Application of SIX family homologous box gene 4 inhibitor in preparation of medicine for promoting growth of neurons of peripheral nervous system

Abstract

The invention discloses an application of an SIX family homologous box gene 4 inhibitor in preparation of drugs for promoting growth of neurons of a peripheral nervous system, and the inhibitor inhibits expression of the SIX family homologous box gene 4 through nucleic acid molecules loaded by a carrier so as to realize regulation and control of the neurons of the peripheral nervous system. The invention provides and verifies for the first time that inhibition of expression of the SIX family homologous box gene 4 can promote growth of neurons of the peripheral nervous system, effective regeneration of dorsal root ganglions is realized, recovery of related functions is accelerated, and a new direction is provided for research and development of drugs for treating traumatic or disease injuries of neurons of the peripheral nervous system.

Description

Technical Field

[0001] The present invention relates to gene therapy, and in particular to the use of a SIX family homeobox gene 4 inhibitor in the preparation of a drug for promoting the growth of neurons in the peripheral nervous system. Background Art

[0002] Neurons are the basic functional units of the nervous system, and their unique morphological structure includes cell bodies, dendrites, and axons. Dendrites are responsible for receiving signals, while axons are responsible for transmitting electrochemical signals over long distances to other neurons, muscles, or glands. The maintenance of normal morphology and structural integrity of neuronal processes are the basis for nerve signal transmission and the physiological function of the nervous system. Traumatic nerve injuries, such as spinal cord injury and peripheral nerve rupture, can directly lead to axonal pinching, rupture, or long-distance defects, blocking signal conduction pathways and causing functional disorders. In addition, a variety of neurological diseases are also accompanied by neuronal process damage, such as retinal ganglion cell axon degeneration in glaucoma, motor neuron axonopathy in amyotrophic lateral sclerosis (ALS), and axonal degeneration in diabetic peripheral neuropathy. These pathological processes ultimately lead to progressive loss of nerve function.

[0003] Promoting the regeneration of neuronal processes is a core strategy for treating nerve injury and related diseases. However, the regenerative capacity of adult mammalian neurons is significantly limited. The reasons for this are, on the one hand, the presence of inherent regeneration inhibitory molecules in the neuronal cell body, and on the other hand, the presence of inhibitory factors such as peripheral myelin-associated glycoproteins in the injury microenvironment, which together form a regeneration barrier. Recent studies have shown that growth-promoting molecules such as GAP43 and STAT3, which are highly expressed during development, can be reactivated during regeneration, while certain inhibitory molecules that are active during development are continuously expressed in adult neurons and may hinder regeneration. Therefore, targeted inhibition of such molecules is expected to become a new way to promote axon regeneration.

[0004] SIX family homeobox 4 (Six4) is an evolutionarily conserved transcription factor encoded by the Six4 gene. It regulates downstream gene expression by binding to specific DNA sequences. It is crucial for embryonic development and participates in the development of multiple organs. Recent studies have found that Six4 can promote the secretion of proinflammatory cytokines by reactive astrocytes after central nervous system injury, potentially indirectly affecting the process of neural repair. However, the role of Six4 in peripheral nervous system (PNS) injury and repair remains unclear. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a use of a SIX family homeobox gene 4 inhibitor in the preparation of a drug for promoting the growth of peripheral nervous system neurons to treat traumatic or disease-related damage to peripheral nervous system neurons.

[0006] Technical solution: Use of the SIX family homeobox gene 4 inhibitor of the present invention in the preparation of a drug for promoting the growth of neurons in the peripheral nervous system.

[0007] Preferably, the inhibitor is a nucleic acid molecule carried by a vector, wherein the vector includes a viral vector or a non-viral vector; and the nucleic acid molecule is siRNA, shRNA or an expression frame encoding shRNA.

[0008] Preferably, the application is application in the preparation of a drug for treating traumatic injury to neurons in the peripheral nervous system, wherein the traumatic injury to neurons in the peripheral nervous system is physical injury directly caused by external force.

[0009] Preferably, the application is the application in the preparation of a drug for treating peripheral nervous system disease damage, wherein the peripheral nervous system disease damage is physiological damage caused by abnormal intrinsic biological processes.

[0010] Preferably, the drug comprises a SIX family homeobox gene 4 inhibitor as an active ingredient, and pharmaceutically acceptable excipients.

[0011] Preferably, the dosage form of the drug is granules, tablets, capsules, oral liquids, pills, emulsions, suspensions, injections, infusions or sprays.

[0012] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The present invention proposes and verifies for the first time that inhibiting the expression of SIX family homeobox gene 4 can promote the growth of neurons in the peripheral nervous system, achieve effective regeneration of dorsal root ganglia, and accelerate the recovery of its related functions; 2. It provides a new direction for the research and development of therapeutic drugs for traumatic or disease-related damage to neurons in the peripheral nervous system. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The expression analysis of the Six4 gene in newborn SD rats and adult SD rats is shown in Figure A. The visualization of single-cell sequencing results using t-SNE nonlinear clustering processing, and Figure B is the expression comparison of the Six4 gene detected by RT-PCR.

[0014] Figure 2 Figure 2 shows the expression of Six4 gene in rat DRG neurons after sciatic nerve injury. A shows the statistical results of transcriptome sequencing, and B shows the results of RT-PCR detection of Six4 gene expression at different time points after sciatic nerve injury.

[0015] Figure 3This figure shows the analysis of gene expression levels and growth in rat DRG neurons after transfection with siRNA Six4. Figure A is a statistical graph of Six4 gene expression levels detected by RT-PCR after transfection, Figure B is a microscopic image of Tuj1 immunofluorescence staining after transfection, with a scale bar of 50 μm, and Figure C is a statistical graph of the total length and longest length of neuronal axons.

[0016] Figure 4 Figure 3: Analysis of the growth of rat DRG neurons in the myelin inhibitory microenvironment after transfection with siRNA Six4. A is a microscopic image of Tuj1 immunofluorescence staining after culture with and without myelin after transfection. The scale bar is 50 μm. B is a statistical graph of the total length and longest length of neuronal axons.

[0017] Figure 5 After rat DRG neurons were transfected with siRNA Six4, the growth of regenerated axons after axon injury was analyzed using a microfluidic cell culture system. A is a microscopic image of Tuj1 immunofluorescence staining, with a scale bar of 100 μm. B is a statistical chart of the total length of neuronal axons.

[0018] Figure 6 Figure 2: Analysis of gene expression levels in rats after intrathecal injection of Six4 shRNA-AAV virus or control. (A) Statistical graph of Six4 gene expression levels detected by RT-PCR, (B) microscopic image of Tuj1 and Six4 immunofluorescence staining, scale bar: 100 μm.

[0019] Figure 7 Figure 1 shows the results of SCG10 immunofluorescence staining of regenerated axons in rats 21 days after intrathecal injection of Six4 shRNA-AAV virus or control and 3 days after sciatic nerve crush. Figure A is a microscopic image, scale bar, 1000 μm, and Figure B is a statistical graph of relative regenerated length.

[0020] Figure 8 The following graphs show the results of muscle action potential detection in rats 21 days after intrathecal injection of Six4 shRNA-AAV virus or control and 21 days after sciatic nerve crush. A is the electrophysiological signal of compound muscle action potential measurement, and B is the statistical graph of muscle action potential amplitude.

[0021] Figure 9 Figure 21 days after intrathecal injection of Six4 shRNA-AAV virus or control, and 1, 2, and 3 weeks after sciatic nerve crush, the skin at the base of the rat paw was stimulated with Von Frey fibers, and the paw withdrawal threshold was measured to assess sensory function recovery.

[0022] Figure 10Figure 21 days after intrathecal injection of Six4 shRNA-AAV virus or control, and 1, 2, and 3 weeks after sciatic nerve crush, the recovery of thermal pain function was assessed by measuring the paw withdrawal reaction time under thermal radiation. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described below.

[0024] Example 1: Analysis of Six4 gene expression in newborn SD rats and adult SD rats

[0025] Ten newborn and adult SD rats were selected, and the dorsal lamina was cut horizontally from the head to the back using surgical scissors to remove the spinal cord. The DRG tissue was removed from the intervertebral foramen using microtweezers and the axons were cut off. The tissue was placed in a small dish filled with dissection fluid and kept on ice throughout the process.

[0026] The removed DRG tissue was cut into small segments and digested with type I collagenase for 1.5 hours and trypsin for 5 minutes, respectively. The cells were then resuspended in 15% BSA and centrifuged to obtain a pellet containing DRG neurons. The pellet was further washed with complete neuronal culture medium and then resuspended.

[0027] The cell suspension was loaded into 10× Chromium, and barcode-labeled micromagnetic beads were added. The oil droplets were isolated to form GEMs, which were then recovered and transferred. After cell lysis, Shanghai Xinhe Bioinformatics Technology Co., Ltd. was commissioned to perform single-cell sequencing using Illumina NovaSeq.

[0028] For the sequencing results, t-SNE nonlinear clustering was used to visualize the cell atlas, and the FindAllMarkers function was used to determine the characteristic expression genes of each cell population to analyze the gene expression in neurons in the dorsal root ganglion tissue of newborn and adult rats.

[0029] The results are as follows Figure 1 As shown, Figure 1 A is the expression of Six4 gene in neurons of dorsal root ganglia of newborn and adult rats detected by t-SNE nonlinear clustering; Figure 1 B is the statistical result of the average expression level of Six4 gene. The data show that the expression of Six4 gene in neurons of dorsal root ganglion of newborn rats is much lower than that in neurons of adult rats.

[0030] Example 2: Analysis of Six4 gene expression in rat DRG neurons after sciatic nerve injury

[0031] Eighteen 8-week-old Sprague-Dawley rats underwent an oblique incision at the hip to expose the nerves. A sciatic nerve crush was performed using a forceps at the sciatic nerve 1 cm above the bifurcation of the tibial and common peroneal nerves to establish a rat sciatic nerve crush model. Nine Sprague-Dawley rats were selected as the sham operation group, with the sciatic nerve exposed but not crushed.

[0032] Use surgical scissors to cut the dorsal lamina from the head side of the rat horizontally along the back to remove the spinal cord. Use micro forceps to remove the DRG tissue from the intervertebral foramen and cut off the axons. Place it in a small dish filled with dissection fluid and keep it on an ice box throughout the process.

[0033] Tissue RNA was extracted using the Yishan Company's rapid RNA extraction kit, and then the IIQ RT SuperMix for qPCR kit was used for reverse transcription and cDNA synthesis;

[0034] Guangzhou Kidio Biotechnology Co., Ltd. was commissioned to perform transcriptome sequencing to quantify gene expression and analyze the changes in gene expression in DRG tissue after sciatic nerve injury.

[0035] At the same time, ChamQTM RT-PCR detection was performed using the qPCR Master Mix system. The primer sequences for the target gene Six4 and the internal reference gene GAPDH are shown in Table 1 below, and the reaction conditions are shown in Table 2 below:

[0036] Table 1 Primer sequences for target gene Six4 and internal reference gene GAPDH

[0037] Primer name Primer sequence 5'→3' Six4 upstream primer CTGTCAATCACAACGCACAAGTAAA Six4 downstream primer CAATAGGTCTGGACCAGGAATAAGG GAPDH upstream primer ACAGCAACAGGGTGGTGGAC GAPDH downstream primers TTTGAGGTGCAGCGAACTT

[0038] Table 2 RT-PCR reaction conditions

[0039]

[0040] Fluorescence values ​​were collected during the extension phase of each cycle. After the amplification reaction, a melting curve analysis was performed to ensure the quality of the PCR product. Using GAPDH as an internal reference, the Ct values ​​of the target gene Six4 and the internal reference GAPDH were measured, and the relative expression of Six4 was calculated using the ΔΔCt method.

[0041] The results are as follows Figure 2 As shown in the figure, the transcriptome sequencing results showed that compared with the sham operation group, the expression of Six4 gene in DRG tissue was reduced 1 day, 4 days and 7 days after sciatic nerve injury; the RT-PCR results were consistent with the sequencing results, and the expression of Six4 gene in DRG tissue was reduced after sciatic nerve injury.

[0042] Example 3: Culture, transfection and growth detection of primary adult rat DRG neurons

[0043] 1. Culture of rat DRG neurons

[0044] Eight-week-old male Sprague Dawley rats were obtained. The dorsal lamina was cut horizontally along the back from the head of the rat using surgical scissors to remove the spinal cord. The DRG tissue was removed from the intervertebral foramen using microtweezers and the axons were cut off. The tissue was placed in a small dish containing dissection fluid and kept on ice throughout the process. The removed DRG tissue was cut into small pieces and digested with collagenase for 1.5 hours and trypsin for 5 minutes. The cells were then resuspended in 15% BSA and centrifuged to obtain a pellet containing DRG neurons. Cell culture was performed using Neurobasal A medium containing B27 and L-glutamine, and DRG neurons were seeded on poly-L-lysine-coated culture dishes for cell culture.

[0045] 2. siRNA transfection of rat DRG neurons

[0046] Based on the published rat SIX family homeobox gene 4 sequence, the following siRNA sequence was designed:

[0047] Table 3 Six4 siRNA and inhibitor control sequences

[0048] Six4 siRNA name Sequence Listing Number Sequence 5'→3' siRNA-Six4-1 SEQ ID NO: 1 GCAAGGGACATGAGGATTT siRNA-Six4-2 SEQ ID NO: 2 CCGTCTTCCTTAATGGCAA siRNA-Six4-3 SEQ ID NO: 3 GCATTGTCCAGATCCCTAA siRNA-NC SEQ ID NO: 4 GGCTCTAGAAAAGCCTATGC

[0049] The above sequences were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. siRNA.

[0050] According to Lipofectamine TM According to the instructions of RNAiMAX transfection reagent, 100 pmol of Six4 siRNA-1, 2, or 3 was transfected into each well of DRG neurons cultured in 12-well plates to inhibit the expression of Six4, and 100 pmol of siRNA-NC was transfected as a control group.

[0051] 3.1. Detection of Six4 expression level after transfection

[0052] 36 h after transfection, total RNA was extracted and reverse transcribed using ChamQTM RT-PCR was performed using the qPCR Master Mix system. The primer sequences and reaction conditions for the target gene Six4 and the internal reference gene GAPDH were the same as in Example 2. Fluorescence values ​​were collected during the extension phase of each cycle. After the amplification reaction, melting curve analysis of the products was performed. Using GAPDH as an internal reference, the Ct values ​​of the target gene Six4 and the internal reference GAPDH were measured, and the relative expression of Six4 was calculated using the ΔΔCt method.

[0053] The results are as follows Figure 3As shown in A, compared with DRG neurons transfected with control siRNA (siRNA-NC), the expression levels of the Six4 gene in rat DRG neurons were significantly reduced after the siRNA fragments 1-3 targeting Six4 (siRNA-Six4-1, 2, 3) were transfected into rat DRG neurons, indicating that Six4 siRNA can inhibit the gene expression of Six4 in adult rat DRG neurons.

[0054] 3.2. Detection of Neuronal Protrusion Outgrowth after Transfection

[0055] 36 hours after transfection, cells were mounted on slides and fixed with 4% paraformaldehyde (PFA) for immunofluorescence staining. Tuj-1 was labeled with green fluorescence to observe the length of Tuj-1-labeled neuronal processes and to detect the effect of Six4 inhibitor on the growth of rat DRG neuronal processes.

[0056] The results are as follows Figure 3 As shown in BC, after rat DRG neurons were transfected with siRNA-Six4-2 or 3, the longest process length and total process length of DRG neurons were significantly increased compared with DRG neurons transfected with control siRNA, indicating that Six4 inhibitors can promote the growth of rat DRG neuron processes.

[0057] 3.3. Detection of neuronal process growth in myelin-coated culture dishes after transfection

[0058] Myelin was extracted from whole brain of adult rats.

[0059] (1) Add 20 mL of 0.30 M sucrose solution to a beaker and place it on ice for pre-cooling. Then add the whole brains of 8 adult rats and record the brain weight.

[0060] (2) Grind the brain tissue using a clean, sterile glass homogenizer. Place the ground tissue in a 100 mL graduated cylinder and dilute to 72 mL with 0.30 M sucrose solution. Add equal amounts of brain tissue homogenate and 0.83 M sucrose solution to an ultracentrifuge tube and centrifuge at 75,000 g at 4°C for 30 min. After centrifugation, the liquid will separate into three phases. Discard the upper 0.30 M sucrose solution and collect the crude myelin layer formed at the interface between the two sucrose solutions.

[0061] (3) Resuspend the crude myelin in 20 mL of Tris-HCl buffer, homogenize, and centrifuge at 75,000 g at 4°C for 15 min. Discard the supernatant. Add Tris-HCl buffer to a volume of 228 mL and centrifuge at 12,000 g at 4°C for 15 min.

[0062] (4) The collected precipitate was suspended in 72 mL of 0.30 M sucrose solution, and steps 2-3 were repeated to obtain a final concentration of 4.7 μg / μL purified myelin, which was stored at -20°C.

[0063] (5) 1 μL of the myelin obtained above was added to 470 μL of a 100 μg / mL poly-L-lysine solution and mixed evenly. The mixture was added to a 12-well cell culture plate and placed in an incubator for 2 h to obtain a myelin-coated poly-L-lysine-coated cell culture plate for use.

[0064] 36 hours after transfection, the cells were resuspended and inoculated into 12-well cell culture plates coated with poly-L-lysine without or with myelin. After further culture for 24 hours, the cells were fixed with 4% paraformaldehyde and stained with immunofluorescence. Tuj-1 was labeled with green fluorescence to observe the length of Tuj-1-labeled neuronal processes and to detect the effect of knocking down Six4 on the growth of rat DRG neuronal processes.

[0065] The results are as follows Figure 4 As shown, on myelin-coated cell culture dishes, after transfection of Six4 siRNA, the longest length and total length of the axons of adult rat DRG neurons increased significantly, indicating that Six4 inhibitors can effectively promote the growth of axons of adult rat DRG neurons in the inhibitory microenvironment of myelin.

[0066] 3.4. Detection of axon regeneration in damaged neurons after transfection

[0067] (1) A sterile microfluidic chamber was placed on a culture dish coated with poly-L-lysine. The microfluidic chamber was rinsed with complete culture medium and then discarded. 3 μL of the cell suspension containing 20,000 cells transfected with Six4 siRNA was added to the well on the left side of the microfluidic chamber and allowed to flow into the axon chamber in the middle of the microfluidic chamber. The cells were cultured in a 5% CO2, 37°C incubator for 30 min to allow the cells to adhere to the wall.

[0068] (2) Add 100 μL of complete culture medium to each well. After culturing for 4 h, discard the complete culture medium and add 200 μL of neuronal culture medium containing b27 to each well.

[0069] (3) After 48 h, Six4 siRNA was transfected on the cell side. 16 h after transfection, the medium was changed and cultured with complete neuronal medium.

[0070] (4) Continue culturing for 24 h, observe the axonal growth under a microscope, and when the axon grows out of the right side of the microfluidic chamber, use a desktop vacuum pump to pump the axon side with a negative pressure of 0.025 MPa five times for 30 seconds each time, and observe under a microscope until all axons are severed;

[0071] (5) After culturing for 24 h, the culture dish was removed and 200 μL of 4% PFA was added to each well of the microfluidic chamber to fix the cells at room temperature for 30 min.

[0072] (6) After fixation, the cells were immunofluorescently stained using green fluorescent marker Tuj-1. The length of Tuj-1-labeled neuronal axons regenerated after injury was observed on the axon side of the microfluidic cell culture system to detect the regeneration of neuronal axons.

[0073] The results are as follows Figure 5 As shown, after transfection with Six4 siRNA, the regenerated length of axons in DRG neurons of 8-week-old rats after axon injury became longer, indicating that Six4 inhibitors can promote the regeneration of damaged axons in DRG neurons of adult rats.

[0074] Example 4: In vivo experiments in rats

[0075] Sixteen 8-week-old male Sprague Dawley rats were housed in a SPF environment. The room temperature was maintained at 24 ± 2°C during the experiment, and all rats had free access to food and water. All rats were divided into groups treated with either Six4 shRNA-AAV virus or control shRNA-AAV virus, with 8 rats in each group.

[0076] The control shRNA-AAV virus pAAV-U6-shRNA(NC)-CMV-EGFP-WPRE or Six4shRNA-AAV virus pAAV-U6-shRNA(Six4)-CMV-EGFP-WPRE were both designed and prepared by Shanghai Heyuan Biotechnology Co., Ltd.

[0077] 1. Intrathecal injection of virus

[0078] After the rats were anesthetized, the hair near the spine of the hind limbs was shaved, and the skin corresponding to the L5-L6 DRG was cut open along the midline of the back with sterile surgical scissors. The muscles on both sides of the L5-L6 segment of the spine were removed with ophthalmic scissors to expose the vertebral lamina.

[0079] Use bone rongeurs to bite off the spinous process of the L6 segment to expose the space between the two vertebrae. Insert the glass electrode needle horizontally without resistance. Slightly move the glass electrode needle. If the rat's tail or hind legs bounce reflexively, it indicates that the needle is in the correct position.

[0080] Six4 shRNA-AAV virus or control shRNA-AAV virus was diluted with normal saline to a titer of 4.265×10 12 vg / mL, 10 μL was injected into each rat, and the needle was withdrawn after 2 minutes of treatment.

[0081] The injured area was sutured and disinfected with iodine, and the rat was returned to the cage after it woke up.

[0082] 21 days after injection, six rats were injected intrathecally with Six4 shRNA-AAV virus or control shRNA-AAV virus, and DRG tissues were obtained. Total RNA was extracted from the tissues and reverse transcribed using ChamQTM RT-PCR was performed using the qPCR Master Mix system. The primer sequences and reaction conditions for the target gene Six4 and the internal reference gene GAPDH were the same as in Example 2. Fluorescence values ​​were collected during the extension phase of each cycle. After the amplification reaction, melting curve analysis of the products was performed. Using GAPDH as an internal reference, the Ct values ​​of the target gene Six4 and the internal reference GAPDH were measured, and the relative expression of Six4 was calculated using the ΔΔCt method.

[0083] At the same time, the DRG tissue sections were sliced ​​and immunofluorescence staining was performed. Green fluorescence was used to label the Six4 protein and red fluorescence was used to label Tuj-1 to observe the infection of neurons in the DRG and the expression of Six4 after intrathecal injection of Six4 shRNA-AAV virus in rats.

[0084] The results are as follows Figure 6 As shown, after intrathecal injection of Six4 shRNA-AAV virus in adult rats, the expression of Six4 gene and protein in DRG tissue was reduced, indicating that Six4 shRNA-AAV virus is an effective inhibitor of Six4.

[0085] 2. Intrathecal injection of Six4-AAV overexpression virus promotes neuronal regeneration after sciatic nerve crush

[0086] Seven rats were injected intrathecally with Six4 shRNA-AAV virus or control shRNA-AAV virus. 21 days after virus injection, the rats' buttocks were obliquely cut to expose the nerves. The sciatic nerve was clamped 1 cm above the bifurcation of the tibial nerve and the common peroneal nerve using hemostats to establish a rat sciatic nerve crush model.

[0087] 2.1 Immunofluorescence detection of nerve growth-related protein SCG10

[0088] Three days after sciatic nerve injury, sciatic nerve tissues were collected from seven rats in each group. The nerve growth-related protein SCG10 was stained by tissue immunofluorescence to observe the length of SCG10-labeled neuronal processes and to detect the effect of in vivo knockdown of Six4 on the growth of rat DRG neuronal processes.

[0089] The results are as follows Figure 7 As shown, compared with the control group, the regenerated length of the damaged sciatic nerve was longer after knocking down the expression of Six4, indicating that Six4 inhibitors can promote the regeneration of damaged nerves in adult rats.

[0090] 2.2 Compound muscle action potential measurement

[0091] 21 days after sciatic nerve injury in SD rats, four rats from each group were selected. Stimulating electrodes were placed on both sides of the injury site, and recording electrodes were inserted into the gastrocnemius muscle belly. Compound muscle action potentials were recorded, and nerve conduction velocity was calculated based on the distance between the stimulating electrodes and the stimulation latency.

[0092] The results are as follows Figure 8 As shown, after intrathecal injection of Six4 shRNA-AAV virus in adult rats, the sciatic nerve conduction velocity of the rats was significantly increased, indicating that knockdown of Six4 promoted the repair of nerve conduction.

[0093] 2.3. Measurement of thermal pain response

[0094] Ten rats were selected from each group. Von Frey fibers were used to stimulate the skin at the base of the rat paws 7, 14, and 21 days after injury. The rats' responses such as paw withdrawal, paw flicking, and paw licking were observed. The paw withdrawal threshold was calculated to detect the mechanical pain response of the rats after sciatic nerve injury.

[0095] The results are as follows Figure 9 As shown, after intrathecal injection of Six4 shRNA AAV virus in adult rats, the paw withdrawal threshold was significantly reduced, indicating that knockdown of Six4 promotes the recovery of damaged nerve sensory function.

[0096] Ten rats in each group were examined. The skin under the paws was exposed to heat radiation using an IITC Life Science Model 390 Thermal Allodynia Tester 7, 14, and 21 days after injury. The paw withdrawal time (Paw Withdrawal Time) was recorded, and the paw withdrawal latency was calculated to assess the thermal allodynia response of rats after sciatic nerve injury.

[0097] The results are as follows Figure 10 As shown, after intrathecal injection of Six4 shRNA AAV virus in adult rats, the latency of foot-lifting reflex and foot-licking behavior was significantly shortened, indicating that knockdown of Six4 promoted the recovery of damaged nerve sensory function.

Claims

1. Use of a SIX family homeobox gene 4 inhibitor in the preparation of a drug for promoting the growth of neurons in the peripheral nervous system.

2. The use according to claim 1, characterized in that The inhibitor is a nucleic acid molecule carried by a carrier.

3. The use according to claim 2, characterized in that The vector includes a viral vector or a non-viral vector.

4. The use according to claim 2, characterized in that The nucleic acid molecule is siRNA, shRNA or an expression cassette encoding shRNA.

5. The use according to claim 1, characterized in that The application is the application in preparing medicine for treating traumatic injury of neurons in the peripheral nervous system.

6. The use according to claim 5, characterized in that The traumatic injury to neurons in the peripheral nervous system is a physical injury directly caused by external force.

7. The use according to claim 1, characterized in that The application is the application in preparing medicines for treating peripheral nervous system disease injuries.

8. The use according to claim 7, characterized in that The peripheral nervous system disease damage is a physiological damage caused by abnormal intrinsic biological processes.

9. The use according to claim 1, characterized in that The medicine comprises a SIX family homeobox gene 4 inhibitor as an active ingredient and pharmaceutically acceptable excipients.

10. The application according to claim 1, characterized in that: The dosage form of the medicine is granules, tablets, capsules, oral liquids, pills, emulsions, suspensions, injections, infusions or sprays.

Images