Application of SNP (Single Nucleotide Polymorphism) molecular marker in close linkage with wheat stripe rust resistance site QYr.cau-2AL
By detecting the SNP1 site polymorphism in the wheat genome, developing the KASP molecular marker, identifying and selecting AA-type homozygous wheat as parents, the problem of unstable wheat stripe rust resistance was solved, a fast and accurate breeding method was achieved, and the disease resistance and breeding efficiency of wheat were improved.
Patent Information
- Application Number
- CN202511059667.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-30
- Publication Date
- 2025-09-19
AI Technical Summary
In the existing technology, wheat stripe rust resistance is unstable, and it is difficult to obtain lasting disease resistance through breeding methods, leading to a pandemic of the disease.
By detecting the polymorphism of SNP1 in the wheat genome, especially the SNP1 sites with nucleotide types of A or G, KASP molecular markers were developed for identification and assisted breeding. AA-type homozygous wheat was selected as the parent for breeding to cultivate wheat resistant to stripe rust.
It enables rapid, accurate and economical selection of stripe rust-resistant wheat, reduces disease pressure, prolongs disease resistance and reduces reliance on fungicides.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_2
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and specifically relates to a wheat stripe rust resistance locus. QYr.cau-2AL Application of tightly linked SNP molecular markers. Background Art
[0002] wheat( Triticum aestivum Wheat stripe rust (L.) is a key food crop. Wheat stripe rust poses a devastating threat to wheat production and is a major biological disaster affecting food security and food safety. It is highly contagious, destructive, and spreads widely and rapidly. Therefore, effectively controlling the occurrence and spread of stripe rust is crucial for ensuring safe wheat production. Planting resistant varieties reduces reliance on fungicides, is both cost-effective and environmentally friendly, and is a long-standing disease control measure used both domestically and internationally.
[0003] More than 500 wheat stripe rust resistance genes or quantitative trait loci (QTLs) have been reported from various wheat varieties and their closely related species, covering all 21 pairs of wheat chromosomes, including 87 officially named resistance genes ( Yr1 to Yr87 ) and dozens of temporary names Yr Genes (Sharma et al. 2024; Klymiuk et al. 2022; McIntosh et al. 2020), and over 400 disease resistance QTLs (Tong et al. 2024; Jan et al. 2021). Some of these genes / locus are race-specific genes that control immune responses or confer complete disease resistance throughout the wheat growth cycle. These resistance genes are easily overcome by new virulent races of stripe rust, rendering them ineffective. Over-reliance on these genes in production can lead to severe stripe rust epidemics. Others are quantitative loci that control disease resistance in adult wheat. Most adult resistance QTLs confer resistance to different stripe rust pathogenic races, demonstrating non-race-specific characteristics. These resistances do not confer complete immunity, significantly reducing directional selection pressure on the pathogen, thereby delaying the emergence of new virulent race mutants and prolonging disease resistance. Summary of the Invention
[0004] The technical problem to be solved by the present invention is how to breed wheat for stripe rust resistance and / or how to improve wheat stripe rust resistance and / or how to breed wheat for disease resistance and / or how to cultivate wheat varieties with durable or stable disease resistance.
[0005] To solve the above technical problems, the present invention first provides the use of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in identifying or assisting in identifying wheat stripe rust resistance. The SNP1 is a single nucleotide polymorphism in the wheat genome, whose nucleotide type is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
[0006] To solve the above technical problems, the present invention also provides the use of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in the preparation and identification of or auxiliary identification of wheat stripe rust resistance products. The SNP1 is a single nucleotide polymorphism in the wheat genome, whose nucleotide type is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
[0007] In order to solve the above technical problems, the present invention also provides the use of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in wheat breeding or in the preparation of wheat breeding products. The SNP1 is a single nucleotide polymorphism in the wheat genome, whose nucleotide type is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
[0008] In the above application, the breeding can be stress resistance breeding. In a specific embodiment of the present invention, the stress resistance breeding is stripe rust resistance breeding, that is, cultivating stripe rust resistant wheat or breeding stripe rust resistant wheat.
[0009] In order to solve the above technical problems, the present invention also provides a method for identifying or assisting in identifying wheat stripe rust resistance, which may include detecting the genotype of the wheat to be tested, and identifying or assisting in identifying the stripe rust resistance of the wheat based on the genotype of the wheat to be tested. The stripe rust resistance of wheat homozygous for SNP1 A may be greater than that of wheat homozygous for SNP1 G. The genotype is the genotype of SNP1 in the wheat genome; SNP1 is a single nucleotide polymorphism in the wheat genome, the nucleotide type of which is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
[0010] In order to solve the above technical problems, the present invention also provides the application of the above method in wheat breeding.
[0011] The above-mentioned breeding can be stress resistance breeding. In a specific embodiment of the present invention, the stress resistance breeding is stripe rust resistance breeding, that is, cultivating stripe rust resistance wheat or breeding stripe rust resistance wheat.
[0012] In order to solve the above technical problems, the present invention also provides a method for wheat breeding, which may include: detecting the polymorphism of the SNP1 site mentioned above in the wheat genome, and selecting homozygous wheat with the SNP1 site in the wheat genome being A as a parent for breeding.
[0013] In the above applications, methods and products, the SNP1 is a single nucleotide polymorphism in the wheat genome, which is associated with the stripe rust resistance QTL on wheat chromosome 2AL. QYr.cau-2AL Tightly linked, it is the 51st nucleotide of SEQ ID No.4, which is A or G. The polymorphism or genotype (i.e., allele) of the detection of the SNP1 site in the wheat genome can specifically be the type of nucleotide for detecting SNP1. The genotype of the SNP1 site in the wheat genome can be GG, AA, or AG. The GG is the homozygous type of the SNP1 site in the wheat genome being G, the AA is the homozygous type of the SNP1 site in the wheat genome being A, and the AG is the heterozygous type of the SNP1 site in the wheat genome being A and G. In the method described above, the identification or auxiliary identification of the stripe rust resistance of wheat based on the genotype of the wheat to be tested can be that the stripe rust resistance of the wheat to be tested with a genotype of AA is higher or is a candidate higher than the stripe rust resistance of the wheat to be tested with a genotype of GG.
[0014] In order to solve the above technical problems, the present invention also provides a product containing a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome, which can be any one of products C1) to C3): C1) Products for detecting single nucleotide polymorphisms or genotypes associated with wheat stripe rust resistance; C2) Products for identifying or assisting in identifying wheat stripe rust resistance; C3) Products used in wheat breeding.
[0015] The SNP1 is a single nucleotide polymorphism in the wheat genome, and its nucleotide type is A or G, which is the 51st nucleotide of SEQ ID No.4 in the sequence list. In the above method or product, the wheat breeding may be the cultivation of stripe rust-resistant wheat or the selection of stripe rust-resistant wheat.
[0016] In the above-mentioned applications, methods, and products, the substance for detecting the polymorphism or genotype (i.e., allele) of SNP1 in the wheat genome can be a reagent and / or instrument required to determine the polymorphism or genotype of SNP1 by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule DNA binding reactions.
[0017] In the above application, method or product, the substance for detecting the polymorphism or genotype of SNP1 in the wheat genome may be the following: D1), D2) or D3): D1) the material for detecting the polymorphism or genotype of SNP1 in the wheat genome contains PCR primers for amplifying a wheat genomic DNA fragment including the SNP1; D2) the substance for detecting the polymorphism or genotype of SNP1 in the wheat genome is a PCR reagent containing the PCR primer; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).
[0018] In the above-mentioned applications, methods or products, the PCR primer may be P1 or P2: P1, the PCR primers are a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 22-40 of SEQ ID No. 1 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-40 of SEQ ID No. 2 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of SEQ ID No. 3 in the sequence listing; P2, the PCR primers are a primer set consisting of the single-stranded DNA shown in SEQ ID No. 1 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing.
[0019] The above-mentioned SEQ ID No. 4 may correspond to the physical position of nucleotides 787,111,531 to 787,111,635 on chromosome 2A in the wheat reference genome Chinese Spring v2.1.
[0020] In the above applications, methods and products, the PCR primers may or may not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include but are not limited to dyes; radioactive labels such as 32 P; a binding moiety such as biotin; a hapten such as digoxigenin (DIG); a luminescent, phosphorescent, or fluorescent moiety; and fluorescent dyes, alone or in combination with a moiety that can inhibit or shift the emission spectrum via fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative) or, alternatively, can be charge-neutral. The label can comprise a nucleic acid or protein sequence, or a combination thereof, so long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly (e.g., by direct sequence read) without a label. For example, the PCR primers may be a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 22-40 of SEQ ID No. 1 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-40 of SEQ ID No. 2 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of SEQ ID No. 3 in the sequence listing. Alternatively, the PCR primers may be a primer set consisting of a single-stranded DNA as set forth in SEQ ID No. 1 in the sequence listing, a single-stranded DNA as set forth in SEQ ID No. 2 in the sequence listing, and a single-stranded DNA as set forth in SEQ ID No. 3 in the sequence listing. SEQ ID No. 1 in the sequence listing consists of 40 nucleotides, with nucleotides 1-21 being a FAM sequence (as a marker) and nucleotides 22-40 being a specific sequence; SEQ ID No. 2 in the sequence listing consists of 40 nucleotides, with nucleotides 1-21 being a HEX sequence (as a marker) and nucleotides 22-40 being a specific sequence.
[0021] In the above-mentioned applications, methods, and products, the product may be a reagent, kit, or system. The system may include a combination of a reagent or kit, an instrument, and analytical software, such as a product consisting of PCR primers, PARMS master mix reagent, and a microplate reader, or a combination of PCR primers, PARMS master mix reagent, and a fluorescence quantitative PCR instrument. The product may include the above-mentioned substance for detecting the polymorphism or genotype of SNP1 in the wheat genome.
[0022] The breeding indicators mentioned above may include the stripe rust resistance.
[0023] The purpose of the present invention is to provide a wheat stripe rust resistance locus QYr.cau-2ALTightly linked KASP markers and their application in assisted breeding of disease-resistant wheat.
[0024] The PCR reaction system (10 μL) described above can be as follows: HiGeno 2× Probe Mix 5.00 μL, SNP-Specific Primers 0.14 μL (this component is not included in the PCR reaction volume), template DNA (25 ng / μL) 2.00 μL, ddH2O 3.00 μL.
[0025] Each 100 μL of SNP-Specific Primers contains 12 μL of forward primer 1 (100 μM), 12 μL of forward primer 2 (100 μM), 30 μL of universal reverse primer (100 μM), and 46 μL of ddH2O.
[0026] The PCR reaction procedure was as follows: (1) denaturation at 95°C for 10 min; (2) denaturation at 95°C for 20 s, annealing / extension at 61°C for 40 s, with the annealing temperature decreasing by 0.6°C each cycle, for 10 consecutive cycles; (3) denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, for 34 consecutive cycles; (4) incubation at 30°C for 2 min, and reading the fluorescence signal value.
[0027] If the fluorescent signal of the amplified product is blue (i.e. the signal value is concentrated close to the Y axis), it means that the FAM fluorescent group is bound, and the wheat sample to be tested contains the disease resistance site. QYr.cau-2AL , that is, the SNP1 is of AA genotype (parent AQ genotype type); if the fluorescence signal of the amplified product is red (i.e., the signal value is aggregated close to the X-axis), it represents the binding of the HEX fluorescent group, and the wheat sample to be tested does not contain the disease resistance site QYr.cau-2AL , which is the GG genotype (the parent Luke genotype type); the stripe rust resistance of the tested wheat with the AA genotype is higher than that of the tested wheat with the GG genotype.
[0028] The wheat described in this application can be an inbred line, a near-allelic line or a pure line.
[0029] In some specific embodiments of the present invention, the wheat is the hybrid offspring of wheat A and wheat B. Wheat A and wheat B are both wheat varieties carrying the SNP1. In a specific embodiment of the present invention, wheat A is wheat AQ, and wheat B is wheat Luke. The hybrid offspring may be F1 generation, F2 generation or above. In a specific embodiment of the present invention, the wheat is a recombinant inbred line of Luke×AQ. In a specific embodiment of the present invention, the recombinant inbred line of Luke×AQ is a recombinant inbred line obtained with wheat Luke as the female parent and wheat AQ as the male parent.
[0030] In some embodiments of the present invention, the breeding index includes the stripe rust resistance. In some embodiments of the present invention, the breeding purpose includes improving the stripe rust resistance of wheat.
[0031] In a specific embodiment of the present invention, the wheat breeding is to cultivate or select wheat resistant to stripe rust. The stripe rust-resistant wheat has a higher resistance to stripe rust than its parent.
[0032] The present invention is based on the major QTL locus for stripe rust resistance found on chromosome 2AL of the wheat genome. QYr.cau-2AL Tightly linked SNPs have been developed for rapid, accurate and efficient detection QYr.cau-2AL The KASP molecular marker of the locus and its application method, using this marker to assist in selection breeding, not only has a clear selection target and is not affected by the environment, but also greatly saves costs, providing technical support for the improvement of wheat stripe rust traits and disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 This is the genotyping result of some strains in the Luke×AQ recombinant inbred line population using the molecular marker KASP-44575 in Example 2 of the present invention, where the blue color represents the AQ genotype AA, and the red color represents the Luke genotype GG.
[0034] Figure 2 This is a graph comparing the stripe rust disease severity values of two different genotypes of the wheat materials tested in Example 2 of the present invention detected by the KASP-44575 marker. **** represents P < 0.0001. DETAILED DESCRIPTION
[0035] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0036] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0037] Wheat AQ in the following examples is a quantitative disease-resistant wheat line bred by the Disease Resistance Genetics Laboratory, Department of Plant Pathology, China Agricultural University, with adult plant resistance to stripe rust. Wheat AQ is the "theadvanced breeding line AQ24788-83" on page 457 of reference 1: Wang Z., Ren J., Du Z., Che M., Zhang Y., Quan W., Jiang X., Ma Y., Zhao Y., and Zhang Z. Identification of a major QTL on chromosome arm 2AL for reducing yellow rust severity from a Chinese wheatlandrace with evidence for durable resistance. Theoretical and Applied Genetics, 2019, 132, 457-471. The public can obtain this biological material from the applicant for use only in replicating the experiments of the present invention and cannot be used for other purposes.
[0038] The wheat variety Luke used in the following examples is a wheat variety bred by Washington State University and other institutions in the United States. Its pedigree is PI178383 / 2*Burt / / CItr 13438 and its number is CItr 14586 at the National Small Grain Collection (Aberdeen, Idaho 83210, USA). It exhibits high-temperature resistance to stripe rust. Wheat Luke is disclosed in the aforementioned reference 1 on page 459. The public can also obtain this biological material from the applicant. This biological material was used solely for the purpose of replicating the experiments of the present invention and is not for use for any other purpose.
[0039] The wheat Mingxian 169 described in the following examples is described in: Wang Z., Ren J., Du Z., Che M., Zhang Y., Quan W., Jiang X., Ma Y., Zhao Y., and Zhang Z. Identification of amajor QTL on chromosome arm 2AL for reducing yellow rust severity from a Chinese wheat landrace with evidence for durable resistance. Theoretical and Applied Genetics, 2019, 132, 457-471. The public can obtain this biological material from the applicant for use only in replicating the experiments of the present invention and cannot be used for other purposes.
[0040] The stripe rust fungus in the following examples is Puccinia striata ( Puccinia striiformis ) CYR32 race. The original strain was provided by Researchers Chen Wanquan and Xu Shichang from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences and has been described in: Wang Z., Ren J., Du Z., Che M., Zhang Y., Quan W., Jiang X., Ma Y., Zhao Y., and Zhang Z. Identification of a major QTL on chromosome arm 2AL for reducing yellow rust severity from a Chinese wheat landrace with evidence for durable resistance. Theoretical and Applied Genetics, 2019, 132, 457-471. The public may obtain this biological material from the applicant for use only in replicating the experiments of the present invention and may not be used for any other purpose.
[0041] In an embodiment of the present invention, a method for constructing a Luke×AQ recombinant inbred line population is as follows: wheat Luke is used as the female parent and wheat AQ is used as the male parent for hybridization to obtain hybrid F1, F1 generation individual plants are self-pollinated to obtain F2, and starting from the F2 generation, self-pollination is repeated to F8 and above by the single-seed transmission method to form a Luke×AQ recombinant inbred line population.
[0042] The following examples were processed using SAS 9.4 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.001 (****) indicated a highly significant difference.
[0043] Example 1. Wheat stripe rust resistance QTL ( QYr.cau-2AL ) and its KASP marker acquisition 1. Acquisition of phenotype and genotype A total of 138 recombinant inbred lines (RILs) of Luke×AQ and their parents were planted in Wushan County, Tianshui City, Gansu Province (1680 m above sea level, average annual temperature 7.8°C, annual precipitation 538.4 mm) and Shengzhuang Town, Tai'an City, Shandong Province (90 m, 12.9°C, 750.4 mm) in mid-September and early October, respectively. A randomized complete block design was used with three replicates, with single-row plots, 1 m long, and 25 cm spacing. Approximately 40 seeds were evenly sown per row. Every 60 rows, a group of parents and a susceptible control (AQ, Luke, and Mingxian 169) were sown. Disease occurred naturally in the Gansu trial site, while the Shandong trial site was artificially inoculated with CYR32.
[0044] The severity of stripe rust was assessed using the method of Peterson et al. (1948), i.e., the percentage of lesion area on diseased leaves to the leaf surface area. Surveys were conducted when the severity of stripe rust on the flag leaves of the susceptible control Mingxian 169 plants reached 10-30% (i.e., early stage of disease), 50-60% (i.e., mid-stage of disease), and 80-90% (i.e., late stage of disease). The average severity of all flag leaves in each plot was visually measured and used as the stripe rust severity for each line and the two parental lines in each recombinant inbred line. Based on the data from the three surveys, the area under the disease progression curve (AUDPC) was calculated according to the following formula (1): Formula (1); In formula (1), x i represents the condition value of the i-th survey, x (i+1) represents the condition value of the i+1th survey, t i represents the date of the i-th survey, t (i+1) represents the date of the i+1th survey; t (i+1) -t i represents the number of days between the i-th and i+1-th surveys.
[0045] Genomic DNA from the parents AQ and Luke and their recombinant inbred lines was extracted using the CTAB method and analyzed using a NanoDrop 2000 ultramicro-spectrophotometer. Qualified DNA was diluted to a working solution of 50 ng / μL and sent to Beijing Capital Biotech Co., Ltd. (http: / / www.capitalbiotech.com) for genotyping using the Illumina iSelect 90K SNP array.
[0046] 2. Genetic map construction and QTL analysis The molecular marker data obtained in step 1 were first filtered to remove markers with a missing value rate greater than 10% and skewed segregation. Redundant markers were then temporarily removed using the BIN function in the software IciMapping V4.0, that is, only one marker was retained as a "skeleton" marker in a recombination segment (i.e., marker site). Linkage clustering was then performed using JoinMap 4.0 software, and each linkage group was ordered. The relative genetic distance (centi-Morgan, cM) between markers was calculated using the Kosambi function. Finally, the linkage group SNP flanking sequences were aligned with the Chinese Spring reference genome sequence to determine the corresponding chromosome and centromere position of each linkage group.
[0047] QTL analysis was performed using the Composite Interval Mapping (CIM) method using Windows QTL Cartographer 2.5 software. The significance threshold was set at 11.5 (equivalent to LOD = 2.5). When the logarithm of the odds (LOD) of the likelihood function exceeded the significance threshold of 2.5, a disease resistance QTL was identified. A stripe rust resistance QTL was located on the long arm of chromosome 2A and named QYr.cau-2AL Under different environmental conditions, the stripe rust resistance QTL can significantly reduce the severity of stripe rust, explaining 23% to 40% of the phenotypic variation in the disease. The disease resistance allele comes from the parent AQ.
[0048] 3. Development of KASP markers KASP primers were designed using DNAMAN software based on the principles of competitive allele-specific PCR (KASP). These primers consist of two allele-specific forward primers (allele-specific forward primers 1 and 2) and a common reverse primer. Since the 3'-terminal base of the forward primer must correspond to the allele site of the allele, two forward primer design methods are available: using the sequence to the left of the SNP site as the forward primer (designed from left to right) or the sequence to the right of the SNP site (designed from right to left). Design criteria include: primer length of 19-28 bp, GC content of 40%-60%, optimal forward primer Tm of 61°C-63°C, and reverse primer Tm of 62°C-65°C; and amplification product length of 45-70 bp. In addition, the primer sequences were aligned by Blast at IWGSC (https: / / urgi.versailles.inra.fr / blast_iwgsc / blast.php) to ensure that the primers could correctly recognize the target sites.
[0049] The target SNP 1 is located at nucleotide position 51 of SEQ ID No. 4, which is a G or A polymorphism and corresponds to a physical position of 787,111,581 on chromosome 2A in the Chinese Spring v2.1 wheat reference genome. The flanking sequence (SEQ ID No. 4): 5'-GAATATAGCGAAGGGGTTCCTCTCAGATCATCGGACTCGTTCCGGTCACTrCATTGATGCCCGGTCAGCCGCGCTGGCCATCGATTTTCACCGAGCTAGGG-3' corresponds to a physical position of 787,111,531 to 787,111,635 on chromosome 2AL in the Chinese Spring v2.1 wheat reference genome. In SEQ ID No. 4, r is either a or g. KASP marker primers were designed based on the antisense strand of SNP 1 (i.e., designed from right to left) and named KASP-44575. The primer sequences are as follows: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT GCTGACCGGGCATCAATGT-3' (SEQ ID No. 1, wherein the underlined portion, i.e., nucleotides 1-21 of SEQ ID No. 1, is a FAM fluorescent labeling sequence); Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATT GCTGACCGGGCATCAATGC-3' (SEQ ID No. 2, wherein the underlined portion, i.e., nucleotides 1-21 of SEQ ID No. 2, is a HEX fluorescent labeling sequence); Universal reverse primer: 5′-AATATAGCGAAGGGGTTCCTCTCAGAT-3′ (SEQ ID No. 3).
[0050] The single-stranded DNA molecules shown in SEQ ID No. 1 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the antisense strand of the SNP1 site is homozygous for T, corresponding to the homozygous fragment in which the nucleotide at the sense strand of the SNP1 site in SEQ ID No. 4 is A, hereinafter referred to as the genotype AA of the SNP1 site; the single-stranded DNA molecules shown in SEQ ID No. 2 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the antisense strand of the SNP1 site is C, corresponding to the homozygous fragment in which the nucleotide at the sense strand of the SNP1 site in SEQ ID No. 4 is G, hereinafter referred to as the genotype GG of the SNP1 site.
[0051] Example 2. Molecular marker KASP-44575 in identifying wheat stripe rust resistance QYr.cau-2AL Application In order to further test the developed KASP-44575 marker in identifying the target SNP1 site polymorphism, that is, detecting the stripe rust resistance site closely linked to it QYr.cau-2AL To demonstrate the accuracy and high resolution of KASP marker typing, 113 strains were selected from the Luke×AQ recombinant inbred line population to verify the typing effect of KASP markers. The specific method was as follows: 1. Determination of stripe rust resistance in 113 lines and their parents A total of 113 recombinant inbred lines (Luke×AQ) were randomly selected (Table 1, numbered 1 to 113). These lines and their parents (wheat Luke and wheat AQ) were planted on September 26, 2019, in a field in Wushan County, Tianshui City, Gansu Province (1680 m above sea level, with an average annual temperature of 7.8°C and an annual precipitation of 538.4 mm). A randomized complete block design was used, with three replicates per line. Each plot had a single row length of 1 m and a row spacing of 25 cm. Forty seeds were evenly sown per row. Every 60 rows, a pair of parents (AQ and Luke) and a susceptible control (Mingxian 169) were sown. Stripe rust naturally occurred in this experimental plot.
[0052] In June of the second year (2020), when the stripe rust disease was prevalent, the severity of stripe rust disease in the flag leaves of the susceptible control Mingxian 169 plant reached 10-30% (i.e., the date of the first survey was June 11, 2020), 50-60% (i.e., the date of the second survey was June 18, 2020), and 80-90% (i.e., the date of the third survey was June 24, 2020), respectively. The stripe rust disease severity of the 113 test lines and the parents Luke and AQ was investigated three times according to the method of Peterson et al. (1948). The AUDPC value of the stripe rust disease severity of each line was calculated according to formula (1) in step 1 of the example (Table 1).
[0053] 2. Determination of SNP1 genotypes of 113 strains and their parents The genomic DNA of the 113 lines and their parents (wheat Luke and wheat AQ) in step 1 was extracted and used as templates, and fluorescence quantitative PCR amplification was performed using specific primers (SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3) of the molecular marker KASP-44575.
[0054] PCR reaction using AQP TM Genotyping reagents (Cat. No. AQP-001S, Beijing Jiacheng Biotechnology Co., Ltd.) were used in a 10 μL reaction system consisting of 5.00 μL of HiGeno 2× Probe Mix, 0.14 μL of SNP-Specific Primers (this component is not included in the PCR reaction volume), 2.00 μL of template DNA (25 ng / μL), and 3.00 μL of ddH2O. The HiGeno 2× Probe Mix contains Taq DNA polymerase, a universal fluorescent reporter probe, dNTPs, buffer, MgCl2, and the reference dye ROX. Each 100 μL of SNP-Specific Primers contains 12 μL of forward primer 1 (100 μM), 12 μL of forward primer 2 (100 μM), 30 μL of universal reverse primer (100 μM), and 46 μL of ddH2O.
[0055] PCR was performed using an ABI QuantStudio 6 Flex fluorescence quantitative PCR instrument with the following procedure: (1) denaturation at 95°C for 10 min; (2) denaturation at 95°C for 20 s, annealing / extension at 61°C for 40 s, with the annealing temperature decreasing by 0.6°C each cycle, for 10 consecutive cycles; (3) denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, for 34 consecutive cycles; (4) incubation at 30°C for 2 min, and reading the fluorescence signal value.
[0056] Using QuantStudio Real-Time PCR Software v1.3, we clustered the samples by analyzing the fluorescence signal values and finally achieved genotyping. Figure 1 As shown, samples with blue fluorescent signals (i.e., signal values aggregated close to the Y-axis) represent the binding of the FAM fluorescent group, and the genotype of the SNP1 site in the wheat genome to be tested is AA, which is consistent with the parent AQ; samples with red fluorescent signals (i.e., signal values aggregated close to the X-axis) represent the binding of the HEX fluorescent group, and the genotype of the SNP1 site in the wheat genome to be tested is GG, which is consistent with the parent Luke.
[0057] The genotypes of each strain and the AUDPC values of the severity of stripe rust in the field in Gansu are shown in Table 1. Genotyping using the KASP-44575 marker showed that the genotype of the SNP1 site in the genome of 61 strains was AA, which means that they contain the stripe rust resistance locus. QYr.cau-2AL , the genotype of SNP1 in the genome of 52 strains was GG, which means that they did not contain stripe rust resistance loci QYr.cau-2AL ; The AUDPC values of the above strains were statistically analyzed and the results showed that QYr.cau-2AL The average AUDPC value of stripe rust of the strains with the genotype of SNP1 locus being AA was 197.22, excluding QYr.cau-2AL The average stripe rust disease value of the strain with the SNP1 locus being GG was 556.11, and the difference in the stripe rust AUDPC values between the two strains reached an extremely significant level (P<0.0001) ( Figure 2 ). The stripe rust AUDPC value of wheat Luke was 462.50, and the stripe rust AUDPC value of wheat AQ was 167.35.
[0058] This result indicates that the KASP-44575 (SNP1) marker can be used as a QTL locus for wheat stripe rust resistance. QYr.cau-2AL Detection and molecular marker-assisted breeding.
[0059] Table 1. Correspondence between SNP1 genotypes and stripe rust phenotypes in the Luke×AQ recombinant inbred line population
[0060]
[0061]
[0062] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Use of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in identifying or assisting in identifying wheat stripe rust resistance; the SNP1 is a single nucleotide polymorphism in the wheat genome, whose nucleotide type is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
2. The use of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in the preparation and identification or auxiliary identification of wheat stripe rust resistance products; the SNP1 is a single nucleotide polymorphism in the wheat genome, its nucleotide type is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
3. Application of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in wheat breeding or in the preparation of wheat breeding products, wherein SNP1 is a single nucleotide polymorphism in the wheat genome, the nucleotide type of which is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
4. A method for identifying or assisting in identifying wheat stripe rust resistance, comprising detecting the genotype of the wheat to be tested, and identifying or assisting in identifying the stripe rust resistance of the wheat based on the genotype of the wheat to be tested, wherein the stripe rust resistance of wheat homozygous for SNP1 A is greater than that of wheat homozygous for SNP1 G; the genotype is the genotype of SNP1 in the wheat genome; the SNP1 is a single nucleotide polymorphism in the wheat genome, the nucleotide type of which is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence listing.
5. Application of the method according to claim 4 in wheat breeding.
6. A method of wheat breeding, comprising: The polymorphism of the SNP1 in claim 1 is detected in the wheat genome, and homozygous wheat in which the SNP1 in the wheat genome is A is selected as a parent for breeding.
7. Products containing substances for detecting the polymorphism or genotype of SNP1 in the wheat genome, any of products C1) to C3): C1) Products for detecting single nucleotide polymorphisms or genotypes associated with wheat stripe rust resistance; C2) Products for identifying or assisting in identifying wheat stripe rust resistance; C3) Products used for wheat breeding; The SNP1 is a single nucleotide polymorphism in the wheat genome, the nucleotide type of which is A or G, and is the 51st nucleotide in SEQ ID No. 4 in the sequence table.
8. The use according to any one of claims 3 and 5, the method according to claim 6 or the product according to claim 7, characterized in that: The breeding criteria include stripe rust resistance.
9. The use according to any one of claims 1 to 3, 5 and 8, the method according to claim 4, 6 or 8, or the product according to claim 7 or 8, characterized in that: The substance for detecting the polymorphism or genotype of SNP1 in the wheat genome is as follows: D1), D2) or D3): D1) the material for detecting the polymorphism or genotype of SNP1 in the wheat genome contains PCR primers for amplifying a wheat genomic DNA fragment including the SNP1 site; D2) the substance for detecting the polymorphism or genotype of SNP1 in the wheat genome is a PCR reagent containing the PCR primer; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).
10. The use, method or product according to claim 9, characterized in that: The PCR primer is P1 or P2: P1, the PCR primers are a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 22-40 of SEQ ID No. 1 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-40 of SEQ ID No. 2 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of SEQ ID No. 3 in the sequence listing; P2, the PCR primers are a primer set consisting of the single-stranded DNA shown in SEQ ID No. 1 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing.