SiRNA for inhibiting CMTM6 gene expression and application thereof in lung cancer cells

Abstract

The invention discloses siRNA for inhibiting CMTM6 gene expression and application of the siRNA in lung cancer cells. The invention discloses siRNA for specifically inhibiting human CMTM6 gene expression and a preparation and screening method thereof. Three recombinant lentiviruses containing siRNA fragments are constructed by taking a CMTM6 gene as a target spot sequence and respectively selecting an interference target spot at the upstream, the middle and the downstream of the CMTM6 gene. The siRNA recombinant lentivirus is transferred into a lung cancer cell line H2122, and two siRNA fragments capable of obviously inhibiting the expression of the CMTM6 gene are finally screened by utilizing a DNA (Deoxyribonucleic Acid) mediated RNA interference technology. Experimental results show that the siRNA screened by the invention can specifically and efficiently inhibit the expression of the CMTM6 gene so as to inhibit the proliferation of lung cancer cells. The siRNA screened by the invention provides a new way for preparing related drugs for targeted therapy of lung cancer, and shows a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of medical molecular biology and specifically relates to the construction and screening of siRNA expression vectors targeting the human CMTM6 gene and their use in suppressing CMTM6 gene expression levels in lung cancer cells. In particular, it relates to the use of siRNA to specifically suppress CMTM6 gene expression through RNA interference and its use in killing lung cancer cells and inhibiting cell metastasis. Background Art

[0002] The CMTM6 gene (chemokine-like MARVEL transmembrane domain containing family member 6) is known in Chinese as chemokine-like factor family 6 containing a MARVEL transmembrane domain. It is also known as chemokine-like factor super family member 6 (CKLFSF6). This gene is located in band 2, subband 3, region 2 of the short arm of chromosome 3. The encoded CMTM6 protein consists of 183 amino acid residues with a molecular weight of 20,419 Da. CMTM6 is essentially a chemokine-like factor, possessing the basic structural features of chemokines (four conserved cysteines and a MARVEL transmembrane domain) and chemotactic (inducing directional cell migration) functions. Furthermore, it possesses functions not found in chemokines (promoting cell proliferation and differentiation and inhibiting apoptosis). Their protein products share sequence homology and a potential four-transmembrane MARVEL domain, participating in various biological processes, including vesicular trafficking and tight junctions. The MARVEL domain has a four-transmembrane protein superfamily (TM4SF). TM4SF is a group of small molecular weight glycoproteins that are involved in regulating cell growth, signal transduction and adhesion effects, and binds to integrins to form transmembrane complexes, regulating signal transduction between cells and between cells and ECM, and playing an important role in tumor cell transformation, growth, invasion, metastasis and apoptosis.

[0003] Other studies have shown that the CMTM6 gene is lowly expressed in normal tissues but highly expressed in tumor tissues, closely associated with poor prognosis. Guan et al. analyzed CMTM6 expression in 988 human glioma patients based on data from the Glioma Genome Atlas (CGGA) and The Cancer Genome Atlas (TCGA) databases. Their results showed that CMTM6 protein expression levels in human glioma cells were significantly higher than in normal tissues, and that glioma patients with high CMTM6 expression had a higher malignancy and poorer prognosis. Feng et al. performed immunohistochemical analysis on 44 patients with oral squamous cell carcinoma and found that the CMTM6 positive expression rate (11 / 33) was significantly higher than that in adjacent normal tissues (0 / 22). Our immunohistochemical analysis of 141 patients with non-small cell lung cancer revealed that CMTM6 was highly expressed in lung cancer, with a positive expression rate of 85% (120 / 141). These results suggest that CMTM6 may play an important role in the development and progression of lung cancer and may serve as a new therapeutic target for lung cancer.

[0004] To this end, this patent uses RNAi technology to knock down the expression of CMTM6 in lung cancer, confirming that reduced CMTM6 expression in lung cancer cells affects the proliferation and metastasis of lung cancer cells. The implementation of this patent will provide new theoretical basis and strategies for the prevention and treatment of lung cancer. Summary of the Invention

[0005] The present invention aims to provide an siRNA sequence that specifically inhibits the human CMTM6 gene, characterized in that its base sequences are: sh-CMTM6-41 siRNA: AUAAGGAGACUCAGAAGAAAG; sh-CMTM6-47 siRNA: AAAUCCAAACACAAUUGCAGC. The target CMTM6 gene sequences are: sh-CMTM6-41: CTTTCTTCTGAGTCTCCTTAT; sh-CMTM6-47: GCTGCAATTGTGTTTGGATTT.

[0006] Another object of the present invention is to provide a method for preparing siRNA that specifically inhibits the expression of human CMTM6 gene.

[0007] The present invention designs siRNA sequences based on the CMTM6 gene (NM_017801.3) sequence. RNAi online design software is then used to search for RNA interference target sequences with high scores among common sequences. BLAST comparison is then performed to remove target sequences that may hybridize with other unrelated genes. Finally, a target sequence with high scores and good specificity is selected from the upstream, midstream, and downstream regions of the sequence. Finally, a recombinant lentivirus carrying the siRNA sequence is constructed using the selected target sequences, and stably transfected into lung cancer cells, ultimately expressing siRNA with interference activity within the cells.

[0008] The present invention also provides a DNA sequence encoding the siRNA precursor and a recombinant siRNA expression vector pLKO.1 containing the coding sequence. The recombinant lentivirus containing the siRNA expression vector can directly express siRNA in cells, thereby inhibiting CMTM6 gene expression and achieving the purpose of inhibiting cancer cell proliferation.

[0009] The siRNA expression vector pLKO.1 used in the present invention contains a U6 promoter with a fixed transcriptional start site (G) and a termination site (TTTTTT) for stable siRNA expression. The U6 promoter in this expression vector can transcribe a siRNA precursor—shRNA (short hairpin RNA)—with a specific sequence. This mRNA does not encode amino acids, but instead automatically forms a stem-loop shRNA within the cell. This shRNA is recognized by the nuclease Dicer and cleaved into an approximately 21-25 nucleotide siRNA with a two-nucleotide overhang at the 3' end. This mature siRNA serves as a guide sequence, directing the RNA-induced silencing complex (RISC) to recognize the target gene mRNA sequence complementary to the siRNA. The siRNA and mRNA then exchange positions within the complex, and the nuclease Dicer cleaves the mRNA into 21-23 nt fragments, specifically inhibiting target gene expression. The newly generated siRNA fragments can again guide RISC to form a complex with the target gene mRNA, further degrading the target gene mRNA, thereby generating a cascade amplification effect that results in nearly complete and specific inhibition of target gene expression.

[0010] Another object of the present invention is to provide a method for specifically inhibiting human CMTM6 gene expression. The method provided herein involves using DNA-mediated RNA interference (RNAi) technology to clone a gene encoding a siRNA (siRNA) that inhibits CMTM6 gene expression into an siRNA expression vector, which is then introduced into lung cancer cells using a recombinant lentivirus. The recombinant lentivirus expresses an siRNA capable of inhibiting CMTM6 gene mRNA in the cells, resulting in transcriptional suppression of CMTM6 in the lung cancer cells.

[0011] The present invention also provides the use of the siRNA in preparing anti-tumor drugs for inhibiting lung cancer cell proliferation and metastasis.

[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0013] (1) The human CMTM6 gene mRNA was searched in the GenBank database, with the sequence number NM_017801.3. The RNAi target sequence with the highest score was selected using the siDirect online website. After BLAST comparison, target sequences that might hybridize with other unrelated genes were removed. Finally, a target sequence with a high score and good specificity was selected in the upstream, midstream, and downstream regions of the sequence.

[0014] (2) The identified target sequence was designed to encode a siDNA sequence capable of spontaneously forming a stem-loop RNA in the form of AgeⅠ+Sense+Loop+AntiSense+Termination Signal+EocR I restriction enzyme cleavage site. The chemically synthesized siDNA fragment was ligated into the siRNA expression vector pLKO.1 to construct the recombinant siRNA expression vector pLKO.1-shCMTM6-21 / 41 / 47.

[0015] (3) The recombinant siRNA expression vector pLKO.1-shCMTM6-21 / 41 / 47 was delivered to GeneCare Genetics (Shanghai, China) for lentiviral packaging. The lentivirus was named LV-shCMTM6-21 / 41 / 47. The lentivirus with a titer of 9E+8TU / mL was obtained and used to infect lung cancer cells H2122. Puromycin was used to screen the stable cell lines sh-CMTM6 21 / H2122, sh-CMTM6 41 / H2122, sh-CMTM6 47 / H2122, and sh-Mock / H2122 that could stably express green fluorescent protein. (4) Total RNA and total protein were extracted from the stably transfected cell lines sh-CMTM6 21 / H2122, sh-CMTM6 41 / H2122, sh-CMTM6 47 / H2122, and sh-Mock / H2122. Fluorescence quantitative PCR and Western blotting were performed to determine changes in CMTM6 gene expression at the mRNA and protein levels. Cell growth curves were drawn using the MTT assay, and plate cloning assays were used to detect changes in cell proliferation.

[0016] The present invention ultimately screened out a recombinant lentivirus that can significantly inhibit the expression of the human CMTM6 gene, thereby inhibiting the proliferation of lung cancer cells. The experimental results of the present invention show that after the screened recombinant lentivirus LV-shCMTM6-41 / 47 infects lung cancer cells, the expression of the CMTM6 gene is significantly reduced by fluorescence quantitative PCR and Western Blot detection; MTT and plate cloning experiments show that cell proliferation is significantly inhibited, and Transwell and migration experiments show that cell invasion and metastasis capabilities are also significantly inhibited. H2122 lung cancer cells infected with the recombinant lentivirus LV-shCMTM6-41 also proved that the proliferation ability of tumor cells was significantly inhibited through in vivo tumor formation experiments. This shows that after LV-shCMTM6-41 / 47 inhibits the expression of the CMTM6 gene in lung cancer cells, it will inhibit the proliferation of cancer cells, and ultimately play a role in inhibiting tumor proliferation and killing cancer cells.

[0017] The present invention has achieved beneficial results: Utilizing DNA-mediated RNA interference technology, the present invention targets the CMTM6 gene, which is highly expressed in lung cancer cells, and designs small interfering RNA (siRNA) against its gene coding sequence. A recombinant siRNA expression vector encoding this siRNA is introduced into cells, where the exogenously introduced siRNA mediates the degradation of endogenous CMTM6 mRNA, thereby silencing the CMTM6 gene within the cells. Through experiments, the present invention has screened an siRNA that significantly inhibits CMTM6 gene expression. This siRNA can be used to observe changes in expression and signaling pathways when the CMTM6 gene is specifically inhibited within cells, providing an effective tool for studying the function of the CMTM6 gene at the molecular and cellular levels. It also provides a new approach for gene therapy of lung cancer and shows promising application prospects in the field of targeted treatment of tumors associated with the CMTM6 gene.

[0018] The present invention has the following advantages and effects compared to the prior art:

[0019] (1) The siRNA expression vector selected in the present invention controls siRNA transcription using the U6 promoter from the RNA polymerase III family. It has defined transcription start and termination sites, facilitating the design of siRNA-encoding siDNA sequences. Furthermore, it can express small RNAs at high levels, resulting in greater intracellular accumulation of siRNA and a more pronounced inhibitory effect.

[0020] (2) The siRNA expression vector used in the present invention carries an antibiotic resistance gene and a gene encoding green fluorescent protein. The puromycin resistance gene can be used for puromycin screening, facilitating the establishment of stable transfected cell lines. Green fluorescent protein can be directly observed under a fluorescence microscope, enabling rapid and accurate tracking of transfection efficiency.

[0021] (3) In the process of constructing a recombinant siRNA expression vector, the present invention utilizes two primers to anneal and extend each other. The resulting annealed product does not require enzyme digestion or purification and can be directly ligated to the processed vector. This experimental design greatly simplifies the experimental process, improves experimental efficiency, and reduces experimental costs.

[0022] (4) The siRNA screened by the present invention has a more significant inhibitory effect on the human CMTM6 gene. The present invention designed interference targets at the upstream, midstream and downstream of the human CMTM6 gene, and screened out siRNA with higher inhibition efficiency on the CMTM6 gene from the experiment.

[0023] (5) The recombinant siRNA expression vector constructed by the present invention for inhibiting the CMTM6 gene can significantly inhibit the proliferation of tumor cells. It can be used to further study the function of the CMTM6 gene and its role in the signaling pathways that activate CMTM6 expression, the target genes regulated by CMTM6, and its interactions with other genes.

[0024] (6) The present invention uses RNA interference technology to directly reduce the expression of CMTM6 gene mRNA at the transcriptional level, directly leading to a decrease in the accumulation of CMTM6 protein and thus inhibiting the CMTM6 signaling pathway. Compared with traditional techniques and methods for treating tumors by inhibiting protein signaling pathways, such as antisense oligonucleotides, gene knockout, and receptor neutralizing antibodies, the present invention has the advantages of simple operation, high specificity, strong targeting, cascade amplification, and more sustained effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The results of the relative expression of CMTM6 gene mRNA in cells transfected with LV-shCMTM6-21 / 41 / 47 and LV-shMock groups of the present invention are shown in FIG.

[0026] Figure 2 Figure 2 is the Western Blot detection result of CMTM6 protein in cells transfected with LV-shCMTM6-21 / 41 / 47 and LV-shMock groups, respectively;

[0027] Figure 3 The growth curves of H2122 cells in the MTT method of the present invention were drawn for the LV-shCMTM6-41 / 47 and LV-shMock groups and the untransfected blank group;

[0028] Figure 4 The results of the clone formation experiment of H2122 cells transfected with LV-shCMTM6-41 / 47 and LV-shMock groups, respectively, according to the present invention;

[0029] Figure 5 The results of the invasion experiment of H2122 cells transfected with LV-shCMTM6-41 / 47 and LV-shMock groups, respectively, according to the present invention;

[0030] Figure 6 The results of the migration experiment of H2122 cells transfected with LV-shCMTM6-41 / 47 and LV-shMock groups, respectively, according to the present invention;

[0031] Figure 7 The apoptosis experimental results of H2122 cells transfected with LV-shCMTM6-41 / 47 and LV-shMock groups, respectively, are shown in the figure;

[0032] Figure 8 Graph showing the growth curve of nude mouse transplanted tumors in which H2122 cells were transfected with LV-shCMTM6-41 and LV-shMock groups, respectively. DETAILED DESCRIPTION

[0033] The present invention will be further described in detail below with reference to the accompanying drawings and examples, but the scope of the present invention is not limited to the contents described above. The methods used in the present invention are all conventional methods unless otherwise specified. The quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0034] Example 1: Construction of recombinant lentivirus targeting human CMTM6 gene

[0035] 1. Synthesis of siDNA gene fragments targeting human CMTM6 gene

[0036] The human CMTM6 mRNA sequence was searched in GenBank, a gene database on the NCBI website, with the gene accession number: NM_017801.3. The top-scoring siRNA target sequences were identified using the online RNAi design website siDirect (http: / / sidirect2.rnai.jp / ). Finally, the designed siRNA target sequences were BLAST-matched against GenBank to eliminate sequences that might hybridize with other unrelated genes. Target sequences located upstream, midstream, and downstream of the mRNA were selected, resulting in the following sequences: sh-CMTM6-21: CCCAAGACAGTGAAAGTAATT; sh-CMTM6-41: CTTTCTTCTGAGTCTCCTTAT; and sh-CMTM6-47: GCTGCAATTGTGTTTGGATTT. A mock siRNA was also used as a negative control, with the sh-mock siRNA sequence being: GCTGCAATTGTGTCCGGACCT.

[0037] Since siRNA must be cleaved from double-stranded RNA (dsRNA) into active double-stranded small interfering RNA (siRNA) in the host cell by Dicer, a member of the RNaseIII family of endonucleases, it is necessary to design a double-stranded RNA that can form a stem-loop structure after being transcribed into RNA. The basic structure of the siRNA-encoding siDNA designed in the present invention is the restriction enzyme cleavage site Age I + Sense + Loop + AntiSense + Termination Signal + EcoR I restriction enzyme cleavage site. Sense is the siRNA-encoding siDNA sequence, the Loop sequence is 5'-CTCGAG-3', AntiSense is the reverse complement sequence of the siRNA-encoding siDNA, and the termination signal sequence is 5'-TTTTT-3'.

[0038] The final synthesized siDNA sequence and complementary sequence were determined to be:

[0039] sh-CMTM6-21F:

[0040]

[0041] sh-CMTM6-21R:

[0042]

[0043] sh-CMTM6-41F:

[0044]

[0045] sh-CMTM6-41R:

[0046]

[0047] sh-CMTM6-47F:

[0048]

[0049] sh-CMTM6-47R:

[0050]

[0051] sh-Mock-F:

[0052]

[0053] sh-Mock-R:

[0054]

[0055] The above sequences were sent to the company for synthesis in the form of primers.

[0056] 2. Construction of siRNA recombinant expression vector targeting human CMTM6 gene

[0057] 2.1 Annealing siDNA Oligonucleotides to Form a Double-Stranded Structure: Dilute the synthesized oligonucleotides to 10 μM / L with the appropriate amount of sterile ultrapure water according to the instructions. Add 2 μl of each diluted complementary siRNA target sequence fragment to 20 μl of 10×T4 buffer and water. Place the diluted fragments in a 200 μl PCR tube and place in a PCR instrument. Set the reaction schedule as follows: 95°C for 5 minutes, followed by 2 minutes each at 80°C, 70°C, 60°C, 50°C, 40°C, 30°C, 20°C, 10°C, and 4°C. This allows the two complementary oligonucleotides to anneal and complement each other, forming a complete double-stranded siRNA target sequence fragment with cohesive ends containing the corresponding restriction sites, which can then be ligated into the siRNA expression vector.

[0058] 2.2 Double Enzyme Digestion of siRNA Expression Vector pLKO.1: The siRNA expression vector pLKO.1 (purchased from Shanghai Gene Gene Co., Ltd.) was double-enzymed with Age I and EcoRI. To a 200μl PCR reaction tube, add 30μl of the siRNA expression vector pLKO.1; 2μl of Age I (10U / μl); 2μl of EcoRI (10U / μl); 5μl of 10× Enzyme Digestion Buffer; and 11μl of ddH2O. Incubate the reaction at 37°C for 4 hours. The digestion products were subjected to 1% agarose gel electrophoresis at 110V for 20 minutes. After double-enzyme digestion of the pLKO.1 expression vector, a target band appeared at approximately 7kb. The target band was purified from the gel using the Tiangen Spin Column DNA Purification Kit instructions.

[0059] 2.3 Construction of siRNA Recombinant Expression Vectors: The double-stranded siDNA fragments formed after annealing the oligonucleotides were ligated into the pLKO.1 vector to construct the corresponding recombinant siRNA expression vectors: pLKO.1-shCMTM6-21 (containing the target sequence sh-CMTM6-21), pLKO.1-sh-CMTM6-41 (containing the target sequence sh-CMTM6-41), pLKO.1-shCMTM6-47 (containing the target sequence sh-CMTM6-47), and pLKO.1-shMock (containing a scrambled sequence as a negative control). The following ligation system was prepared in a 200 μl PCR tube: 1 μl of the pLKO.1 / Age I / EcoRI vector large fragment; 5 μl of double-stranded siDNA fragment DNA; 1 μl of T4 DNA ligase; 1 μl of 10× T4 DNA ligase buffer; and 2 μl of ddH2O. The system was placed in a metal bath and reacted at 16°C for 4 hours. Add the entire ligation product to 100 μl of DH5α competent medium and incubate on ice for 30 minutes. Heat shock at 42°C for 90 seconds, then immediately incubate on ice for 90 seconds. Add 900 μl of LB liquid medium and incubate at 37°C, shaking at 80 rpm for 1 hour. Spread 200 μl of the culture onto an LB / Amp plate and incubate inverted at 37°C for 10 hours.

[0060] 2.4 Identification of positive clones: Pick a single colony from the LB / Amp plate and inoculate it into 5 ml of liquid LB / Amp medium. Place it in a 37°C constant temperature shaker at 150 rpm for 8-10 hours until the OD value of the bacterial solution reaches 0. 600 Stop the culture when the pH value is approximately 0.8. Collect the entire bacterial suspension for plasmid extraction according to the instructions of the Tiangen Plasmid Miniprep Kit. Sequence the extracted recombinant plasmids, and select a recombinant siRNA expression vector containing the target siDNA fragment without mutations for lentiviral packaging experiments.

[0061] 3. Packaging of recombinant lentivirus targeting human CMTM6 gene

[0062] The three plasmid DNAs in the lentiviral packaging system (pLKO.1-shCMTM6-21 / 41 / 47 / Mock, pMD2G, and psPAX2, all from Shanghai Gene Gene Co., Ltd.) were extracted using Qiagen's plasmid extraction kit. The plasmid DNA was dissolved in sterile TE and its concentration and purity were determined by UV absorption to ensure that the A260 / A280 ratio of the extracted plasmid DNA was between 1.8 and 2.0. 24 hours before transfection, 293T cells in the logarithmic growth phase were trypsinized and the cell density was adjusted to approximately 5×10 cells in a medium containing 10% serum. 6Cells / 15ml were reseeded in 10cm cell culture dishes and cultured in a 37°C, 5% CO2 incubator. After 24 hours, when the cell density reached 70%-80%, the cells were ready for transfection. Two hours before transfection, the medium was replaced with serum-free medium. The prepared DNA solutions (12.5μg of pLKO.1 recombinant vector plasmid, 7.5μg of pMD2G vector plasmid, and 5μg of psPAX2 vector plasmid) were added to a sterile centrifuge tube and mixed with the corresponding volume of GeneCare transfection reagent to adjust the total volume to 1ml. The mixture was incubated at room temperature for 15 minutes. The mixture was slowly added dropwise to the 293T cell culture medium, mixed thoroughly, and cultured in a 37°C, 5% CO2 incubator. After 6 hours of incubation, the culture medium containing the transfection mixture was discarded and the cells were washed once with 10ml of PBS. Then, 20ml of cell culture medium containing 10% serum was slowly added and the cells were cultured in a 37°C, 5% CO2 incubator for another 48-72 hours. 293T cell supernatants were collected 48 hours after transfection, depending on the cell status. Cell debris was removed by centrifugation at 4000 g for 10 minutes at 4°C. The supernatants were filtered through a 0.45 μm filter and transferred to 40 ml ultracentrifuge tubes. Each ultracentrifuge tube containing the viral supernatant was placed into a Beckman ultracentrifuge at 25,000 rpm for 2 hours at 4°C. After centrifugation, the supernatant was discarded, PBS was added, and the suspension was resuspended by gentle pipetting. After thorough lysis, the supernatant was centrifuged at 10,000 rpm for 5 minutes. The supernatant was then aliquoted into 1.5 ml microcentrifuge tubes and stored frozen at -80°C. Viral titers were determined using a fluorescence assay. Four recombinant lentiviruses were obtained: LV-shCMTM6-21 / 41 / 47 and LV-shMock.

[0063] Example 2: Inhibitory Effect of Recombinant siRNA Lentivirus on the CMTM6 Gene in Lung Cancer Cell Line H2122 and Its Effect on Cell Biological Characteristics

[0064] 1. Construction of H2122 stable cell line with stable knockdown of CMTM6 gene

[0065] Lung cancer H2122 cell suspension was inoculated into a 6-cm dish containing 3 mL of complete culture medium, gently shaken and placed in a 37°C, 5% CO2 incubator. When the cell confluence reached about 80%, trypsin was used for digestion and complete culture medium (10% fetal bovine serum + high glucose DMEM) was used to make 6×10 4 / mL cell suspension. Take 500μl of cell suspension and inoculate it into a 48-well plate and continue to culture. On the second day after plating, change the medium and add puromycin with a final concentration of 0μg / ml, 0.5μg / ml, 1μg / ml, 2μg / ml, 4μg / ml, 6μg / ml, 8μg / ml, and 10μg / ml to 8 wells respectively. Observe the cell status under a microscope 48 hours after adding puromycin (the cell density of the untreated group is between 60% and 90%). At this time, the cells in the high-concentration puromycin group should be completely dead. By observing the cell status, the lowest concentration that causes complete cell death is determined as the optimal concentration for puromycin screening of the cell. This experiment determined that the optimal screening concentration of puromycin for H2122 cells is 8μg / ml. The cells in the logarithmic growth phase are trypsinized, and the complete culture medium is made into 5×10 4 Prepare a 100 μl / mL cell suspension and add 2 mL of cell suspension to a 6-well plate. Continue culturing to ensure that the cell count reaches about 15%-30% when infected. Dilute the Jikai Gene infection reagent Hitrans GP and complete culture medium at a ratio of 1:24, and add 1 ml of infection medium to each well. That is, add 960 μl of complete culture medium and 40 μl of Hitrans GP infection reagent to each well, mix well and add. Add 8 μl of recombinant virus to each well according to the virus titer. 16 hours after adding the virus infection, replace it with regular complete culture medium and continue culturing. 72 hours after infection, observe the cell status and observe the infection efficiency by fluorescence microscopy. The cells must be in good condition without a large number of cell deaths, especially to ensure that the cell status of the NC group and the non-transfected group is equivalent. 72 hours after infection, add puromycin with a final concentration of 8 μg / ml to maintain culture.

[0066] When the cell number reaches the required level, the cells are collected for downstream qPCR and WB detection (to identify the expression level of the target gene and protein). This transfection is divided into four groups, of which the experimental group has three groups, namely, the recombinant lentivirus LV-shCMTM6-21 / 41 / 47 transfected with the target sequence sh-CMTM6-21 / 41 / 47, and the blank control group (i.e., the Mock group) transfected with the recombinant lentivirus LV-shMock.

[0067] 2. Detection of CMTM6 gene mRNA expression by fluorescence quantitative PCR

[0068] The four stable transfected cell groups and the untransfected H2122 cells (blank group) were inoculated into 6-well plates. When the cells reached the logarithmic growth phase, the culture medium was discarded and centrifuged to collect the cells. The cell pellet was resuspended in D-Hanks solution. Total RNA was extracted from the cells using the Trizol method. The specific extraction steps were referred to the Molecular Cloning Guide (3rd Edition). The electrophoresis diagram of total RNA extraction is attached. Figure 4. Reverse transcription was performed using a reverse transcription kit purchased from Fermentas. For specific steps, please refer to the instructions. Fluorescence quantitative PCR was performed using the reverse transcription product to determine the expression of the CMTM6 gene in different transfection groups. Primer CMTM6f: CGAGGCGATGGAGAACGGAG; CMTM6r: GCTGCAAGCCCTTGAGAACG; RPL13A (NM_012423.4) was selected as the internal reference gene, primer RPL13Af: TGGTCGTACGCTGTGAAGGC; RPL13Ar: CAGCATACCTCGCACGGTCC. The reaction system and conditions refer to the kit purchased from TAKARA. PremixEx Taq TM Kit instructions.

[0069] The experiment was carried out in five groups, with three replicates in each group. The results of fluorescence quantitative PCR showed that the amplification efficiency of the primers was roughly the same, and 2 -ΔΔCt The mRNA expression levels of CMTM6 gene and internal reference gene GAPDH were analyzed by relative quantitative analysis. Where ΔCt = Ct value of target gene - Ct value of GAPDH, ΔΔCt = ΔCt of experimental group - ΔCt of blank group, target gene in experimental group / target gene in blank group = 2 -ΔΔCt . The results of fluorescence quantitative PCR showed that in H2122 cells, compared with the uninfected H2122 cell group, the mRNA expression of CMTM6 gene in the infected blank control Mock group and the negative control group was not much different; the mRNA expression level of CMTM6 gene in H2122 cells infected with LV-shCMTM6-21 / 41 / 47 group was significantly decreased, among which the mRNA expression level of CMTM6 gene in H2122 cells infected with LV-shCMTM6-41 group decreased the least. The results showed that the recombinant lentivirus LV-shCMTM6-21 / 41 / 47 containing the target sequence sh-CMTM6-21 / 41 / 47 can effectively inhibit the expression of CMTM6 gene mRNA in lung cancer cells H2122, but the sh-CMTM6-41 group had the strongest inhibitory effect on CMTM6 gene. The results are shown in the attached figure. Figure 1 .

[0070] 3. Western Blot Detection of CMTM6 Protein Expression in Cells

[0071] Four stably transfected cell lines (sh-CMTM6 21 / H2122, sh-CMTM6 41 / H2122, sh-CMTM6 47 / H2122, and sh-Mock / H2122) and the lung cancer H2122 cell line were cultured in T75 flasks. When the cell confluence reached 80-90%, total protein was extracted and collected from each group. Protein content was determined using a BCA protein quantification kit (Thermo Scientific). 50 μg of total protein from each group was separated by 12% SDS-PAGE gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) using semi-dry electroporation. The cells were then blocked with a blocking buffer containing 5% skim milk powder for 2 hours at room temperature. The cells were incubated with an anti-CMTM6 antibody (Abcam, Catalog No. ab264067) as the primary antibody at room temperature for 2 hours, followed by incubation with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Catalog No. ZB-2301) as the secondary antibody at room temperature for 2 hours. Mouse anti-human β-actin (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Catalog No. TA-09) was used as the internal control, followed by an HRP-conjugated goat anti-mouse IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Catalog No. ZB-2305) as the secondary antibody. Finally, enhanced chemiluminescence (ECL) was used to visualize the bands, and detection was performed using a Bio-Rad chemiluminescence gel imaging system.

[0072] Western Blot results show that CMTM6 protein is normally expressed in H2122 cells transfected with LV-shMock; there are basically no bands in H2122 cells transfected with LV-shCMTM6-21 / 41 / 47, indicating that the expression of CMTM6 protein is significantly decreased. Among them, CMTM6 protein is almost not expressed in H2122 cells transfected with LV-shCMTM6-41. WB results show that H2122 cells transfected with LV-shCMTM6-21 / 41 / 47 can inhibit the expression of CMTM6 protein, and the inhibition effect of the group transfected with LV-shCMTM6-41 is more significant. The results are shown in the attached figure. Figure 2 .

[0073] 4. Draw cell growth curve using MTT method

[0074] The three stably transfected cell groups, sh-CMTM6 41 / H2122, sh-CMTM647 / H2122 and sh-Mock / H2122, and normal H2122 cells were made into single-cell suspensions, with 3×10 3Each well was inoculated with 100 μl of cells in a 96-well plate. At the same time, a zeroing well was set up in which only culture medium was added without adding cells, and 3 replicate wells were set up for each group at each detection time point. The culture medium was replaced once a day, and the culture was continued for 72 hours. 10 μl of MTT (5 mg / ml) solution was added to each well and incubated for 4 hours. The culture was terminated, the supernatant was discarded, and 150 μl of DMSO was added to each well. The plate was shaken for 10 minutes to fully dissolve the crystals. The absorbance was detected at 490 nm using an enzyme-labeled instrument, and the detection was performed at four time points of 6 h, 24 h, 48 h, and 72 h of culture. The growth curve of each group of cells was drawn with the culture time as the horizontal axis and the light absorption value as the vertical axis. The results are shown in the attached figure. Figure 3 .

[0075] The plotted growth curves show that H2122 lung cancer cells transfected with LV-shCMTM6-41 showed significantly slower growth and proliferation. The results indicate that lentivirus transfection with LV-shCMTM6-41 significantly inhibited the growth of H2122 lung cancer cells, while the inhibitory effect was relatively weak in the group transfected with LV-shCMTM6-21 / 47. The mock group showed virtually no inhibition of cell growth.

[0076] 5. Detection of cell proliferation ability

[0077] The experimental cells included three stably transfected cell groups: sh-CMTM6 41 / H2122, sh-CMTM647 / H2122, and sh-Mock / H2122, as well as normal H2122 cells. Adherent cells in the logarithmic growth phase in 6-well plates were dissociated with 0.25% trypsin and suspended in RPMI 1640 (Hyclone) supplemented with 20% fetal bovine serum (Gibco) to create single-cell suspensions. Each sample was seeded in a density gradient of 500 cells per well in 6-well plates, with three replicates per sample. Cultures were performed for two weeks and terminated when visible colonies appeared. The cells were rinsed with PBS, fixed with methanol, and stained with Giemsa stain. Colonies with >50 cells were counted microscopically, and the colony formation rate was calculated. The effects of siRNA expressed by different recombinant siRNA expression vectors on cell proliferation were analyzed and compared.

[0078] After 2 weeks of culture, all four groups of cells were plated into 6-well plates and clones were formed. Among them, the ability of H2122 cells transfected with LV-shCMTM6-41 to form single clones was significantly reduced. The clone formation ability of H2122 cells transfected with LV-shMock group was basically the same as that of untransfected H2122 cells. The results showed that the clone formation ability of lung cancer H2122 cells transfected with LV-shCMTM6-41 recombinant virus was significantly reduced, and the cell proliferation activity was inhibited. The results are shown in the attached figure. Figure 4.

[0079] 6. Detection of cell invasion ability

[0080] The day before the experiment, place a tube of Matrigel (purchased from Corning) from -20°C in a 4°C refrigerator overnight to allow the Matrigel to melt from a solid state to a liquid state. Hydrate the basement membrane: add 50 μL of 10g / LBSA serum-free culture medium to each well and incubate at 37°C for 30 minutes. Coat the basement membrane: aspirate the culture medium in the upper chamber, dilute the Matrigel at a ratio of 1:8, and add 100 ul of the diluted Matrigel to each upper chamber to coat the upper chamber surface of the bottom membrane of the transwell chamber. Incubate at 37°C for 1 hour to solidify the gel. Digest the cells (sh-CMTM6 41 / H2122, sh-CMTM647 / H2122, and sh-Mock / H2122, H2122) with conventional trypsin, wash 1-2 times with PBS to remove the influence of serum, resuspend the cells in serum-free culture medium, and adjust the cell density to 2×10 5 / mL. Take 200μL of cell suspension and add it to the upper chamber of the Transwell chamber. Add 600μL of culture medium containing 10% FBS to the lower chamber of the 24-well culture plate. Be careful not to generate bubbles between the lower culture medium and the chamber. Place the culture plate in a CO2 incubator at 37℃ and culture for 24 hours. Remove the chamber, aspirate the liquid in the upper chamber, rinse twice with PBS, carefully wipe the cells in the upper layer of the microporous membrane of the chamber with a cotton swab, fix with methanol for 30 minutes in a 24-well plate, and stain with 0.5% crystal violet solution for 15 minutes. Take pictures under an inverted microscope, randomly count 10 fields of view for each sample, take the average value, and perform statistical analysis.

[0081] The Transwell assay revealed that the number of cells that passed through the basement membrane in H2122 cells transfected with the LV-shCMTM6-41 recombinant lentivirus was significantly lower than that in the control group, with a statistically significant difference (P < 0.05). The results showed that the invasive ability of lung cancer H2122 cells transfected with the LV-shCMTM6-41 recombinant virus was significantly reduced, and the cell metastasis activity was inhibited. Figure 5 .

[0082] 7. Detection of cell migration

[0083] Three stable cell lines, sh-CMTM6 41 / H2122, sh-CMTM647 / H2122 and sh-Mock / H2122, and normal H2122 cells were cultured in 2 ml of culture medium containing 4 × 10 5The cells were plated in a 6-well plate and cultured overnight in a 37°C, 5% CO2 cell culture incubator. When the cell fusion rate reached 100%, the cells were taken out and scratched vertically with a 200ul pipette tip in a biosafety cabinet. The healing of the cells after scratching was observed under a microscope at 0h, 24h, and 48h, and photos were taken. The results showed that at 48h, the cells in the H2122 and sh-Mock / H2122 groups migrated significantly, while the cell migration ability of the sh-CMTM6 41 / H2122 and sh-CMTM647 / H2122 groups was significantly weakened. The results showed that the migration of H2122 cells transfected with the LV-shCMTM6-41 / 47 recombinant lentivirus was significantly inhibited. The results are attached. Figure 6 .

[0084] 8. Detection of cell apoptosis by flow cytometry

[0085] Three stable cell lines, sh-CMTM6 41 / H2122, sh-CMTM647 / H2122, and sh-Mock / H2122, and normal H2122 cells were digested with EDTA-free trypsin, washed twice with PBS, and collected into centrifuge tubes to prepare single-cell suspensions. 2.5×10 5 Centrifuge the cells at 1000 g for 5 minutes, discard the supernatant, and gently resuspend the cells in 195 μl of Annexin V-FITC conjugate (Biyuntian Biotechnology Co., Ltd., Catalog No. C1062M). Add 5 μl of Annexin V-FITC and mix gently. Add 10 μl of propidium iodide staining solution and mix gently. Incubate at room temperature (20°C) in the dark for 20 minutes, then place on ice. Flow cytometry was used to detect Annexin V-FITC as green fluorescence and propidium iodide (PI) as red fluorescence. Repeat the experiment three times.

[0086] The results showed that knocking down the CMTM6 gene in lung cancer cells H2122 significantly promoted apoptosis of lung cancer cells. The results showed that H2122 cells transfected with LV-shCMTM6-41 recombinant lentivirus were significantly induced to apoptosis, and cell growth and proliferation were inhibited. The results are shown in the attached Figure 7 .

[0087] 9. Growth of transplanted tumors in nude mice

[0088] Twelve SPF-grade male BALB / c nude mice (Vital River Laboratories, Beijing) were purchased and housed in an animal house. Two stably transfected human lung cancer cell lines, sh-CMTM6 41 / H2122 and sh-Mock / H2122, were inoculated into T75 culture flasks. When the cells were well adhered and reached a confluence of 70%-80%, they were subcultured. The cells were digested with 0.25% trypsin and collected. The cells were rinsed three times with PBS and diluted to 1×10 7 After mixing with Corning Matrigel (1:1), 200 μl of the mixture was inoculated into the right axilla of nude mice. The size of the subcutaneous tumor was observed every 3 days. The tumor growth was observed dynamically with a caliper. The calculation formula was volume = 1 / 2 (short diameter). 2 × long diameter). After 40 days of observation, tumor growth curves were drawn, and euthanasia was performed by rapid cervical dislocation.

[0089] The tumor growth curve shows that the growth rate of the transplanted tumor in the LV-shCMTM6-41 / H2122 group was significantly lower than that in the LV-shMock / H2122 group. The results show that knocking down the CMTM6 gene can effectively inhibit the growth of lung cancer cell H2122 nude mouse transplanted tumors. Figure 8 .

Claims

1. An siRNA for inhibiting CMTM6 gene expression, characterized in that: The nucleotide sequences thereof are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

2. The siRNA according to claim 1, characterized in that The siRNA is transcribed from the DNA oligonucleotide chains shown in SEQ ID NO: 9 and SEQ ID NO: 11, respectively, and cleaved by the nuclease Dicer in cells.

3. Use of the siRNA according to claim 1 in the preparation of drugs for inhibiting cancer cell proliferation.

4. The use of the siRNA according to claim 3 in the preparation of a drug for inhibiting cancer cell proliferation, characterized in that: The cancer cells are lung cancer cell H2122 cell lines.

Images