Method for producing cell, method for producing multispecific antibody, vector set, mammalian cell, CHO cell, and method for producing cell pool

Abstract

A cell production method for introducing a vector group into host cells and selecting a cell for producing a multispecific antibody from among the host cells into which the vector group has been introduced. A vector group is a group comprising a first expression vector and a second expression vector, the first expression vector comprising an expression cassette of a first H chain, an expression cassette of a second H chain, an expression cassette of a first L chain, and an expression cassette of a second L chain, and the second expression vector comprising one, two, or three expression cassettes selected from the group consisting of the expression cassettes of the first H chain, the expression cassette of the second H chain, the expression cassette of the first L chain, and the expression cassette of the second L chain.

Description

Technical Field

[0001] The present invention relates to a method for producing cells, a method for producing multispecific antibodies, a vector set, mammalian cells, CHO cells and a method for producing a cell pool. Background Art

[0002] Patent Document 1 discloses a method for producing a multispecific antibody comprising at least three different polypeptides, the method comprising the step of transfecting a first expression vector and one, two, or three further expression vectors into mammalian cells.

[0003] Patent Document 2 discloses an expression vector and an expression method for expressing a humanized bispecific antibody that targets HER1 and CD3 and is composed of two single-chain polypeptides.

[0004] Prior art literature

[0005] Patent Literature

[0006] Patent Document 1: Japanese Patent Application No. 2020-509754

[0007] Patent Document 2: Japanese Patent Application Laid-Open No. 2012-179051 Summary of the Invention

[0008] Technical issues to be solved by the invention

[0009] Traditionally, to create cells that produce multispecific antibodies, expression vectors containing the polypeptides that comprise the multispecific antibody have been introduced into host cells. For example, in the case of a multispecific antibody containing four polypeptides, an expression vector containing all four expression cassettes is introduced into the host cells. However, in reality, the expression level and purity of the multispecific antibody are low, and the yield of the multispecific antibody sometimes falls short of expectations. Possible reasons for this include: varying transcription or translation rates for each polypeptide; the susceptibility of some polypeptides to degradation; and the accumulation of all polypeptides when there are too many polypeptides of a particular type.

[0010] Furthermore, the expression level or purity of the multispecific antibody is low, and the following reasons may also be considered.

[0011] Because multispecific antibodies have multiple H chains and / or L chains, mispairing of the H and L chains may sometimes occur (pairing that is not intended by the designer of the multispecific antibody and that does not result in the expected antibody activity). In order to efficiently form the target multispecific antibody, techniques for altering the amino acid sequence of the H and / or L chains (e.g., knobs-into-holes techniques, amino acid substitutions for the purpose of charge control at the interface between the H and L chain constant regions) are sometimes used, but the incidence of mispairing is known to vary depending on the technique used. Even with the application of these techniques, the occurrence of mispairing cannot be completely suppressed. Therefore, the optimal expression ratio of each polypeptide for obtaining the target multispecific antibody is not necessarily consistent with the quantitative ratio of each polypeptide contained in the multispecific antibody.

[0012] As a method for increasing the expression level or purity of multispecific antibodies, it is possible to consider placing the expression cassettes of each polypeptide on separate expression vectors and introducing multiple expression vectors into the host cell. In the case where the multispecific antibody has four polypeptides, the four expression vectors are introduced into the host cell. Since there is a deviation in the number of each of the four expression vectors introduced into the host cell, diversity is generated in the number of each expression cassette retained in the host cell. Cells with high expression level or purity of the multispecific antibody are selected from the multiple host cells. However, it is necessary to construct expression vectors with the same number of types as the number of types of polypeptides constituting the multispecific antibody, and it is necessary to integrate the same number of selection markers as the number of types of expression vectors.

[0013] As another method for increasing the expression level or purity of a multispecific antibody, one can consider knowing in advance the optimal ratio of expression levels of all polypeptides constituting the multispecific antibody and placing expression cassettes for all types of polypeptides in a quantity ratio according to this ratio on a single expression vector. However, when a multispecific antibody is composed of four polypeptides, it is not necessarily easy to understand the optimal ratio of expression levels of the four polypeptides. Furthermore, when the optimal ratio of expression levels of the four polypeptides is a relatively large integer (e.g., 1:1:2:3), the total number of expression cassettes placed on a single expression vector increases. As a result, the size of the expression vector increases, and the rate of incorporation into host cells decreases.

[0014] The present invention provides a method different from the above-mentioned method as a method for increasing the expression level or purity of a multispecific antibody.

[0015] An object of the present invention is to provide a method for producing cells with excellent productivity of multispecific antibodies.

[0016] An object of the present invention is to provide a method for producing a multispecific antibody with excellent productivity.

[0017] An object of the present invention is to provide a vector set for producing cells that produce multispecific antibodies.

[0018] The present invention aims to provide mammalian cells and CHO cells that produce multispecific antibodies.

[0019] An object of the present invention is to provide a method for producing a cell pool for selecting cells producing multispecific antibodies.

[0020] Means for solving technical problems

[0021] In the cell production method of the present invention, two expression vectors, namely a first expression vector and a second expression vector, are introduced into host cells in order to express a multispecific antibody having four polypeptides.

[0022] The first expression vector contains expression cassettes for all four polypeptides constituting the multispecific antibody. By introducing the first expression vector into host cells, expression of the four polypeptides is ensured.

[0023] The second expression vector houses an expression cassette for a polypeptide of interest (typically, the polypeptide whose expression is desired to be enhanced) among the four polypeptides comprising the multispecific antibody. The polypeptides of interest may be one, two, or three. By introducing the second expression vector into the host cell in addition to the first expression vector, the number of expression cassettes for the polypeptide of interest introduced into the host cell increases, thereby enhancing expression of the polypeptide of interest.

[0024] Since the number of the first expression vector and the number of the second expression vector introduced into each host cell varies, the number of expression cassettes retained in the host cell varies. Cells that meet the evaluation criteria (e.g., the expression level or purity of the multispecific antibody) are selected from the plurality of host cells.

[0025] Specific methods for solving the problem include the following.

[0026] <1>

[0027] A method for producing a cell that produces a multispecific antibody having four polypeptides, namely, a 1H chain, a 2H chain, a 1L chain, and a 2L chain.

[0028] The method comprises:

[0029] The step of introducing the following vector assembly into a host cell; and

[0030] Select cells producing multispecific antibodies from host cells into which the vector group has been introduced,

[0031] A vector set, which is a set of a first expression vector and a second expression vector,

[0032] The first expression vector comprises an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

[0033] The second expression vector comprises one, two or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

[0034] <2>

[0035] The method for producing a cell according to <1>, wherein

[0036] The second expression vector contains an expression cassette for the first L chain and an expression cassette for the second L chain.

[0037] <3>

[0038] The method for producing a cell according to <1> or <2>, wherein

[0039] The multispecific antibody is a pentamer in which the 1st L chain and the 2nd L chain are bound to the 1st H chain, and the 2nd L chain is bound to the 2nd H chain.

[0040] <4>

[0041] The method for producing a cell according to any one of <1> to <3>, wherein

[0042] The first expression vector comprises one expression cassette for the first H chain, one expression cassette for the second H chain, one expression cassette for the first L chain, and one expression cassette for the second L chain.

[0043] The second expression vector comprises one, two or three expression cassettes each selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain and an expression cassette for the second L chain.

[0044] <5>

[0045] The method for producing a cell according to any one of <1> to <4>, wherein

[0046] The expression cassettes for the polypeptides constituting the multispecific antibody all contain the same type of promoter.

[0047] <6>

[0048] The method for producing a cell according to any one of <1> to <5>, wherein

[0049] The first expression vector further comprises an expression cassette for a first selection marker,

[0050] The second expression vector further comprises an expression cassette for a second selection marker.

[0051] <7>

[0052] The method for producing a cell according to any one of <1> to <6>, wherein

[0053] The host cells are mammalian cells.

[0054] <8>

[0055] The method for producing a cell according to any one of <1> to <6>, wherein

[0056] The host cells are CHO cells.

[0057] <9>

[0058] A method for producing a multispecific antibody, comprising:

[0059] A step of culturing cells produced by the method for producing cells according to any one of <1> to <8>.

[0060] <10>

[0061] A vector set for expressing a multispecific antibody having four polypeptides, namely, a 1H chain, a 2H chain, a 1L chain, and a 2L chain.

[0062] It is a set of the first expression vector and the second expression vector,

[0063] The first expression vector comprises an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

[0064] The second expression vector comprises one, two or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

[0065] <11>

[0066] The vector set according to <10>, wherein

[0067] The second expression vector contains an expression cassette for the first L chain and an expression cassette for the second L chain.

[0068] <12>

[0069] The vector set according to <10> or <11>, wherein

[0070] The multispecific antibody is a pentamer in which the 1st L chain and the 2nd L chain are bound to the 1st H chain, and the 2nd L chain is bound to the 2nd H chain.

[0071] <13>

[0072] The carrier set according to any one of <10> to <12>, wherein

[0073] The first expression vector comprises one expression cassette for the first H chain, one expression cassette for the second H chain, one expression cassette for the first L chain, and one expression cassette for the second L chain.

[0074] The second expression vector comprises one, two or three expression cassettes each selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain and an expression cassette for the second L chain.

[0075] <14>

[0076] The carrier set according to any one of <10> to <13>, wherein

[0077] The expression cassettes for the polypeptides constituting the multispecific antibody all contain the same type of promoter.

[0078] <15>

[0079] The carrier set according to any one of <10> to <14>, wherein

[0080] The first expression vector further comprises an expression cassette for a first selection marker,

[0081] The second expression vector further comprises an expression cassette for a second selection marker.

[0082] <16>

[0083] A mammalian cell, which is a cell transfected with the vector group described in any one of <10> to <15>.

[0084] <17>

[0085] A CHO cell, which is a cell transfected with the vector group described in any one of <10> to <15>.

[0086] <18>

[0087] A method for producing a cell pool, comprising:

[0088] A step of introducing the vector group described in any one of <10> to <15> into a host cell.

[0089] <19>

[0090] The method for producing a cell pool according to <18>, wherein

[0091] The host cells are mammalian cells.

[0092] <20>

[0093] The method for producing a cell pool according to <18>, wherein

[0094] The host cells are CHO cells.

[0095] Effects of the Invention

[0096] According to the present invention, a method for producing cells with excellent productivity of multispecific antibodies is provided.

[0097] According to the present invention, a method for producing a multispecific antibody with excellent productivity is provided.

[0098] According to the present invention, a vector set for producing cells producing multispecific antibodies is provided.

[0099] According to the present invention, a mammalian cell and a CHO cell for producing a multispecific antibody are provided.

[0100] According to the present invention, a method for producing a cell pool for selecting cells producing multispecific antibodies is provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0101] Figure 1 Schematic diagram of a tetrameric multispecific antibody comprising four polypeptides.

[0102] Figure 2 Schematic diagram of a multispecific antibody having a pentamer of four polypeptides.

[0103] Figure 3 is a vector map of the expression vector 1 constructed in the examples.

[0104] Figure 4 is a vector map of expression vector 2 constructed in the examples. DETAILED DESCRIPTION

[0105] The following describes embodiments of the present invention. These descriptions and examples are examples of embodiments and do not limit the scope of the embodiments. The mechanism of action described in the present invention includes speculation, and its accuracy does not limit the scope of the embodiments.

[0106] In the present invention, a numerical range expressed using “to” indicates a range including the numerical values ​​before and after “to” as the minimum value and the maximum value, respectively.

[0107] In the numerical ranges described at various stages in the present invention, the upper limit or lower limit of one numerical range may be replaced by the upper limit or lower limit of another numerical range described at various stages. Furthermore, in the numerical ranges described in the present invention, the upper limit or lower limit of the numerical range may be replaced by the value shown in the Examples.

[0108] In the present invention, each component may also include multiple corresponding substances. In the present invention, when referring to the amount of each component in the composition, if multiple substances corresponding to each component are present in the composition, unless otherwise specified, it refers to the total amount of the multiple substances present in the composition.

[0109] In the present invention, nucleic acids include all nucleic acids (e.g., DNA, RNA, their analogs, natural products, and artificial products), as well as nucleic acids formed by linking low molecular weight compounds, groups (e.g., methyl groups), molecules other than nucleic acids, and structures. Nucleic acids can be single-stranded or double-stranded.

[0110] In the present invention, a vector is a substance that transports exogenous nucleic acids into cells and is itself a nucleic acid. An expression vector is a vector that expresses a polypeptide based on its nucleic acid sequence. The size and base sequence of vectors and expression vectors are not limited. Preferably, the vector and expression vector are double-stranded DNA.

[0111] In the present invention, amino acid notations are based on the three-letter notation and the one-letter notation specified by IUPAC-IUBMB JCBN (IUPAC-IUBMB Joint Commission on Biochemical Nomenclature). Unless otherwise specified, amino acids referred to in the present invention are L-amino acids.

[0112] In the present invention, the term "polypeptide" encompasses proteins. The number of amino acid residues in a polypeptide is not limited. Polypeptides also include polypeptides in which amino acids have been post-translationally modified. Examples of post-translational amino acid modifications include phosphorylation, methylation, acetylation, sugar chain addition, and lipid addition.

[0113] In the present invention, a polypeptide refers to a molecule expressed from a single independently expressed coding sequence. A relatively large polypeptide (e.g., an antibody heavy chain) composed of multiple domains connected by one or more peptide linkers also constitutes a polypeptide, as long as it is expressed from a single independently expressed coding sequence.

[0114] In the present invention, the term "antibody" is not limited to immunoglobulins, but is intended to be any molecule that binds to an antigen. In the present invention, "antibody" is a term encompassing antibody fragments and antigen-binding molecules. In the present invention, the heavy chain of an antibody is also referred to as an H chain, and the light chain of an antibody is also referred to as an L chain.

[0115] The present invention relates to a multispecific antibody having four polypeptides, namely, a 1H chain, a 2H chain, a 1L chain, and a 2L chain. The multispecific antibody referred to in the present invention is the above-mentioned multispecific antibody unless otherwise specified.

[0116] Hereinafter, when describing common matters between the first H chain and the second H chain, both are collectively referred to as the H chain, and when describing common matters between the first L chain and the second L chain, both are collectively referred to as the L chain.

[0117] There is no limitation on the structure of a multispecific antibody or the number of epitope binding sites. A multispecific antibody can be a multimer composed of four polypeptides (i.e., a tetramer) or a multimer composed of five or more polypeptides (i.e., a pentamer or higher).

[0118] The tetrameric multispecific antibody has one each of the first H chain, the second H chain, the first L chain, and the second L chain.

[0119] A multispecific antibody having pentameric or higher specificity has at least one each of the 1H chain, the 2H chain, the 1L chain, and the 2L chain, and has two or more of any one of the chains (one type or two or more types).

[0120] The first and second H chains are two different heavy chains with different amino acid sequences. Each of the first and second H chains contains at least a region for antigen recognition and a region for forming a multispecific antibody. The order of domains within the H chain is not limited to VH-CH1-CH2-CH3; some domains may be repeated or deleted. The first and second H chains are linked by a disulfide bond.

[0121] The first and second L chains are two light chains with different amino acid sequences. Each of the first and second L chains should contain at least a region for antigen recognition and a region for forming a multispecific antibody. The L chain is bound to the H chain via a disulfide bond.

[0122] The multispecific antibody comprising four polypeptides is expressed based on four coding sequences that are expressed independently of one another, namely, the coding sequence of the first H chain, the coding sequence of the second H chain, the coding sequence of the first L chain, and the coding sequence of the second L chain.

[0123] Examples of multispecific antibodies include: human antibodies having human variable regions and human constant regions; mouse antibodies having mouse variable regions and mouse constant regions; chimeric antibodies combining regions derived from multiple animals; humanized antibodies having mouse variable regions and human constant regions; humanized antibodies having camel heavy chain variable regions and human Fc regions; and the like.

[0124] Examples of multispecific antibodies include bispecific antibodies and trispecific antibodies. Bispecific antibodies are antibodies that can simultaneously bind to two epitopes. Trispecific antibodies are antibodies that can simultaneously bind to three epitopes. There are no restrictions on the structure of bispecific antibodies or the number of epitope binding sites. There are no restrictions on the structure of trispecific antibodies or the number of epitope binding sites.

[0125] An example of a multispecific antibody is Figure 1 This antibody has the form shown. This antibody is a tetramer consisting of one first H chain (HC1), one second H chain (HC2), one first L chain (LC1), and one second L chain (LC2). This antibody has a structure in which LC1 binds to HC1 and LC2 binds to HC2. In this antibody, HC1 and LC1 constitute the first epitope binding site, and HC2 and LC2 constitute the second epitope binding site. This antibody is a bispecific antibody that binds to the first antigen via the first epitope binding site and to the second antigen via the second epitope binding site.

[0126] As a Figure 1 Examples of bispecific antibodies of the above-mentioned form include Faricimab, Vanucizumab, Mosunetuzumab, and Amivantamab.

[0127] An example of a multispecific antibody is Figure 2 This antibody has the form shown. This antibody is a pentamer consisting of one first H chain (HC1), one second H chain (HC2), one first L chain (LC1), and two second L chains (LC2). The HC1 domains are arranged in the order VH-CH1-VH-CH1-CH2-CH3. This antibody has a structure in which LC1 and LC2 bind to HC1, and LC2 binds to HC2. In this antibody, HC1 and LC1 constitute the first epitope binding site, HC1 and LC2 constitute the second epitope binding site, and HC2 and LC2 constitute the third epitope binding site. The antibody of this form can be any of the following: a bispecific antibody, which binds to a first antigen through a first epitope binding site and binds to a second antigen through a second epitope binding site and / or a third epitope binding site; a trispecific antibody, which binds to a first antigen through a first epitope binding site, binds to a second antigen through a second epitope binding site, and binds to a third antigen through a third epitope binding site.

[0128] As a Figure 2 Examples of bispecific antibodies of the above-mentioned form include Cibisatamab, Glofitamab, and Alnuctamab.

[0129] <Cell Production Method>

[0130] One embodiment of the present invention is a method for producing cells that produce multispecific antibodies. The method comprises: introducing a vector set comprising a first expression vector and a second expression vector into a host cell; and selecting a cell that produces the multispecific antibody from the host cell into which the vector set has been introduced.

[0131] In the present invention, the "vector set" refers to a set of a first expression vector and a second expression vector. Details of the vector set, the first expression vector, and the second expression vector will be described later.

[0132] In the present invention, when describing matters common to the first expression vector and the second expression vector, the first expression vector and the second expression vector are collectively referred to as "expression vector."

[0133] The host cell may be a prokaryotic cell or a eukaryotic cell. Examples of prokaryotic cells include bacterial cells. Examples of eukaryotic cells include yeast, insect cells, and mammalian cells. The host cell is preferably a eukaryotic cell, more preferably a mammalian cell.

[0134] Examples of bacterial cells include Gram-negative bacterial cells such as Escherichia coli, Salmonella typhimurium, Serratia marcescens, Pseudomonas putida, and Pseudomonas aeruginosa; and Gram-positive bacterial cells such as Bacillus subtilis. Preferred bacterial cells are Enterobacteriaceae, more preferably Escherichia coli, and particularly preferably strain B or K12.

[0135] Examples of yeast include Saccharomyces cerevisiae, Pichia pastoris, and Hansenula polymorpha.

[0136] Examples of insect cells include BmN cells derived from silkworm ( Bombyx mori ), Sf9 cells and Sf21 cells derived from Spodoptera frugiperda , S2 cells derived from Drosophila melanogaster , and Pv11 cells derived from Polypedilum vanderplanki .

[0137] Examples of mammalian cells include Chinese hamster ovary cells (CHO cells), baby hamster kidney cells (BHK cells), human embryonic kidney cell lines (e.g., HEK293 cells), human retinoblastoma cell lines (e.g., PER.C6 cells), and mouse myeloma cell lines (e.g., NS0 cells and SP2 / 0 cells).

[0138] The host cell is preferably a Chinese hamster ovary cell (CHO cell). Examples of CHO cells include CHO-DG44 cells, CHO-K1 cells, CHO-DXB11 cells, CHOpro3 - cells and cell lines derived from these cells.

[0139] Examples of methods for introducing expression vectors into host cells include electroporation, lipofection, microinjection, and cell infection with viral vectors. Electroporation is preferred from the perspectives of high safety, high introduction efficiency, and low cytotoxicity. Furthermore, electroporation is preferred from the perspective of allowing multiple expression vectors to be introduced into cells without deviation due to the type of expression vector and to be introduced uniformly into the cells and chromosomes.

[0140] The order in which the first expression vector and the second expression vector are introduced into the host cell is not limited. The first expression vector and the second expression vector may be introduced into the host cell together or separately. From the perspective of shortening the steps and time required to produce the target cell, it is preferred that the first expression vector and the second expression vector be introduced into the host cell together.

[0141] When the first expression vector and the second expression vector are introduced into the host cell together, a vector solution containing the two expression vectors is prepared. In this vector solution, the molar concentration ratio of the first expression vector to the second expression vector is, for example, 1:5 to 5:1, 1:2 to 2:1, or 1:1.

[0142] When the first expression vector and the second expression vector are introduced separately into host cells, a vector solution containing the first expression vector and a vector solution containing the second expression vector are prepared. The molar concentration ratio of the expression vectors in the two vector solutions is, for example, 1:5 to 5:1, 1:2 to 2:1, or 1:1.

[0143] The expression vector introduced into the host cell may be integrated into the host cell genome, may be integrated into an extrachromosomal element such as a plasmid, or may be contained in the cell as an independent extrachromosomal element. From the perspective of achieving long-term expression of the desired multispecific antibody, the expression vector is preferably integrated into the host cell genome.

[0144] Selection of multispecific antibody-producing cells from host cells introduced with the vector set can be performed, for example, by setting a benchmark for the expression level and / or purity of the multispecific antibody and selecting cells that meet the benchmark; and / or selecting cells with relatively high expression level and / or purity of the multispecific antibody. Specifically, for example, the following (a) to (d) can be performed.

[0145] (a) Adding a selective agent to the culture medium of the host cells.

[0146] (b) The host cells are unicellularized.

[0147] (c) A portion of the culture medium of the monocytosed cells is collected and the expression level and / or purity of the multispecific antibody is measured.

[0148] (d) selecting cells whose expression level and / or purity of the multispecific antibody is higher than a reference value and / or selecting cells whose expression level and / or purity of the multispecific antibody is relatively high.

[0149] The expression level of the multispecific antibody is the amount of the multispecific antibody itself.

[0150] The purity of a multispecific antibody refers to the ratio of the target multispecific antibody to the total amount of multiple proteins (based on mass or quantity). During the expression of multispecific antibodies, multimeric proteins that are not in their original form may sometimes be produced (e.g., multimeric proteins lacking a portion of a polypeptide, or multimeric proteins in which one polypeptide is replaced by another). It is preferred that the ratio of multimeric proteins that are not in their original form be low.

[0151] Cells producing multispecific antibodies may be cells that transiently express the multispecific antibody or cells that stably express the antibody, but are preferably cells that stably express the antibody.

[0152] <Carrier group>

[0153] One embodiment of the present invention is a vector set for producing cells that produce multispecific antibodies. The vector set is a set of a first expression vector and a second expression vector.

[0154] The first expression vector contains all four expression cassettes for the four polypeptides that constitute the multispecific antibody. Specifically, the first expression vector contains an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain. By introducing the first expression vector into host cells, expression of the four polypeptides is ensured.

[0155] The second expression vector contains an expression cassette for a polypeptide of interest (typically a polypeptide whose expression is desired to be enhanced) among the four polypeptides constituting the multispecific antibody. The polypeptides of interest are one, two, or three. That is, the second expression vector contains one, two, or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain. By introducing the second expression vector into the host cell in addition to the first expression vector, the number of expression cassettes for the polypeptide of interest introduced into the host cell is relatively increased, and expression of the polypeptide of interest is enhanced.

[0156] An example of an embodiment of the second expression vector includes an expression cassette comprising at least the first L chain and / or the second L chain. A preferred example includes an expression cassette comprising at least the first L chain and the second L chain. A vector set comprising this second expression vector increases the number of the first L chain and / or the second L chain expression cassette introduced into host cells, thereby enhancing expression of the first L chain and / or the second L chain. Enhanced expression of the first L chain and / or the second L chain (preferably both the first L chain and the second L chain) tends to increase the expression level and / or purity of the multispecific antibody.

[0157] As an example of an embodiment of the second expression vector, one can cite an embodiment that includes at least an expression cassette for a relatively large molecular weight chain (an expression cassette for the first H chain and / or an expression cassette for the second H chain). By including this second expression vector, the number of expression cassettes for the relatively large molecular weight chain introduced into the host cell is relatively increased, thereby enhancing the expression of the relatively large molecular weight chain (the first H chain and / or the second H chain). Enhanced expression of the relatively large molecular weight chain tends to increase the expression level and / or purity of the multispecific antibody.

[0158] As an example of an embodiment of the second expression vector, one can cite an embodiment that includes at least an expression cassette for the largest molecular weight H chain (an expression cassette for the first H chain or a second H chain). By including this second expression vector, the number of expression cassettes for the largest molecular weight H chain introduced into the host cell is relatively increased, and expression of the largest molecular weight H chain (the first H chain or the second H chain) is enhanced. By enhancing expression of the largest molecular weight H chain, the expression level and / or purity of the multispecific antibody tends to increase.

[0159] An example of an embodiment of the second expression vector includes an expression cassette for the largest molecular weight H chain (the first H chain expression cassette or the second H chain expression cassette), an expression cassette for the first L chain, and an expression cassette for the second L chain. A vector set comprising this second expression vector increases the number of expression cassettes for the largest molecular weight H chain, the first L chain expression cassette, and the second L chain expression cassette introduced into host cells, thereby enhancing expression of the largest molecular weight H chain (the first H chain or the second H chain), the first L chain, and the second L chain. Enhanced expression of the largest molecular weight H and L chains tends to increase the expression level and / or purity of the multispecific antibody.

[0160] An example embodiment of the second expression vector includes an expression cassette for the H chain predicted to have the lowest expression rate based on experimental data or coding sequences (the first H chain expression cassette or the second H chain expression cassette), an expression cassette for the first L chain, and an expression cassette for the second L chain. A vector set comprising this second expression vector increases the number of expression cassettes for the H chain with the lowest expression rate, the first L chain expression cassette, and the second L chain expression cassette introduced into host cells, thereby enhancing expression of the H chain with the lowest expression rate (the first H chain or the second H chain), the first L chain, and the second L chain. By enhancing expression of the H and L chains with the lowest expression rates, the expression level and / or purity of the multispecific antibody tends to increase.

[0161] The sizes of the first expression vector and the second expression vector are not limited.

[0162] The size of the first expression vector is, for example, 5000 bp to 50,000 bp (base pair), 8000 bp to 40,000 bp, or 10,000 bp to 30,000 bp.

[0163] The size of the second expression vector is, for example, 5000 bp to 50,000 bp (base pair), 8000 bp to 40,000 bp, or 10,000 bp to 30,000 bp.

[0164] The polypeptide expression cassette contains all nucleic acids required for the expression of the polypeptide. The size and base sequence of the polypeptide expression cassette are not limited. The size of a single expression cassette for a polypeptide constituting a multispecific antibody is, for example, 400 bp to 4000 bp (basepair), 600 bp to 3000 bp, or 800 bp to 2000 bp.

[0165] The first expression vector comprises an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain. The four expression cassettes contained in the first expression vector may be one or two or more of each type, and may be the same or different in type. That is, in the first expression vector, the number of expression cassettes for the first H chain, the number of expression cassettes for the second H chain, the number of expression cassettes for the first L chain, and the number of expression cassettes for the second L chain are independent of each other and may be exactly the same or different.

[0166] As an example of an embodiment of the first expression vector, there can be mentioned an embodiment in which the ratio of the number of the four expression cassettes is 1st H chain: 2nd H chain: 1st L chain: 2nd L chain = 1:1:1:1.

[0167] From the viewpoint of reducing the size of the first expression vector, the first expression vector preferably contains one expression cassette each of the first H chain, the second H chain, the first L chain, and the second L chain.

[0168] The second expression vector comprises one, two, or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain. When the second expression vector comprises one expression cassette selected from the four types, the number of each expression cassette may be one or two or more. When the second expression vector comprises two or three expression cassettes selected from the four types, the number of each of the two or three expression cassettes may be one or two or more, and the two or three expression cassettes may be the same or different. That is, when two or three expression cassettes are selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain, the number of the two or three expression cassettes in the second expression vector is independent of each other and may be exactly the same or different.

[0169] When the second expression vector contains two expression cassettes selected from the four types, an embodiment in which the ratio of the number of expression cassettes is 1:1 can be given as an example of this embodiment.

[0170] When the second expression vector contains three expression cassettes selected from the four types, an embodiment in which the ratio of the number of expression cassettes is 1:1:1 can be given as an example of this embodiment.

[0171] From the viewpoint of reducing the size of the second expression vector, the second expression vector preferably contains one, two, or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

[0172] From the viewpoint of reducing the size of the expression vector, the vector set of the present invention preferably comprises a first expression vector comprising one each of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain, and a second expression vector comprising one each of one, two, or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

[0173] With Figure 1 The tetrameric antibody has the morphology shown and has Figure 2 In the following description, the first H chain is referred to as "HC1," the second H chain is referred to as "HC2," the first L chain is referred to as "LC1," and the second L chain is referred to as "LC2."

[0174] As an expression of Figure 1 An example of an embodiment of a vector set for a tetrameric antibody of the form shown is as follows: the first expression vector comprises an expression cassette for HC1, an expression cassette for HC2, an expression cassette for LC1, and an expression cassette for LC2, and the second expression vector comprises an expression cassette for LC1 and an expression cassette for LC2. This embodiment enhances the expression of the L chain.

[0175] As a more preferred example of the above embodiment, the following embodiment can be mentioned: the first expression vector contains one expression cassette each of HC1 expression cassette, HC2 expression cassette, LC1 expression cassette, and LC2 expression cassette; the second expression vector contains one expression cassette each of LC1 expression cassette and LC2 expression cassette.

[0176] As an expression of Figure 2 An example embodiment of a vector set for a pentameric antibody of the form shown is as follows: the first expression vector comprises an expression cassette for HC1, an expression cassette for HC2, an expression cassette for LC1, and an expression cassette for LC2, and the second expression vector comprises an expression cassette for LC1 and an expression cassette for LC2. This embodiment enhances the expression of the L chain.

[0177] As a more preferred example of the above embodiment, the following embodiment can be mentioned: the first expression vector contains one expression cassette each of HC1 expression cassette, HC2 expression cassette, LC1 expression cassette, and LC2 expression cassette; the second expression vector contains one expression cassette each of LC1 expression cassette and LC2 expression cassette.

[0178] As an expression of Figure 2 An example embodiment of a vector set for a pentameric antibody of the form shown is as follows: a first expression vector comprises an expression cassette for HC1, an expression cassette for HC2, an expression cassette for LC1, and an expression cassette for LC2, and a second expression vector comprises an expression cassette for LC2. This embodiment enhances the expression of two LC2s in a single antibody.

[0179] As a more preferred example of the above embodiment, the first expression vector includes one expression cassette each of HC1, HC2, LC1, and LC2, and the second expression vector includes one expression cassette of LC2.

[0180] As an expression of Figure 2 An example embodiment of a vector set for a pentameric antibody of the form shown is as follows: a first expression vector comprises an expression cassette for HC1, an expression cassette for HC2, an expression cassette for LC1, and an expression cassette for LC2, and a second expression vector comprises an expression cassette for HC1. This embodiment enhances expression of HC1, which has the largest molecular weight.

[0181] As a more preferred example of the above embodiment, the first expression vector includes one expression cassette each of HC1 expression cassette, HC2 expression cassette, LC1 expression cassette, and LC2 expression cassette, and the second expression vector includes one expression cassette of HC1.

[0182] As an expression of Figure 2 An example embodiment of a vector set for a pentameric antibody of the form shown is as follows: a first expression vector comprises an expression cassette for HC1, an expression cassette for HC2, an expression cassette for LC1, and an expression cassette for LC2; and a second expression vector comprises an expression cassette for HC1, an expression cassette for LC1, and an expression cassette for LC2. This embodiment enhances expression of the HC1 and L chains, which have the largest molecular weights.

[0183] As a more preferred example of the above embodiment, the following embodiment can be cited: the first expression vector contains one expression cassette each of HC1, HC2, LC1, and LC2; and the second expression vector contains one expression cassette each of HC1, LC1, and LC2.

[0184] As an expression of Figure 2 An example embodiment of a vector set for a pentameric antibody of the form shown is as follows: a first expression vector comprises an expression cassette for HC1, an expression cassette for HC2, an expression cassette for LC1, and an expression cassette for LC2; and a second expression vector comprises an expression cassette for HC1 and an expression cassette for LC2. This embodiment enhances the expression of HC1, which has the largest molecular weight, and LC2, which has two copies per antibody.

[0185] As a more preferred example of the above embodiment, the following embodiment can be mentioned: the first expression vector contains one expression cassette each of HC1 expression cassette, HC2 expression cassette, LC1 expression cassette, and LC2 expression cassette; the second expression vector contains one expression cassette each of HC1 expression cassette and LC2 expression cassette.

[0186] The nucleic acid and base sequence used as the basis for constructing an expression vector are not limited. Examples of nucleic acids used as the basis for constructing an expression vector include nucleic acids derived from viral vectors, nucleic acids derived from non-viral vectors, and artificial nucleic acids. The basis nucleic acid may be circular or linear.

[0187] Examples of nucleic acids derived from viral vectors include nucleic acids derived from adenovirus, adeno-associated virus, retrovirus, vaccinia virus, poxvirus, lentivirus, herpes virus, baculovirus, or bacteriophage.

[0188] Examples of nucleic acids derived from non-viral vectors include plasmids.

[0189] The expression vector and expression cassette contain elements necessary for the expression of the polypeptide depending on the type of host cell.

[0190] When the host cell is a prokaryotic cell, the expression vector may contain, for example, a replication origin, a restriction enzyme site, a transcription terminator, and a plasmid stability locus such as a cer stability sequence.

[0191] When the host cell is yeast, the expression vector may contain, for example, a promoter, a transcription terminator, a selectable marker, and an origin of replication.

[0192] When the host cell is an insect cell, the expression vector may contain, for example, a promoter, a transcription terminator, and a selectable marker.

[0193] When the host cell is a mammalian cell, the expression vector may, for example, contain a promoter, a polyadenylation sequence (e.g., human β-globin polyA sequence, bovine growth hormone polyA sequence, SV40 early polyA sequence (SV40 early polyA), SV40 late polyA sequence (SV40 late polyA)) and a selection marker.

[0194] Promoters that can be used in prokaryotes include those disclosed in J. Mol. Biol. 1986; 189(1): 113-30, phage polymerase promoters, and E. coli polymerase promoters. Specific examples include T7A1, T7A2, T7A3, λpL, λpR, lac, lacUV5, trp, tac, trc, phoA, and rrnB.

[0195] Examples of promoters that can be used in yeast cells include the gal promoter, AOX1 promoter, AOX2 promoter, GAP promoter, GAL1 promoter, and GAL10 promoter.

[0196] Examples of promoters that can be used in insect cells include the polyhedrin promoter, P10 promoter, viral infection early expression protein (IE-1) promoter, MT promoter, COPIA promoter, CMV promoter, RSV promoter, SV40 promoter, heat shock protein promoter, OPIE2 promoter, and actin 5C promoter.

[0197] As examples of promoters that can be used in mammalian cells, promoters derived from viruses and promoters derived from housekeeping genes can be enumerated. As examples of promoters derived from viruses, human CMV promoter, rat CMV promoter, SV40 promoter, RSR-LTR promoter and HSK-TK promoter can be enumerated. As examples of promoters derived from housekeeping genes, hEF-1α promoter, Chinese hamster EF-1α promoter, β-actin promoter and mouse phosphoglycerate kinase (mPGK) promoter can be enumerated. A preferred example of a promoter that can be used in mammalian cells is EF-1α promoter, more preferably hEF-1α promoter.

[0198] The promoters contained in the expression cassettes for the four polypeptides constituting the multispecific antibody may be of the same or different types. In one embodiment, the expression cassettes for the four polypeptides constituting the multispecific antibody all contain promoters of the same type. In a preferred embodiment, the expression cassettes for the four polypeptides constituting the multispecific antibody all contain the hEF-1α promoter.

[0199] The expression cassette of the polypeptide constituting the multispecific antibody preferably contains a coding sequence for a secretory signal peptide to promote the extracellular transport or secretion of the expressed antibody polypeptide. A secretory signal peptide is a type of signal peptide that induces the extracellular transport or secretion of a polypeptide.

[0200] When the expression cassette for the polypeptide constituting the multispecific antibody contains a coding sequence for a secretory signal peptide, the coding sequence for the secretory signal peptide and the coding sequence for the antibody polypeptide are arranged in the same reading frame. Here, "arranged in the same reading frame" means that the secretory signal peptide and the antibody polypeptide are arranged as two coding sequences so that they can be expressed as a single polypeptide. In the expression cassette for the antibody polypeptide, a coding sequence for a linker or spacer may or may not be present between the coding sequence for the secretory signal peptide and the coding sequence for the antibody polypeptide.

[0201] A preferred embodiment is one in which the coding sequence for the antibody polypeptide is arranged in the same reading frame downstream of the coding sequence for the secretory signal peptide. From the expression cassette of this embodiment, a recombinant polypeptide having a secretory signal peptide arranged at the N-terminus of the antibody polypeptide is expressed. A more preferred embodiment is one in which the coding sequence for the antibody polypeptide is arranged continuously in the same reading frame downstream of the coding sequence for the secretory signal peptide. From the expression cassette of this embodiment, a recombinant polypeptide having a secretory signal peptide bound to the N-terminus of the antibody polypeptide is expressed. Here, "downstream" refers to the order in which two coding sequences are arranged. When two coding sequences are arranged such that coding sequence A is transcribed followed by coding sequence B, coding sequence B can be said to be arranged downstream of coding sequence A.

[0202] The secretory signal peptide of a recombinant polypeptide is usually cleaved from the recombinant polypeptide during the delivery or secretion of the recombinant polypeptide.

[0203] Examples of secretion signal peptides include fibronectin secretion signal peptide, collagen secretion signal peptide, and albumin secretion signal peptide. From the viewpoint of high secretion rate of the recombinant polypeptide to the outside of the cell, the fibronectin secretion signal peptide is preferred.

[0204] Examples of fibronectin secretion signal peptides include those from amphibians and mammals. An example of an amphibian fibronectin secretion signal peptide is that from Xenopus laevis. Examples of mammalian fibronectin secretion signal peptides include those from humans, rats, cattle, pigs, dogs, cats, and Chinese hamsters, as well as functional equivalents thereof. Functional equivalents of fibronectin secretion signal peptides have an amino acid sequence identity of 70% or greater, preferably 75% or greater, more preferably 80% or greater, even more preferably 90% or greater, and most preferably 95% or greater, and function to secrete the recombinant polypeptide outside the cell. Sequence homology of amino acid sequences can be calculated, for example, using BLAST (Basic Local Alignment Search Tool) (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi).

[0205] The source organism of the fibronectin secretion signal peptide is preferably selected according to the type of host cell. When the host cell is a human cell, it is preferred to use the human fibronectin secretion signal peptide in the expression cassette. When the host cell is a rat cell, it is preferred to use the rat fibronectin secretion signal peptide in the expression cassette. When the host cell is a CHO cell, it is preferred to use the Chinese hamster fibronectin secretion signal peptide in the expression cassette.

[0206] Examples of embodiments of the fibronectin secretion signal peptide include a human fibronectin secretion signal peptide having the amino acid sequence of SEQ ID NO: 1 and a Chinese hamster fibronectin secretion signal peptide having the amino acid sequence of SEQ ID NO: 2. An example of the coding sequence of SEQ ID NO: 1 is SEQ ID NO: 3. An example of the coding sequence of SEQ ID NO: 2 is SEQ ID NO: 4.

[0207] Serial number 1: Met Leu Arg Gly Pro Gly Pro Gly Leu Leu Leu Leu Ala Val GlnCys Leu Gly Thr Ala Val Pro Ser Thr Gly Ala(MLRGPGPGLLLLAVQCLGTAVPSTGA)

[0208] Serial number 2: Met Leu Arg Gly Pro Gly Pro Gly Leu Leu Leu Ala Val Leu CysLeu Gly Thr Ala Val Arg Cys Thr Glu Ala(MLRGPGPGLLLLAVLCLGTAVRCTEA)

[0209] Serial number 3:ATGCTGAGAGGCCCTGGACCTGGACTGCTGCTGCTGGCTGTGCAGTGTCTGGGAACCGCCGTGCCTTCTACCGGCGCC

[0210] Serial number 4: ATGCTCAGGGGTCCGGGACCCGGGCTGCTGCTGGCCGTCCTGTGCCTGGGGACAGCGGTGCGCTGTACCGAAGCC

[0211] As an example of an embodiment, there is a mode in which the expression cassettes for the four polypeptides constituting the multispecific antibody all contain a coding sequence for a fibronectin secretion signal peptide.

[0212] When the host cell is a human cell, it is preferred that the expression cassettes for all four polypeptides constituting the multispecific antibody contain the coding sequence for the human fibronectin secretion signal peptide.

[0213] When the host cell is a CHO cell, it is preferred that the expression cassettes for all four polypeptides constituting the multispecific antibody contain the coding sequence for the Chinese hamster fibronectin secretion signal peptide.

[0214] In a preferred embodiment, the expression cassettes for the four polypeptides constituting the multispecific antibody each comprise an hEF-1α promoter, a fibronectin secretion signal peptide coding sequence, an antibody polypeptide coding sequence, and a PolyA sequence operably linked to each other.

[0215] For the purpose of confirming the introduction of the expression vector into host cells or producing stably expressing cells, the expression vector preferably contains an expression cassette containing a selectable marker.

[0216] In the present invention, a selectable marker is a marker that functions to select cells into which an expression vector has been introduced, and refers to a gene incorporated into the expression vector and a protein encoded by the gene.

[0217] The expression cassette of the selection marker contains all nucleic acids required for expressing the selection marker. The size and base sequence of the expression cassette of the selection marker are not limited.

[0218] Examples of selection markers include proteins and genes that exhibit resistance to selection agents, and examples of selection agents include fermentation inhibitors and antibiotics.

[0219] As an example of an enzyme inhibitor selected as a drug, there is the DHFR-MTX system. In the DHFR-MTX system, the drug selected is methotrexate (MTX), and the selection marker is dihydrofolate reductase (DHFR) and its gene. The DHFR-MTX system is an effective system in host cells (e.g., CHO-DG44 cells) lacking the DHFR gene.

[0220] An example of an enzyme inhibitor as a selection agent is the GS-MSX system. In the GS-MSX system, the selection agent is methionine sulfenamide (MSX), and the selection marker is glutamine synthetase (GS) and its gene. The GS-MSX system is effective in host cells lacking the GS gene (e.g., GS knockout CHO cells).

[0221] When the selective agent is an antibiotic, an antibiotic-degrading enzyme and an antibiotic resistance gene serving as the gene for the antibiotic are selected markers. Examples include hygromycin resistance genes, neomycin resistance genes, puromycin resistance genes, chloramphenicol resistance genes, tetracycline resistance genes, erythromycin resistance genes, spectinomycin resistance genes, kanamycin resistance genes, G418 resistance genes, blasticidin resistance genes, zetamycin resistance genes, fluamphenicol resistance genes, and ampicillin resistance genes.

[0222] In one embodiment of a vector set, a first expression vector comprises an expression cassette for a first selectable marker, and a second expression vector comprises an expression cassette for a second selectable marker, wherein the first and second selectable markers are different types of selectable markers. For example, the first selectable marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene. For example, the second selectable marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

[0223] In one embodiment of a vector set, one of the first and second expression vectors contains an expression cassette for a dihydrofolate reductase gene or a glutamine synthetase gene, and the other contains an expression cassette for an antibiotic resistance gene. A preferred example of the expression cassette for the dihydrofolate reductase gene contains an mPGK promoter. A preferred example of the expression cassette for the glutamine synthetase gene contains an mPGK promoter. A preferred example of the expression cassette for the antibiotic resistance gene contains a viral-derived promoter.

[0224] From the perspective of increasing the amount of antibody polypeptide expressed from the first expression vector relative to the amount expressed from the second expression vector, a preferred vector set includes a dihydrofolate reductase gene or a glutamine synthetase gene as the first selection marker and an antibiotic resistance gene as the second selection marker. Expression vectors containing a dihydrofolate reductase gene or a glutamine synthetase gene tend to have an increased copy number in host cells compared to expression vectors containing antibiotic resistance genes.

[0225] The present invention does not exclude the use of a third expression vector in addition to the vector set (i.e., the first expression vector and the second expression vector). The third expression vector is used, for example, to express a polypeptide required for the growth or metabolism of the host cell.

[0226] Cells transfected with the vector group

[0227] One embodiment of the present invention is a mammalian cell transfected with a vector set. The mammalian cell transfected with the vector set can be a transiently expressing cell or a stably expressing cell of the multispecific antibody, but is preferably a stably expressing cell.

[0228] One embodiment of the present invention is a CHO cell transfected with a vector group. Specific examples include CHO-DG44 cells, CHO-K1 cells, CHO-DXB11 cells, CHOpro3 cells, and CHO-DG44 cells transfected with a vector group. - Cells and cell lines derived from these cells. CHO cells transfected with the vector group can be cells that transiently express the multispecific antibody or cells that stably express it, but stably expressing cells are preferred.

[0229] Mammalian cells and CHO cells transfected with the vector set of the present invention preferably have a greater total number of copies of the L chain expression cassette (first L chain + second L chain) than the total number of copies of the H chain expression cassette (first H chain + second H chain). This tends to increase the expression level and / or purity of the antibody.

[0230] The amount of mRNA measured by quantitative PCR (quantitative polymerase chain reaction) helps predict the copy number of the expression cassette present in the cell.

[0231] In the expression Figure 1 In mammalian cells and CHO cells transfected with a vector group containing a tetrameric antibody of the morphology shown, the mRNA amount measured by quantitative PCR is preferably 0.5 to 2 for the 2H chain, 2 to 5 for the 1L chain, and 2 to 5 for the 2L chain, when the mRNA amount of the 1H chain is set to 1.

[0232] In the expression Figure 2 In mammalian cells and CHO cells transfected with a vector group containing a pentameric antibody of the shown morphology, the mRNA amount measured by quantitative PCR is preferably 1 to 2 for the 1H chain mRNA, 2 to 5 for the 1L chain mRNA, and 2 to 10 for the 2L chain mRNA, when the 2H chain mRNA amount is set to 1.

[0233] The mammalian cells and CHO cells transfected with the vector set of the present invention are cells that express multispecific antibodies and can be used to produce multispecific antibodies. The mammalian cells and CHO cells transfected with the vector set of the present invention can also be used for administration, infusion or transplantation to mammals.

[0234] <Method for producing multispecific antibodies>

[0235] One embodiment of the present invention is a method for producing a multispecific antibody. The method comprises culturing cells that produce the multispecific antibody. The cells are cultured to produce the multispecific antibody within the cells, and the multispecific antibody accumulates in the culture medium and / or the cells.

[0236] The cells used in the method for producing multispecific antibodies are cells produced by the method for producing cells, which is one embodiment of the present invention. These cells are selected based on evaluation criteria and / or relative production performance related to multispecific antibodies, and therefore have excellent multispecific antibody productivity.

[0237] The culture method and medium composition for producing multispecific antibodies can be selected according to the type of host cells. Culture conditions (e.g., culture scale, cell density, temperature, and CO2 concentration) can also be selected according to the type of host cells.

[0238] One embodiment of a method for producing a multispecific antibody includes recovering the multispecific antibody from a culture medium. Examples of methods for recovering the multispecific antibody from the culture medium include centrifugation, filtration, diafiltration, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography, and high-performance liquid chromatography (HPLC). The recovered multispecific antibody is used, for example, in the manufacture of a pharmaceutical composition.

[0239] One embodiment of a method for producing a multispecific antibody includes a step of recovering cells that have accumulated the multispecific antibody from a culture medium. Examples of methods for recovering cells from a culture medium include centrifugation and filtration. Depending on their properties, the multispecific antibody accumulates inside or on the surface of the cells. The recovered cells can be administered, infused, or transplanted into a mammal, for example.

[0240] <Method for producing cell pool>

[0241] One embodiment of the present invention is a method for producing a cell pool. The method comprises introducing a vector assembly into host cells. The produced cell pool is used to select cells that produce multispecific antibodies. In the present invention, a cell pool refers to a population of cells that exhibits a diversity in the number of copies of the expression cassettes for the four polypeptides that comprise the multispecific antibody.

[0242] The size of the cell pool is not limited and may include, for example, 10 to 10,000 clones.

[0243] The host cells used in the method for producing the cell pool are preferably eukaryotic cells, more preferably mammalian cells, and even more preferably CHO cells. Examples of CHO cells include CHO-DG44 cells, CHO-K1 cells, CHO-DXB11 cells, CHOpro3 - cells and cell lines derived from these cells.

[0244] The cells contained in the cell pool may be cells transiently expressing the multispecific antibody or cells stably expressing the multispecific antibody, but are preferably cells stably expressing the multispecific antibody.

[0245] Cells can be cultured and maintained in cell pools or cryopreserved.

[0246] Example

[0247] The following specific examples provide a more detailed description of methods for producing cells and vector sets for producing multispecific antibodies. The materials, processing steps, and the like described in the following specific examples may be modified as appropriate without departing from the spirit of the present invention. The scope of the vector sets and the like of the present invention should not be construed as limiting the scope of the specific examples described below.

[0248] <Construction of expression vector>

[0249] Expression vectors 1 and 2 were constructed for expressing a bispecific antibody pentamer having two H chains having mutually different amino acid sequences and two L chains having mutually different amino acid sequences.

[0250] Hereinafter, the bispecific antibody will be referred to as "BiAb2," the two H chains will be referred to as "HC1" and "HC2," and the two L chains will be referred to as "LC1" and "LC2." HC1, HC2, LC1, and LC2 will be collectively referred to as "antibody subunits."

[0251] Figure 2 This is a schematic diagram of BiAb2. BiAb2 has a structure in which LC1 and LC2 bind to HC1, and LC2 binds to HC2. In BiAb2, HC1 and LC1 constitute the first epitope binding site, HC1 and LC2 constitute the second epitope binding site, and HC2 and LC2 constitute the third epitope binding site. The epitope recognized by the second epitope binding site is common to the epitope recognized by the third epitope binding site. BiAb2 is a bispecific antibody that binds to a first antigen via the first epitope binding site and to a second antigen via the second and / or third epitope binding sites.

[0252] Figure 3 This is a vector map of expression vector 1. Expression vector 1 contains one HC1 expression cassette, one HC2 expression cassette, one LC1 expression cassette, one LC2 expression cassette, and one DHFR gene expression cassette. Each antibody subunit expression cassette contains the hEF-1α promoter, the coding sequence for the fibronectin secretion signal peptide, the coding sequence for the antibody subunit, and a polyA sequence. The coding sequence for the antibody subunit is arranged continuously and in frame downstream of the coding sequence for the fibronectin secretion signal peptide.

[0253] Figure 4 This is a vector map of expression vector 2. Expression vector 2 contains one expression cassette for LC1, one expression cassette for LC2, and one expression cassette for the hygromycin resistance gene. Each antibody subunit expression cassette contains the hEF-1α promoter, the coding sequence for the fibronectin secretion signal peptide, the coding sequence for the antibody subunit, and a polyA sequence. The coding sequence for the antibody subunit is arranged continuously and in frame downstream of the coding sequence for the fibronectin secretion signal peptide.

[0254] <Introduction of expression vector into CHO cells>

[0255] Only expression vector 1, or both expression vector 1 and expression vector 2 were introduced into CHO-DG44 cells by electroporation.

[0256] CHO-DG44 cells introduced with the expression vector were inoculated into 10 mL of OptiCHO medium (Life technologies, 12681011) and statically cultured at 37°C in a CO2 5% (v / v) atmosphere.

[0257] One day after the expression vector introduction, methotrexate was added as a selection agent to CHO-DG44 cells introduced with expression vector 1 alone, and methotrexate and hygromycin B were added simultaneously as selection agents to CHO-DG44 cells introduced with both expression vectors 1 and 2.

[0258] Fourteen days after the introduction of the expression vector, the culture volume was expanded to 20 mL, transferred to a 125 mL flask for shaking culture, and shake culture was performed.

[0259] <Selection of BiAb2-producing cells>

[0260] The shaken cultured cells were dispensed into 96-well plates, one cell per well, using a microdroplet cell sorter and statically cultured at 37°C in an atmosphere of 10% (v / v) CO2. After 14 days of culture, the culture supernatant was recovered and the antibody concentration was measured using the Octet Qke (Sartorius) molecular interaction analyzer. Clones with high antibody concentrations were selected and cultured in 24-well plates, followed by culture in bioreactor tubes and scaled up for production. In this way, cells producing BiAb2 were generated.

[0261] BiAb2-producing cells produced by introducing only expression vector 1 are referred to as BiAb2-QGV cells. BiAb2-producing cells produced by introducing both expression vector 1 and expression vector 2 are referred to as BiAb2-QGV / DGV cells.

[0262] Production of BiAb2

[0263] BiAb2-QGV cells and BiAb2-QGV / DGV cells were suspended in 40 mL of basal medium, transferred to a 125 mL flask for shaking culture, and cultured and fed at 140 rpm at a temperature of 37°C and a CO25% (v / v) atmosphere. From the third day to the 13th day of culture, a specified amount of supplementary medium was added every day. Samples were taken every 1 to 3 days to measure cell density, culture medium composition, and antibody concentration. The culture medium was recovered on the 14th day of culture, and cells and cell debris were removed using a depth filter (pore size 0.22 μm) to obtain the culture supernatant.

[0264] The antibody concentration in the culture supernatant was determined by liquid chromatography using a Protein A column. Antibodies were purified from the culture supernatant using a Protein A column, and the quantification of BiAb2 and mismatched antibodies (antibodies with only HC1 H chain and antibodies with only HC2 H chain) was performed using a CE-SDS analyzer PA800 Plus (SCIEX) to determine the purity of BiAb2. Here, purity refers to BiAb2 / (BiAb2+mismatched antibodies)×100(%). Table 1 shows the measurement results of the clone with the highest antibody concentration. The Qp shown in Table 1 refers to the antibody production per day and per cell, and is the antibody production excluding mismatched antibodies.

[0265] The mRNA levels of the antibody subunits in each clone were measured by quantitative PCR. The measurement results for the clone with the highest antibody concentration are shown in Table 2. The values ​​shown in Table 2 are relative values ​​when the mRNA level of each antibody subunit in BiAb2-QGV cells is set to 1.

[0266] [Table 1]

[0267]

[0268] [Table 2]

[0269]

[0270] Since BiAb2-QGV cells are cells transfected with expression vector 1, it is expected that the ratio of the number of expression cassettes retained in the cells is HC1:HC2:LC1:LC2=1:1:1:1.

[0271] BiAb2-QGV / DGV cells are transfected with expression vector 1 and expression vector 2, so the ratio of the number of expression cassettes retained in the cells is expected to be HC1:HC2:LC1:LC2=1:1:greater than 1:greater than 1.

[0272] This was confirmed by the relative mRNA expression levels shown in Table 2. Specifically, in BiAb2-QGV / DGV cells, HC1 was 1.2-fold, HC2 was 1.0-fold, LC1 was 2.0-fold, and LC2 was 3.0-fold relative to BiAb2-QGV cells.

[0273] In addition, it is speculated that the difference in the relative expression levels of LC1 and LC2 mRNA in BiAb2-QGV / DGV cells is caused by the difference in the transcription efficiency of each expression cassette.

[0274] As shown in Table 1, Qp (antibody productivity per cell) was 11.9 pg / cell / day for BiAb2-QGV cells and 16.6 pg / cell / day for BiAb2-QGV / DGV cells, representing 1.4 times the level of BiAb2-QGV cells. It is speculated that the excess expression of LC1 and LC2 contributes to the Qp in BiAb2-QGV / DGV cells (1.4 times that of BiAb2-QGV cells).

[0275] By selecting CHO cells expressing BiAb2 at high levels and with high purity from CHO cells transfected with the vector set of expression vector 1 and expression vector 2, CHO cells with excellent BiAb2 productivity can be produced.

[0276] All documents, patent applications, and technical standards described in this specification are incorporated herein by reference to the same extent as if each individual document, patent application, or technical standard was specifically and individually indicated to be incorporated by reference.

[0277] The disclosure of Japanese application No. 2023-023760 filed on February 17, 2023 is incorporated herein by reference in its entirety.

Claims

1. A method for producing a cell that produces a multispecific antibody having four polypeptides, namely, a 1H chain, a 2H chain, a 1L chain, and a 2L chain. The method comprises: The step of introducing the following vector group into the host cell; and a step of selecting cells producing multispecific antibodies from host cells into which the vector set has been introduced, Vector set: a set of the first expression vector and the second expression vector, The first expression vector comprises an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain. The second expression vector comprises one, two or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

2. The method for producing cells according to claim 1, wherein The second expression vector comprises an expression cassette for the first L chain and an expression cassette for the second L chain.

3. The method for producing cells according to claim 1, wherein The multispecific antibody is a pentamer in which the 1st L chain and the 2nd L chain are bound to the 1st H chain, and the 2nd L chain is bound to the 2nd H chain.

4. The method for producing cells according to claim 1, wherein The first expression vector comprises one expression cassette for the first H chain, one expression cassette for the second H chain, one expression cassette for the first L chain, and one expression cassette for the second L chain. The second expression vector comprises one, two or three expression cassettes each selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain and an expression cassette for the second L chain.

5. The method for producing cells according to claim 1, wherein The expression cassettes for the polypeptides constituting the multispecific antibody all contain the same type of promoter.

6. The method for producing cells according to claim 1, wherein The first expression vector further comprises an expression cassette for a first selection marker, The second expression vector further comprises an expression cassette for a second selection marker.

7. The method for producing cells according to claim 1, wherein The host cell is a mammalian cell.

8. The method for producing cells according to claim 1, wherein The host cell is a CHO cell.

9. A method for producing a multispecific antibody, comprising: A step of culturing cells produced by the method for producing cells according to any one of claims 1 to 8.

10. A vector set for expressing a multispecific antibody having four polypeptides, namely, a first H chain, a second H chain, a first L chain, and a second L chain. It is a set of the first expression vector and the second expression vector, The first expression vector comprises an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain. The second expression vector comprises one, two or three expression cassettes selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain, and an expression cassette for the second L chain.

11. The carrier set according to claim 10, wherein The second expression vector comprises an expression cassette for the first L chain and an expression cassette for the second L chain.

12. The carrier set according to claim 10, wherein The multispecific antibody is a pentamer in which the 1st L chain and the 2nd L chain are bound to the 1st H chain, and the 2nd L chain is bound to the 2nd H chain.

13. The carrier set according to claim 10, wherein The first expression vector comprises one expression cassette for the first H chain, one expression cassette for the second H chain, one expression cassette for the first L chain, and one expression cassette for the second L chain. The second expression vector comprises one, two or three expression cassettes each selected from the group consisting of an expression cassette for the first H chain, an expression cassette for the second H chain, an expression cassette for the first L chain and an expression cassette for the second L chain.

14. The carrier set according to claim 10, wherein The expression cassettes for the polypeptides constituting the multispecific antibody all contain the same type of promoter.

15. The carrier set according to claim 10, wherein The first expression vector further comprises an expression cassette for a first selection marker, The second expression vector further comprises an expression cassette for a second selection marker. 16 . A mammalian cell, which is a cell transfected with the vector set according to any one of claims 10 to 15 . 17 . A CHO cell transfected with the vector set according to claim 10 .

18. A method for producing a cell pool, comprising: A step of introducing the vector group according to any one of claims 10 to 15 into a host cell.

19. The method for producing a cell pool according to claim 18, wherein: The host cell is a mammalian cell.

20. The method for producing a cell pool according to claim 18, wherein: The host cell is a CHO cell.

Images