] 6) Single colonies were picked from the triparental hybridization plates and PCR-verified for positive Agrobacterium strains, i.e., the target vector / Agrobacterium C58C1 (using their genomic DNA as templates and the detection primers for each vector mentioned above for PCR, to screen for positive Agrobacterium strains).

[0039] 3. Agrobacterium-mediated transformation of wheat The detailed steps and methods refer to Wang et al., 2022 and are as follows: 1) 4 days before infection, inoculate Agrobacterium containing target gene into 50 mg / L medium containing Gentamycin, 50 mg / L medium, and 50 mg / L medium respectively. -1 、Kana 50 mg L -1 , Rif (rifampicin), 50 mg L -1 The cells were cultured on YEP solid medium at 28℃ in the dark for 3 days. A single colony was picked and placed in 10 ml of Gent 50 mg L -1 、Kana 50 mg L -1 、Rif 50 mg L -1 The culture was shaken overnight in YEP liquid medium at 200 rpm and 28°C in the dark to obtain activated bacterial solution. The concentration of the Agrobacterium containing the target gene was adjusted to OD 600 =0.6.

[0040] 2) Collect Agrobacterium cells by centrifugation at 3,500 rpm for 10 min at room temperature, discard the supernatant, and resuspend in MS medium [(1 / 10 MS basic medium (Beijing Ximeijie Technology Co., Ltd., product number: M519, glucose 10 g L -1 )] Resuspend the bacterial pellet to obtain Agrobacterium resuspensions containing the target gene (all mixed bacterial solutions were mixed at a ratio of 1:1).

[0041] 3) Select wheat embryos of different varieties about 14 days after flowering, infect them with Agrobacterium resuspension containing the target gene, and then spread them on AS basic co-culture medium (1 / 10 MS basic culture medium, glucose 10 g L -1 , agar 8 gL -1 ) and cultured at 25℃ for 3 days.

[0042] 4) Transfer the co-cultured embryos to the recovery medium WLS-RES (MS basic medium, 2,4-D 0.5 mg / L -1 , picloram 2.2 mg L -1 , Cb (carbenicillin) 400 mg L -1 , Cef (cephalosporin) 100 mg L -1 ) and cultured in darkness for 5 days.

[0043] 5) After recovery, transfer the immature embryos to the first screening medium WLS-P5 (MS basic medium, 2,4-D 0.5 mg L -1 , picloram 2.2 mg L -1 , PPT (glufosinate) 5 mg L -1 , Cb 400 mg L -1 , Cef 100 mg L -1 ) were cultured in darkness for 14 days.

[0044] 6) The calli were then transferred to the first screening medium WLS-P10 (MS basic medium, 2,4-D 0.5 mg / L -1 , picloram 2.2 mg L -1 , PPT 10 mg L -1 , Cb 400 mg L -1 ) were cultured in darkness for 21 days.

[0045] 7) Transfer the above callus to differentiation medium LSZ-P5 (MS basic medium, PPT 5 mg L -1 ) and cultured under light for 2 weeks.

[0046] 8) Separate the wheat green shoots and place them on rooting medium MSF-P5 (MS medium, PPT 5 mg L -1 、IBA 0.5mg L -1 ) and cultured for 21 days. Once the roots have fully grown, the seedlings are transplanted into soil to obtain transgenic plants expressing the target gene. Transgenic testing is then performed, and the number of positive plants is counted.

[0047] 4. TaIMPA1 Gene editing mutant acquisition and TaIMPA1 Effects on plant regeneration ability Design A, B, and D genomes respectively TaIMPA1 We used specific primers for the gene, performed PCR-RE detection and sequencing, and finally obtained three plants with mutations in the A, B, and D genomes. Because some mutants have 3bp deletions that cannot cause frameshift mutations, we finally screened out a homozygous mutant with frameshift mutations in the A, B, and D genomes ( Figure 4 ).

[0048] We conducted a comparative experiment on the regeneration ability of immature embryos of Fielder wheat and its mutants ( Figure 5 a). The results showed that during the callus induction stage, the control (CK) and TaIMPA1 The callus induction rates of the mutant embryos were 91.2% and 92.3% ( Figure 5 b); After 3 weeks of culture, the callus was transferred to differentiation medium, and Fielder and TaIMPA1 The plant regeneration efficiencies of the mutants were 86.4% and 89.1%, respectively ( Figure 5 c). Statistical analysis showed that there was no significant difference between Fielder and the mutant in either callus induction efficiency or plant regeneration efficiency. Therefore, we concluded that: TaIMPA1 The gene mutation did not affect the regeneration ability of wheat tissue.

[0049] TaIMPA1 Effects of genes on transient delivery efficiency The wheat variety Fielder and its triple mutant edited lines ( TaIMPA1-abd ) were used as control and experimental materials. The experiment set up 4 groups of vector treatments: 1) pWMB110- Ruby Vector as a control; 2) pWMB110- Ruby Respectively with pWMB110- TaWOX5 、pWMB110- TaIMPA1 and pWMB110- TaIMPA1-TaWOX5 Wheat immature embryos were co-transformed at a ratio of 1:1. The gene delivery efficiency was calculated by counting the number of immature embryos that appeared red after 5 days of culture in the recovery medium. Figure 6 ).

[0050] In the Fielder variety, pWMB110- Ruby The delivery efficiency is 61.4±1.0%. TaWOX5 When genes Ruby The gene delivery efficiency was slightly reduced to 58.7±1.2%, which may be related to the dilution of Ruby vector concentration in Agrobacterium. TaIMPA1 The gene delivery efficiency was increased to 65.4±1.2%, while TaIMPA1 and TaWOX5 When co-expressed, the delivery efficiency was significantly increased to 84.5 ± 0.8%, indicating that the two genes had a synergistic effect (Table 1).

[0051] In the mutant, the delivery efficiency of pWMB110-Ruby was significantly reduced to 40.6±2.0%, but by introducing TaIMPA1 The gene can restore it to more than 60%, reaching an efficiency level comparable to Fielder, confirming TaIMPA1 It is a key factor affecting the efficiency of gene delivery (Table 1).

[0052] Table 1 TaIMPA1 Genes in Fielder and TaIMPA1-abd Effects of mutants on transient infection efficiency

[0053] two, TaIMPA1 Effects of genes on genetic transformation efficiency Transformation efficiency = (positive seedlings / number of embryos) * % To further verify TaIMPA1 To investigate the function of the control vector, we introduced pMB110-GUS (control), pMB110-TaIMPA1, and pWMB110-TaIMPA1-TaWOX5 into immature embryos of Zhengmai 7698, Aikang 58, Kenong 199, Jimai 22, and Jing 411. The results showed that the control vector (pMB110-GUS) achieved an efficiency of approximately 18% in Zhengmai 7698 and Kenong 199, two easily transformed varieties, while the efficiency in the other three difficult-to-transform varieties was extremely low, not exceeding 5%. TaIMPA1 After the experiment, the transformation efficiency of Zhengmai 7698 and Kenong 199, two varieties that are easy to transform, was significantly increased to over 45%, and the transformation efficiency of the other three varieties that are difficult to transform was also significantly increased to over 20%. TaIMPA1 and TaWOX5 When used in combination, the transformation efficiency of the two easily transformed varieties was further increased to more than 60%, and the transformation efficiency of the three difficult-to-transform varieties was further significantly increased to 27-30% (Table 2).

[0054] Table 2 TaIMPA1 Effects of genes on wheat genetic transformation efficiency

[0055] This result fully proves that TaIMPA1 The ability to genetically transform wheat can be enhanced by improving gene delivery efficiency. TaIMPA1 and TaWOX5 The synergistic effect of the two strategies can simultaneously optimize the delivery and regeneration processes. Therefore, this combined strategy is expected to become a key technical solution to break the bottleneck of wheat genotype-dependent transformation.

[0056] Example 2 TaIMPA1-TaWOX5 Application of Gene Combinations in Oat Transgenics 1. Agrobacterium-mediated transformation of oats The detailed steps and methods refer to Shi et al., 2025 and are as follows: 1) 4 days before infection, the above-mentioned pWMB110- TaIMPA1-TaWOX5 Vector / Agrobacterium and pWMB110- Ruby The vector / Agrobacterium were inoculated into 50 mg L Gent -1 、Kana 50 mg L -1 、Rif 50 mg L -1 The cells were cultured on YEP solid medium at 28℃ in the dark for 3 days. A single colony was picked and placed in 10 ml of Gent 50 mg L -1 、Kana 50mg L -1 、Rif 50 mg L -1 YEP liquid medium, 200 rpm, 28 ℃ in the dark overnight shaking culture, respectively, to obtain the activated bacterial solution, pWMB110- TaIMPA1-TaWOX5 Vector / Agrobacterium C58C1 and pWMB110- Ruby Adjust the OD value of the vector / Agrobacterium C58C1 bacterial solution to OD value. 600 =0.6.

[0057] 2) Agrobacterium cells were collected by centrifugation at 3,500 rpm for 10 min at room temperature, the supernatant was discarded, and the cells were resuspended in MS medium [(1 / 10 MS basic medium (Beijing Ximeijie Technology Co., Ltd., product number: M519, glucose 10 g L -1 )] Resuspend the bacterial pellet and obtain pWMB110- Ruby Vector / Agrobacterium infection resuspension and obtain pWMB110- Ruby and pWMB110- TaIMPA1-TaWOX5 The resuspension was infected with a 1:1 mixture of vector and Agrobacterium.

[0058] 3) Select immature oat embryos approximately 14 days after anthesis. Aseptically sterilize the immature seeds with 75% ethanol for 1 minute, 5% sodium hypochlorite for 5 minutes, and finally rinse ten times with sterile water. Isolate the embryos from fresh immature embryos and incubate them with the Agrobacterium-infected suspension in co-cultivation liquid medium (L3 basal salts with 4.5917 g / L vitamins, 100 mg / L inositol, 30 g / L maltose, 420 mg / L L-asparagine, 100 μM acetosyringone, and 2.5 mg / L 2,4-D, pH 5.6-5.8) at room temperature for 5 minutes. The embryos are then transferred to solid co-cultivation medium (co-cultivation liquid medium supplemented with 4 g / L phytagel) and incubated at 25°C in the dark for 2 days.

[0059] 4) After co-cultivation, the remaining embryonic tissue was transferred to selective recovery medium plates (L3 basal salts with 4.5917 g / L vitamins, 100 mg / L inositol, 30 g / L maltose, 420 mg / L L-asparagine, 2.5 mg / L 2,4-D, 200 mg / L timentin, 4 g / L phytagel, pH 5.6-5.8). Five days later, the cells were transferred to the first screening medium (L3 basal salts with 4.5917 g / L vitamins, 100 mg / L inositol, 30 g / L maltose, 420 mg / L L-asparagine, 2.5 mg / L 2,4-D, 200 mg / L timentin, 5 mg / L glufosinate, 4 g / L phytagel, pH 5.6-5.8) and cultured for 21 days. During this period, the long shoots were removed and only the base of the callus was retained. The calli were then cultured on a secondary screening medium with a glufosinate concentration of 10 mg / L for 21 days. Embryogenic calli were then transferred to fresh differentiation medium (L3 basal salts with 2.296 g / L vitamins, 200 mg / L timentin, 5 mg / L glufosinate, 3 g / L Phytagel, pH 5.6-5.8) and induced to differentiate under a light intensity of 100 μmol m⁻² s⁻¹ and 25°C. Subcultures were performed every two weeks until regenerated shoots appeared. Finally, the shoots were transferred to culture cups containing rooting medium (L3 basal salts with 2.296 g / L vitamins, 20 g / L sucrose, 5 mg / L glufosinate, 4 g / L Phytagel, pH 5.6-5.8) to promote elongation and rooting.

[0060] 5) After the roots have grown well, the seedlings are transplanted into the soil to obtain transgenic seedlings with the target gene.

[0061] 2. Statistical analysis of conversion efficiency Transformation efficiency = (positive seedlings / number of embryos) * % The results are shown in Table 3. The control vector pWMB110- Ruby The transformation efficiency in Mufeng was 8.57%, while no transgenic plants were obtained in Zhongyan No. 1 and Galileo; pWMB110- TaIMPA1-TaWOX5 The vector can greatly improve the genetic transformation efficiency of oats, pWMB110- TaIMPA1-TaWOX5 The transformation efficiency of the vector in Mufeng, Zhongyan No. 1 and Galileo was significantly increased to 19.23%, 14.63% and 34.15% respectively.

[0062] Table 3 Control vector and TaIMPA1 Comparison of transformation efficiency of vectors in oats

[0063] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A TaIMPA1 A gene characterized by described TaIMPA1 The polynucleotide of the gene is shown as (a), (b), (c) or (d): (a) the polynucleotide shown in SEQ ID No: 1 in the sequence listing; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, wherein the protein encoded by the polynucleotide still has the function of improving the efficiency of plant genetic transformation; (c) a polynucleotide having at least 90% homology with the polynucleotide represented by SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of improving the efficiency of plant genetic transformation.

2. A TaIMPA1 protein, characterized in that The amino acid sequence of the TaIMPA1 protein is shown in (a), (b) or (c): (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% or more identity with the amino acid represented by SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids in the protein shown in SEQ ID No: 2, and the protein still has the function of improving the efficiency of plant genetic transformation.

3. according to claim 1 TaIMPA1 The gene or the TaIMPA1 protein according to claim 2, characterized in that The plant is a wheat or a oat plant; the wheat plant is wheat, and the oat plant is oat.

4. Containing the claim 1 TaIMPA1 Recombinant gene vector.

5. Containing the method according to claim 3 TaIMPA1 Engineering bacteria with recombinant gene vectors.

6. Containing the claim 1 TaIMPA1 Gene-transgenic plant cell lines.

7. The method according to claim 1 TaIMPA1 Application of genes in improving the efficiency of plant genetic transformation.

8. A method for improving the transformation efficiency of nucleic acid molecules into plants, characterized in that: The method comprises the step of: TaIMPA1 The gene is introduced into the plant via a plant expression vector.

9. The method according to claim 8, characterized in that The plant expression vector is pWMB110 vector.

10. A new method for improving the efficiency of plant genetic transformation, characterized in that: The method comprises simultaneously introducing a gene for improving delivery efficiency and a gene for improving regeneration ability into a plant through a plant expression vector; the gene for improving delivery efficiency is TaIMPA1 Gene; The gene that improves regeneration ability is TaWOX5 Gene.

Images