Molecular marker located in chromosome 2 and related to yield of medicago sativa and application of molecular marker

Abstract

The invention belongs to the technical field of molecular markers, and discloses an InDel molecular marker located in a chromosome 2 and related to the yield of medicago sativa and application of the InDel molecular marker. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.4 or SEQ ID NO.5, the sequence of an upstream primer of a primer pair for amplifying the molecular marker is shown as SEQ ID NO.1, and the sequence of a downstream primer of the primer pair is shown as SEQ ID NO.2. The invention further discloses an application of the InDel molecular marker. The molecular marker is located on a chromosome 2 of medicago sativa, and the nucleotide sequence of an insertion or deletion fragment of the molecular marker is shown as SEQ ID NO.3 in a sequence table. The InDel molecular marker and the primer pair provided by the invention can be used for predicting, identifying or assisting in identifying the yield traits of medicago sativa. Meanwhile, the invention further provides a method for identifying the alfalfa yield character by using the InDel molecular marker, and the method is simple, convenient and rapid, accurate in identification result and good in popularization and application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an InDel molecular marker located on chromosome 2 and related to alfalfa yield and its application. Technical Background

[0002] The rapid development and increased demand for animal husbandry in my country have led to a shortage of high-quality forage. How to meet the demand for high-quality forage in the animal husbandry industry is an urgent problem that needs to be solved. Alfalfa (Medicago sativa L.), due to its long history of cultivation and strong adaptability, is cultivated throughout Eurasia and countries around the world, becoming one of the most widely planted forages in the world, earning the reputation of "King of Forage" and having high economic benefits. With the continuous improvement of people's living standards, the demand for ruminant products such as meat and milk is expected to increase significantly in the future, and the demand for high-quality forage, especially alfalfa, will also increase greatly. Therefore, cultivating new high-yield and high-quality alfalfa materials is of great significance to increasing the yield of alfalfa and promoting the development of the forage industry and animal husbandry.

[0003] Most alfalfa species have complex genetic backgrounds, and the speed of cultivating new varieties using traditional breeding methods is very slow. With the continuous development and improvement of modern biogenetic technology, scholars are paying more and more attention to the use of molecular marker technology to assist genetic breeding to improve breeding efficiency and eliminate blindness in the breeding process. Genome-Wide Association Study (GWAS) can simultaneously detect genetic variations in large-scale populations across the entire genome and associate these variations with specific phenotypic traits. By statistically analyzing the genotype and phenotypic data of large-scale samples, we can help identify genetic markers that are significantly associated with specific traits, and then reveal the genetic basis of trait variation. The present invention uses 258 alfalfa materials to construct a population, resequencing them, and conducting whole-genome association analysis in combination with dry weight traits, and develops an InDel site related to yield. The present invention provides theoretical support and gene resources for high-yield molecular genetic improvement and new material breeding of alfalfa. Summary of the Invention

[0004] One of the objectives of the present invention is to provide an InDel molecular marker related to alfalfa yield.

[0005] A second object of the present invention is to provide an application of the above-mentioned InDel molecular marker located on chromosome 2 and related to alfalfa yield.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention discloses a molecular marker related to alfalfa yield, which is located on chromosome 2 of alfalfa. The molecular marker is named Ms_Chr2_61464064.

[0008] The primer pair for amplifying the above molecular markers has the following sequence:

[0009] Ms_Chr2_61464064-F: GTAGTTAAAAAAATACATTAAGTAAAAAAATTTG (shown in SEQ ID NO. 1);

[0010] Ms_Chr2_61464064-R: ATTAGTAGGCATAATTTTTAAAATTGGATT (shown in SEQ ID NO. 2);

[0011] The present invention also discloses the use of the aforementioned molecular marker primer pair in alfalfa yield-assisted breeding. Specifically, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting the presence of the molecular markers of the present invention, yield-related traits of alfalfa materials can be identified. PCR detection can be used, specifically the aforementioned molecular marker primer pair. Sequencing can also be used.

[0012] The present invention also discloses the application of the molecular markers in identifying alfalfa yield traits, especially in screening and identifying alfalfa with high or low yield. Specifically, the specific steps for identifying whether alfalfa has high-yield traits are as follows:

[0013] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the markers Ms_Chr2_61464064-F and Ms_Chr2_61464064-R were used as primers. The PCR amplification reaction system was as shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 18 s; extension at 72°C for 10 min; and storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 7 μL and judge the alfalfa yield results based on the results of the bands.

[0018] PCR amplification was performed using primer pairs Ms_Chr2_61464064-F and Ms_Chr2_61464064-R. If the PCR amplification product had only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa was a high-yield type; if the PCR amplification product had both a characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa was a low-yield type.

[0019] In addition, the present invention also protects a kit for identifying alfalfa yield traits, comprising the primer pair Ms_Chr2_61464064-F and Ms_Chr2_61464064-R. The other components of the kit are conventional reagents, specifically PCR buffer, dNTPs, and Taq DNA polymerase. The present invention does not particularly limit the concentration of the primer pair; primer concentrations well known in the art may be used. The present invention does not particularly limit the sources of the PCR buffer, dNTPs, and Taq DNA polymerase; conventional PCR amplification reagents well known in the art may be used.

[0020] The kit of the present invention can be used to quickly identify the yield traits of alfalfa and can also quickly identify the yield genotype of alfalfa. The specific method is similar to the method for identifying whether alfalfa has a high-yield trait. The specific steps are: performing electrophoresis detection and / or sequencing on the PCR amplification product. If the PCR amplification product has only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous low-yield genotype.

[0021] The present invention has the following advantages:

[0022] (1) This study used 258 alfalfa accessions to construct a population, resequence them, and conduct genome-wide association analysis in combination with dry weight traits, identifying an InDel locus associated with yield. This study provides theoretical support and genetic resources for molecular genetic improvement of high-yield alfalfa and the selection of new materials.

[0023] (2) Using markers linked to yield traits to screen high-yield alfalfa materials is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, and is conducive to improving efficiency and saving costs.

[0024] (3) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to high-yield breeding practice and material identification of alfalfa in a simple, rapid and high-throughput manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the result of genome-wide association analysis of alfalfa yield, which is a Manhattan plot obtained based on EMMAX software analysis. The green dots indicate the positions of the InDels associated with the present invention.

[0026] Figure 2 This is a box plot of the dry weight distribution corresponding to the genotype of the Ms_Chr2_61464064 locus of the alfalfa population of the present invention; 0 / 0 means that the genotype of the Ms_Chr2_61464064 locus is a homozygous high-yield genotype, and 0 / 1 means that the Ms_Chr2_61464064 locus is a heterozygous low-yield genotype; the dots are extreme values ​​of the data, and **** represents P < 0.0001.

[0027] Figure 3 This is the partial sequence comparison result between high-yield materials and low-yield materials in the yield-related region.

[0028] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 16 alfalfa germplasm resources. The concentration of agarose gel is 2%. DETAILED DESCRIPTION

[0029] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0030] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1 Development of molecular markers related to alfalfa yield

[0033] The present invention measures alfalfa yield by measuring the dry weight of alfalfa at the initial flowering stage (unit: kg). The higher the value, the higher the alfalfa yield; the lower the value, the lower the alfalfa yield. After measuring the dry weight of 258 alfalfa populations, a GWAS analysis was performed to locate an InDel site in alfalfa ( Figure 1 Green site), named Ms_Chr2_61464064. This site is located on chromosome 2 of the alfalfa reference genome (download the file "ZhongmuNo.1_genome.fasta.gz" from the URL: https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960, which is the alfalfa genome sequence). The first allele type is 0 / 0; the second allele type is 0 / 1. The yield distribution box plot corresponding to the genotype of the population Ms_Chr2_61464064 site ( Figure 2 ), indicating that the yield of alfalfa lines with genotype 0 / 0 was significantly higher than that of alfalfa lines with genotype 0 / 1. At position 61464064 on chromosome 2 of alfalfa, the insertion / deletion fragment ATCAGCTATCAATTATAAACTAACTTT (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on alfalfa yield. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is a high-yield alfalfa; the alfalfa without the fragment shown in SEQ ID NO.3 is a low-yield alfalfa.

[0034] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0035] Ms_Chr2_61464064-F: GTAGTTAAAAAAATACATTAAGTAAAAAAATTTG (shown in SEQ ID NO. 1);

[0036] Ms_Chr2_61464064-R: ATTAGTAGGCATAATTTTTAAAATTGGATT (shown in SEQ ID NO. 2);

[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous high-yield alfalfa sample had only a 300bp characteristic band, while the PCR product of the heterozygous low-yield alfalfa sample had both a 300bp characteristic band and a 273bp characteristic band.

[0038] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0039] Using the above molecular markers, 150 germplasms were identified. The specific germplasm materials used are shown in Table 2:

[0040] Table 2 Genotypes and yields of 150 materials based on the Ms_Chr2_61464064 locus

[0041]

[0042]

[0043]

[0044] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0045] The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× SanTaq PCR Mix, and deionized water to 20 μL. The PCR amplification reaction protocol is preferably as follows: 94°C initial denaturation for 5 min; 35 cycles of 94°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 18 s; 72°C extension for 10 min; and storage at 4°C. Separation was performed by electrophoresis on a 2% agarose gel. After spotting, the samples were electrophoresed at 120 V DC for 60 min, and the PCR banding pattern of each sample was determined.

[0046] 2) judging the yield of alfalfa based on the size of the PCR product: if the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, the alfalfa to be identified is low-yield alfalfa;

[0047] When the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is a high-yield alfalfa;

[0048] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, and the band length of the PCR product is 300 bp, the alfalfa to be identified is a high-yield alfalfa.

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, and the band length of the PCR product is 273 bp, the alfalfa to be identified is low-yield alfalfa.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054] Furthermore, as shown in Table 2, of the 150 alfalfa accessions identified in this study, 104 were homozygous high-yield genotypes (0 / 0). The average dry weight of these 104 accessions was 0.28 kg. Forty-six accessions were heterozygous low-yield genotypes (0 / 1). The average dry weight of these 46 accessions was 0.19 kg, lower than the average of the 104 high-yield alfalfa accessions. Analysis of variance showed that the dry weight of the high-yield and low-yield genotypes was significantly different (P < 0.0001). Figure 4 The PCR test results of 16 germplasms (Ladakh, CF039770, CF005602, Xinmu No. 4, CF040664, Nanmu 601, Plato MS, PI641378, CF039784, Longmu 808, CF021077, PI631977, PI631714, Longmu 809, Zhongmu No. 3, and CF039888) are shown. In the figure, the 0 / 0 type material only amplified a 300bp band, which is a homozygous high dry weight genotype, which is consistent with the actual high dry weight results of the first 8 materials; while the 0 / 1 type material amplified both a 300bp band and a 273bp band, which is a heterozygous low dry weight genotype, which is consistent with the actual low dry weight results of the last 8 materials. Therefore, the InDel molecular marker of the present invention can effectively identify the yield traits of alfalfa and can be used for the prediction and screening of high-yield alfalfa materials.

[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 2 and associated with alfalfa yield, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment ATCAGCTATCAATTATAAACTAACTTT on chromosome 2 of the alfalfa reference genome. The sequence of the primer pair for amplifying the molecular marker is: Ms_Chr2_61464064-F: GTAGTTAAAAAAATACATTAAGTAAAAAAATTTG; Ms_Chr2_61464064-R:ATTAGTAGGCATAATTTTTAAAATTGGATT.

2. Use of the primer pair corresponding to the molecular marker described in claim 1 in molecular marker-assisted breeding of alfalfa.

3. The use according to claim 2, characterized in that The molecular marker is used for predicting, identifying or assisting in identifying the yield traits of alfalfa.

4. A method for identifying alfalfa yield, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2), with the specific criteria being: PCR amplification was performed using primer pairs Ms_Chr2_61464064-F and Ms_Chr2_61464064-R. If the PCR amplification product had only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa was a high-yield type; if the PCR amplification product had both a characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa was a low-yield type.

5. A kit for identifying alfalfa yield genotypes, characterized in that: The kit comprises a primer pair corresponding to the molecular marker described in claim 1.

6. The use according to claim 5, characterized in that The method for identifying alfalfa yield genotype using the kit comprises the following steps: (1) Extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 300 bp in length as shown in SEQ ID NO. 4, the alfalfa was a homozygous high-yield genotype; if the PCR amplification product had both one characteristic band of 300 bp in length as shown in SEQ ID NO. 4 and one characteristic band of 273 bp in length as shown in SEQ ID NO. 5, the alfalfa was a heterozygous low-yield genotype.

Images