Anti-fibrosis saRNA-Rplp0 vaccine as well as preparation method and application thereof

By preparing a self-amplifying RNA vaccine based on Rplp0, the toxicity and insufficient efficacy of existing anti-fibrosis drugs were solved, effective treatment and prevention of pulmonary fibrosis was achieved, and a new low-toxicity, high-efficacy treatment option was provided.

CN120683113APending Publication Date: 2025-09-23SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511129650.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing anti-fibrotic drugs such as nintedanib and pirfenidone can only delay disease progression but cannot reverse fibrosis. They also have liver toxicity and gastrointestinal side effects. The pathogenesis of pulmonary fibrosis is complex, and there is a lack of effective low-toxicity, high-efficacy treatment strategies.

Method used

Based on Rplp0 as a fibrosis target, a self-amplifying RNA (saRNA-Rplp0) vaccine was prepared, using an alphavirus backbone vector and delivery vehicles such as lipid nanoparticles, and administered through injection and other routes for the prevention and treatment of fibrotic diseases.

Benefits of technology

The saRNA-Rplp0 vaccine can effectively treat and prevent bleomycin-induced pulmonary fibrosis in mice, reduce lung collagen deposition, lower pulmonary fibrosis indicators, and improve pathological changes, providing a new low-toxicity, high-efficacy treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683113A_ABST
    Figure CN120683113A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an anti-fibrosis saRNA-Rplp0 vaccine as well as a preparation method and application thereof. In order to explore more low-toxicity and high-curative-effect medicines for preventing and treating fibrosis diseases, the invention provides an anti-fibrosis saRNA-Rplp0 and a vaccine thereof on the basis of taking Rplp0 as a fibrosis target. Experimental results show that the vaccine prepared by the invention can significantly improve mouse lung tissue pathological changes and collagen deposition caused by bleomycin, so that fibrosis related indexes are significantly reduced. The saRNA-Rplp0 vaccine provides a new thought for fibrosis treatment and drug research and development, and is expected to become a candidate vaccine for fibrosis treatment in the future.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an anti-fibrotic saRNA-Rplp0 vaccine and a preparation method and application thereof. Background Art

[0002] Pulmonary fibrosis is a type of lung disease characterized by abnormal proliferation of fibroblasts and excessive deposition of extracellular matrix. Its pathological nature is the abnormal repair of lung tissue after injury, which leads to pathological abnormalities in lung structure. Idiopathic pulmonary fibrosis (IPF) is the most common type. Currently approved anti-fibrotic drugs (such as nintedanib and pirfenidone) can only delay disease progression, but cannot achieve tissue regeneration or reverse fibrosis, and have significant hepatotoxicity and gastrointestinal side effects. Therefore, there is an urgent need to develop targeted treatment strategies for pulmonary fibrosis with lower toxicity and higher efficacy.

[0003] However, the pathogenesis of pulmonary fibrosis is complex, with no definitive consensus. Studies have shown that abnormalities in lung tissue damage and repair, inflammatory cytokine disturbances, epithelial-mesenchymal transition, cellular senescence, abnormal signaling pathways, and dysregulated cellular metabolism all accompany the development of pulmonary fibrosis. This has repeatedly frustrated traditional drug development efforts in pulmonary fibrosis treatment. New therapeutic strategies for pulmonary fibrosis are urgently needed.

[0004] Self-amplifying RNA (saRNA), a next-generation RNA vaccine platform, is rapidly developing and being applied to a variety of major human diseases, including cancer and influenza. It has achieved some initial success and shows promising development prospects. The application of saRNA vaccines in the treatment of pulmonary fibrosis has positive implications for both the clinical treatment of pulmonary fibrosis and the development of anti-fibrotic drugs.

[0005] Ribosomal large subunit phosphoprotein P0 (Rplp0) is a core component of the eukaryotic 60S ribosome subunit, traditionally considered to be primarily involved in protein translation. However, there are no reports of using it as a therapeutic target for fibrosis, or developing saRNA vaccines for the treatment and prevention of fibrotic diseases. Summary of the Invention

[0006] In order to explore more low-toxicity, high-efficacy drugs for the prevention and treatment of fibrotic diseases, the present invention provides an anti-fibrosis saRNA-Rplp0 vaccine based on Rplp0 as a fibrosis target, and its preparation method and application.

[0007] To achieve the above application objectives, the technical solutions adopted in this application are as follows: In a first aspect, the present invention provides a saRNA transcribed from an alphavirus backbone vector, wherein the alphavirus backbone vector comprises the gene sequence of the immunogen Rplp0, wherein the gene sequence of the immunogen is as shown in SEQ ID NO.1 or a gene sequence having at least 90% homology with SEQ ID NO.1 and the same or similar biological activity.

[0008] Furthermore, the alphavirus backbone vector includes a promoter, a 5'UTR, an alphavirus non-structural protein, a gene sequence of an immunogen, a 3'UTR and a PolyA tail.

[0009] Furthermore, the nucleotide sequence of the promoter is shown in SEQ ID NO.3.

[0010] Furthermore, the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.4.

[0011] Furthermore, the nucleotide sequence of the alphavirus non-structural protein is shown in SEQ ID NO.5.

[0012] Furthermore, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.6.

[0013] Furthermore, the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.7.

[0014] Furthermore, the nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.8.

[0015] In a second aspect, the present invention provides a saRNA vaccine for preventing and / or treating fibrosis, comprising the above-mentioned saRNA and a vector for delivering the saRNA.

[0016] Furthermore, the delivery vehicle is selected from at least one of lipid nanoparticles (LNP), polymer nanoparticles or liposome complexes.

[0017] Preferably, the LNP components include: cationic lipid SM-102, auxiliary lipid DSPC, cholesterol and PEG lipid DMG-PEG 2000 .

[0018] Preferably, the polymer nanoparticles are selected from at least one of the following: polyethyleneimine (PEI), polyamidoamine (PAMAM), polylysine (PLL), and polypropyleneimine (PPI).

[0019] Preferably, the liposome complex is selected from at least one of the following: (2,3-dioleyloxypropyl)trimethylammonium chloride (DOTAP), N-[1-(2,3-dioleoyl chloride)propyl]-N,N,N-trimethylammonium chloride (DOTMA), cationic cholesterol (DC-Chol), and dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA).

[0020] In a third aspect, the present invention provides a combination drug comprising the above-mentioned saRNA or saRNA vaccine, administered separately or simultaneously, and other drugs for preventing and / or treating fibrotic diseases.

[0021] In a fourth aspect, the present invention provides the use of the above-mentioned saRNA, saRNA vaccine or combination drug in the preparation of a drug for treating and / or preventing fibrotic diseases.

[0022] Furthermore, the drug is a pharmaceutical preparation that is administered by injection, oral administration, nasal mucosa, lungs, rectum, oral mucosa or skin.

[0023] Preferably, the drug is an injectable preparation, and the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

[0024] Furthermore, the fibrotic disease is selected from at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, renal fibrosis, cardiac fibrosis, endometrial fibrosis, eye fibrosis, splenic fibroproliferative disease, myelofibrosis or skin fibrosis.

[0025] Preferably, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or other pulmonary fibrosis.

[0026] Preferably, the pulmonary fibrosis is caused by drugs, and the drugs are at least one of bleomycin, amiodarone or methotrexate.

[0027] In a fifth aspect, the present invention provides a method for preparing the above-mentioned saRNA, comprising the following steps: (1) Enzymatically digest the plasmid containing the DNA sequence shown in SEQ ID NO. 8 to obtain a linearized template, which was then purified; (2) The purified linearized template is transcribed in vitro and purified to obtain purified RNA; (3) Capping and purifying the purified RNA obtained in step (2) to obtain saRNA.

[0028] Beneficial Effects: The present invention utilizes Rplp0, a novel fibrosis target, to prepare an anti-fibrosis saRNA vaccine. Animal experimental results demonstrate that the saRNA-Rplp0 vaccine, prepared based on Rplp0, can treat and prevent bleomycin-induced pulmonary fibrosis in mice, as evidenced by improved lung pathology, reduced collagen deposition, and lowered pulmonary fibrosis indicators. The saRNA-Rplp0 vaccine of the present invention provides new insights into the treatment and drug development of pulmonary fibrosis and is expected to become a promising candidate for a new class of anti-fibrosis vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the recombinant alphavirus backbone vector constructed in Example 1 of the present invention.

[0030] Figure 2 Figure 1 shows the results of the saRNA-Rplp0 vaccine in Experimental Example 1 of the present invention treating bleomycin-induced pulmonary fibrosis in mice through therapeutic intramuscular immunization. a) Weight change curves of mice in the blank group, model group, saRNA-Vehicle (control group), and saRNA-Rplp0 (treatment group) after bleomycin modeling; b) Lung weight, c) Lung coefficient, and d) Hydroxyproline content in lung tissue of mice in the saRNA-Rplp0-treated pulmonary fibrosis model; e) qPCR detection of FN mRNA expression levels and f) Col1a mRNA expression levels in lung tissue of mice in the saRNA-Rplp0-treated pulmonary fibrosis model; g) Western Blot detection of Rplp0, Col1a1, and Fibronectin protein levels in lung tissue of mice in the saRNA-Rplp0-treated pulmonary fibrosis model. Data are expressed as mean ± SEM.

[0031] Figure 3 Histological staining of the saRNA-Rplp0 vaccine in Experimental Example 1 of the present invention for the treatment of bleomycin-induced pulmonary fibrosis in mice via therapeutic intramuscular immunization; a) Masson staining of lung tissue sections from each group of mice in the saRNA-Rplp0-treated pulmonary fibrosis model; b) Immunohistochemical staining of lung tissue sections for α-SMA and Col1a. Scale bar: 50 μm. DETAILED DESCRIPTION

[0032] In order to make the technical problems, technical solutions and beneficial effects to be solved by this application more clear, the application is further described in detail below in conjunction with the embodiments. Unless otherwise defined, all scientific and technical terms used herein have the same meanings as understood by ordinary technicians in this field.

[0033] The term "self-amplifying RNA" (saRNA) refers to a class of engineered RNA molecules capable of autonomously replicating within host cells, significantly enhancing the level and duration of target protein expression. Inspired by the structure of the alphavirus genome, saRNA retains the 5' cap and 3' polyadenylic acid (PolyA) tail of traditional mRNA while also incorporating viral replicase genes, such as the RNA-dependent RNA polymerase (RdRp), and subgenomic promoters, such as SGP, enabling self-replication within the cytoplasm. This unique structure allows saRNA to extend the duration of antigen expression to several weeks, while requiring only 1 / 10-1 / 100th the dose of traditional mRNA.

[0034] The term "ribosomal large subunit phosphoprotein P0 (Rplp0)" refers to a core component protein of the 60S subunit of the eukaryotic ribosome, and is traditionally considered to be primarily involved in the protein translation process. The applicant's previous studies have found that Rplp0 is abnormally highly expressed in the pulmonary fibrosis microenvironment, and that Rplp0 can affect the pro-fibrotic phenotype of macrophages and promote the secretion of pro-fibrotic factors by macrophages. More importantly, the pro-fibrotic function of Rplp0 is independent of its classical ribosomal function, making it a highly promising target for fibrosis treatment. Therefore, in one embodiment of the present invention, based on the novel pulmonary fibrosis target Rplp0 (Uniprot ID: P14869), a saRNA vaccine encoding mouse Rplp0 was prepared for the treatment of fibrotic diseases.

[0035] In some specific embodiments of the present invention, a saRNA is provided, which is transcribed from an alphavirus backbone vector, wherein the alphavirus backbone vector includes the gene sequence of the immunogen Rplp0, and the gene sequence of the immunogen is as shown in SEQ ID NO.1 or a gene sequence having at least 90% homology with SEQ ID NO.1 and the same or similar biological activity.

[0036] In some specific embodiments of the present invention, the alphavirus backbone vector includes a promoter, a 5'UTR, an alphavirus non-structural protein, a gene sequence of an immunogen, a 3'UTR and a PolyA tail.

[0037] In some specific embodiments of the present invention, the nucleotide sequence of the promoter is shown as SEQ ID NO.3.

[0038] In some specific embodiments of the present invention, the nucleotide sequence of the 5'UTR is shown as SEQ ID NO.4.

[0039] In some specific embodiments of the present invention, the nucleotide sequence of the alphavirus non-structural protein is shown as SEQ ID NO.5.

[0040] In some specific embodiments of the present invention, the nucleotide sequence of the 3'UTR is shown as SEQ ID NO.6.

[0041] In some specific embodiments of the present invention, the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.7.

[0042] In some specific embodiments of the present invention, the nucleotide sequence of the alphavirus backbone vector is shown as SEQ ID NO.8.

[0043] In another embodiment of the present invention, a saRNA vaccine for preventing and / or treating fibrosis is provided, which contains the above-mentioned saRNA and a vector for delivering the saRNA.

[0044] In order to ensure that the synthesized saRNA can efficiently enter cells and express antigens, in some embodiments of the present invention, the delivery vehicle is selected from at least one of LNP, polymer nanoparticles or liposome complexes.

[0045] In some preferred embodiments of the present invention, the LNP components include: cationic lipid SM-102, auxiliary lipid DSPC, cholesterol and PEG lipid DMG-PEG 2000 .

[0046] In some preferred embodiments of the present invention, the polymer nanoparticles are selected from at least one of the following: PEI, PAMAM, PLL, and PPI.

[0047] In some preferred embodiments of the present invention, the liposome complex is selected from at least one of the following: DOTAP, DOTMA, DC-Chol, and DOSPA.

[0048] In order to better treat and prevent fibrotic diseases, in some embodiments of the present invention, the above-mentioned saRNA or saRNA vaccine is administered separately or simultaneously with other drugs for preventing and / or treating fibrotic diseases to achieve better effects.

[0049] In order to verify the therapeutic and / or preventive effect of the saRNA or saRNA vaccine prepared by the present invention on fibrotic diseases, in some embodiments of the present invention, the saRNA or saRNA vaccine is prepared into a pharmaceutical preparation for administration by injection, oral administration, nasal mucosa, lung, rectum, oral mucosa or skin.

[0050] In some preferred embodiments of the present invention, the drug is an injectable preparation, and the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

[0051] The present invention constructs a fibrotic disease model to verify the therapeutic and / or preventive effect of the prepared saRNA or saRNA vaccine on fibrotic diseases. The fibrotic disease is selected from at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, renal fibrosis, cardiac fibrosis, endometrial fibrosis, ocular fibrosis, splenic fibrosis, myelofibrosis, or skin fibrosis.

[0052] Pulmonary fibrosis has a complex pathogenesis in clinical practice and may be caused by a variety of reasons. It is characterized by abnormal proliferation of fibroblasts and excessive deposition of extracellular matrix. Therefore, in some preferred embodiments of the present invention, a pulmonary fibrosis model is constructed to verify the therapeutic and / or preventive effects of the prepared saRNA or saRNA vaccine on fibrotic diseases. The pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis, or other pulmonary fibrosis.

[0053] In some preferred embodiments of the present invention, the pulmonary fibrosis is caused by a drug, and the drug is at least one of bleomycin, amiodarone or methotrexate.

[0054] In some specific embodiments of the present invention, bleomycin is administered by tracheal instillation to establish a mouse pulmonary fibrosis model, and the saRNA vaccine is injected intramuscularly at a dose of 1 μg saRNA per mouse.

[0055] Specific examples will be listed below to explain the scheme of the present invention. Those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0056] A kit for measuring tissue hydroxyproline content was purchased from the Nanjing Jiancheng Bioengineering Institute. Antibodies against Rplp0 and Fibronectin were purchased from Proteintech; α-SMA antibody was purchased from Huabio; and Col1a1 antibody was purchased from Zhengneng Biotechnology. Male C57BL / 6 mice (8–10 weeks old) were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. All animal experiments were performed in accordance with the guidelines evaluated and approved by the Ethics Committee of Sichuan University.

[0057] Example 1: Preparation of saRNA-Rplp0 vaccine In this example, the gene fragment of the target gene Rplp0 (SEQ ID NO.1) was first cloned into the alphavirus backbone plasmid to produce the saRNA-Rplp0 recombinant plasmid. Figure 1 As shown, the constructed recombinant plasmid structure includes: T7 promoter (SEQ ID NO.3), 5'UTR (SEQ ID NO.4), alphavirus nonstructural protein (SEQ ID NO.5), immunogen Rplp0 gene (SEQ ID NO.1), 3'UTR (SEQ ID NO.6) and PolyA tail (SEQ ID NO.7), and finally gene synthesis is performed and cloned into the PUC57-kan vector.

[0058] The constructed plasmid was mixed with 50 μL of E. coli competent cells DH5α and placed on ice for 30 min. Heat shock was performed at 42°C for 90 s, and the mixture was immediately returned to ice. After a 2-min ice bath, the mixture was incubated at 37°C for 1 hour.

[0059] Add 400 μL of LB medium and culture at 30°C in a shaking incubator for 45 to 60 min.

[0060] Take 50-100 μL of bacterial solution and spread it on LB solid medium containing 100 μg / mL kanamycin antibiotic, and culture it upside down at 37℃ overnight.

[0061] The obtained monoclonal colony plate was sequenced to verify its correctness, and the monoclonal colony with correct sequencing was picked and cultured in a shaking incubator at 30°C overnight.

[0062] Plasmids were extracted using an endotoxin-free plasmid extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd.). The extracted plasmid was digested with restriction enzymes to form a linearized plasmid for use as a transcription template. The specific enzymatic digestion process for in vitro transcription and saRNA production is as follows: (1) Plasmid linearization: According to the instructions, use MluI restriction endonuclease to cut the linearized vector containing the DNA sequence shown in SEQ ID NO. 8, and verify the enzyme cutting effect by agarose gel electrophoresis.

[0063] (2) Purification of linearized plasmid: Purify the linearized plasmid according to the instructions of the DNA recovery kit (purchased from Chengdu Haoruilai Biotechnology Co., Ltd., HRL-ds0002). Add 3-5 volumes of DNA recovery reagent Buffer A to the enzyme digestion system, centrifuge through the column, wash twice with DNA recovery reagent Buffer B, dry, add 50 uL of water to elute the linearized plasmid, and measure the concentration.

[0064] (3) In vitro transcription: In vitro transcription was performed according to the instructions of the RNA in vitro transcription kit (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HRL-sr0004). DNase I was used to remove the transcription template by incubation at 37°C for 15 min. RNA was recovered according to the RNA purification kit (precipitation method) (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HR-mr130). 1 volume of water and 1.5 volumes of RNA purification buffer A were added and the mixture was incubated at -20°C for 30 min. The mixture was centrifuged at 12,000 rpm and 4°C for 15 min. RNA purification buffer B was added and the mixture was centrifuged at 12,000 rpm and 4°C for 5 min. This was repeated twice. After drying, RNase-free water was added to dissolve the RNA and the RNA concentration was determined.

[0065] (4) RNA capping: Heat denature the RNA at 65°C for 5 min and place on ice for 5 min. Cap the RNA according to the instructions of the RNA capping kit (Chengdu Haoruilai Biotechnology Co., Ltd., HR-sr0001). Purify the RNA according to the RNA purification kit. Add 1.5 times the volume of RNA purification buffer A and place it at -20°C for 30 min. Centrifuge at 12,000 rpm at 4°C for 15 min. Add RNA purification buffer B and centrifuge at 12,000 rpm at 4°C for 5 min. Repeat twice. After drying, add an appropriate amount of RNase-free water to dissolve the RNA and measure the RNA concentration.

[0066] The RNA obtained by transcription and purification is encapsulated in LNP: (1) The LNP of the present invention is prepared as follows: the four components of lipids are dissolved in ethanol, and the liposome nanoparticles are prepared according to the formula of the prior art, using cationic lipid SM-102, auxiliary lipid DSPC, cholesterol, PEG lipid DMG-PEG 2000 The mixture was mixed at a molar ratio of 50:10:38.5:1.5 to obtain a lipid mixture LNP.

[0067] (2) The RNA was resuspended in RNA encapsulation buffer (HR-mr115, Chengdu Haoruilai Biotechnology Co., Ltd.) and encapsulated into RNA-LNP using microfluidic technology. Specifically, the prepared LNP was used as the organic phase and the buffer containing the synthesized RNA was used as the aqueous phase. The organic phase and the aqueous phase were mixed at a total flow rate of 12 mL / min on a microfluidic device at a ratio of 1:3 to obtain RNA-LNP, which was then purified and concentrated by ultrafiltration or purified by dialysis.

[0068] Ultrafiltration purification and concentration: The obtained RNA-LNP was centrifuged three times using LNP-mRNA storage solution Buffer A (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HR-mr110-1) according to the instructions; LNP-mRNA storage solution Buffer B (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HR-mr110-2) was centrifuged three times according to the instructions. Finally, the LNP-mRNA was pipetted into RNase-free EP tubes and stored at -80°C. The obtained RNA-LNP encapsulation efficiency was 92%, and the RNA content was 0.1 μg / μL.

[0069] Dialysis method: After dialyzing the RNA-LNP with PBS, the LNP-mRNA storage solution Buffer B was centrifuged three times according to the instructions. Finally, the LNP-mRNA was pipetted into RNase-free EP tubes and stored at -80°C. The obtained RNA-LNP encapsulation efficiency was 93%, and the RNA content was 0.1 μg / μL.

[0070] Comparative Example 1: Preparation of saRNA-Luciferase Vaccine The preparation of the saRNA-Luciferase vaccine in this comparative example was similar to that in Example 1, except that the target gene Rplp0 sequence was replaced with the Luciferase sequence (SEQ ID NO. 2). This is referred to as the saRNA-Vehicle control group.

[0071] Experimental Example 1: Efficacy of saRNA-Rplp0 vaccine in treating pulmonary fibrosis in mice In order to study the ability of the saRNA-Rplp0 vaccine prepared in Example 1 to treat pulmonary fibrosis in mice, the mice were injected intramuscularly with the saRNA-Rplp0 vaccine (effective dose 1 μg / mouse) dissolved in sterile PBS on days 0, 7, and 14, and each mouse was given 3 mg / kg bleomycin sublingually on day 1 to establish an in vivo mouse pulmonary fibrosis model. The weight changes of the mice were recorded during the modeling period. After 28 days of modeling, the mice were sacrificed, their weights were calculated, and lung tissues were isolated and used to evaluate the pathological indicators related to pulmonary fibrosis. Figure 1 As shown in a, saRNA-Rplp0 vaccine immunization can effectively reduce the weight loss of mice caused by bleomycin. At the same time, the lung weight and lung coefficient (lung weight / body weight) of mice were also significantly improved, as shown in Figure 1 As shown in Figures 1b and 1c. Hydroxyproline is one of the main components of collagen tissue and is a collagen-specific amino acid. It is one of the important evaluation indicators of pulmonary fibrosis. Therefore, we used a hydroxyproline detection kit to analyze the hydroxyproline content in the lung tissue of each group of mice. Figure 1As shown in Figure d, the hydroxyproline content in the lung tissue of the mice in the treatment group was significantly lower than that in the model group and the control group. The qPCR results showed that the FN and Col1a in the lung tissue of the mice in the treatment group decreased at the RNA level. Figure 1 e and 1f. Western Blot results also showed that the levels of Col1a1, Fibronectin and Rplp0 in the lung tissues of the treated mice were significantly reduced. Figure 1 As shown in g.

[0072] The lung tissue sections of each group of mice were used for Masson staining and immunohistochemical staining. The results of Masson staining are shown in Figure 2. Figure 2 As shown in a, the collagen deposition in the lung tissue of the treatment group was also significantly improved. The results of immunohistochemistry also show that the positive fraction of α-SMA and Col1a in the lung tissue of the saRNA-Rplp0 treatment group was significantly lower than that of the model group and the control group. Figure 2 In summary, Rplp0 is the first discovered potential therapeutic target for pulmonary fibrosis. Its saRNA vaccine can effectively alleviate bleomycin-induced pulmonary fibrosis in mice and is a potential candidate vaccine for the treatment of pulmonary fibrosis.

[0073] The following are the nucleotide sequences involved in the saRNA of the present invention: Rplp0 gene sequence (SEQ ID NO. 1): ATGCCCAGGGAAGACAGGGCGACCTGGAAGTCCAACTACTTCCTCAAGATCATCCAACTTTTGGATGATTATCCAAAATGCTTCATTGTGGGAGCAGACAACGTGGGCTCCAAGCAGATGCAGCAGATCCGCATGTCGCTCCGAGGGAAGGCCGTGGTGCTGATGGGCAAGAACACCATGATGCGCAAGGCTATCAGGGGCCACCTGGAGAACAACCCAGCTCTGGAGAAACTGCTGCCTCACATCCGGGGGAACGTGGGCTTCGTGTTCACCAAGGAGGACCTCACTGAGATTCGGGATATGCTGTTGGCCAATAAGGTGCCAGCTGCTGCTCGGGCTGGTGCCATCGCCCCGTGTGAGGTCACTGTGCCAGCTCAGAACACTGGTCTAGGACCCGAGAAGACCTCCTTCTTCCAGGCTTTGGGCATCACCACGAAAATCTCCAGAGGCACCATTGAAATTCTGAGTGATGTGCAGCTGATAAAGACTGGAGACAAGGTGGGAGCCAGCGAGGCCACACTGCTGAACATGCTGAACATCTCCCCCTTCTCCTTCGGGCTGATCATCCAGCAGGTGTTTGACAACGGCAGCATTTATAACCCTGAAGTGCTCGACATCACAGAGCAGGCCCTGCACTCTCGCTTTCTGGAGGGTGTCCGCAACGTGGCCAGTGTGTGTCTGCAGATCGGGTACCCAACTGTTGCCTCGGTGCCACACTCCATCATCAATGGGTACAAGCGCGTCCTGGCATTGTCTGTGGAGACTGAGTACACCTTCCCACTTACTGAAAAGGTCAAGGCCTTCCTGGCTGATCCATCTGCATTTGCGGCTGCTGCCCCTGCAGCTGCTGCCACCACTGCTGCCCCTGCGGCTGCTGCAGCCCCTGCCAAAGCTGAAGCAAAGGAAGAGTCGGAGGAATCAGATGAGGATATGGGATTCGGTCTCTTCGACTAA; Gene of Luciferase (SEQ ID NO.2): T7 promoter (SEQ ID NO. 3): TAATACGACTCACTATAG; 5'UTR (SEQ ID NO.4): ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA; Alphavirus nonstructural protein (SEQ ID NO.5) 3'UTR (SEQ ID NO.6): AAAATTTTTATTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC; PolyA tail (SEQ ID NO.7): AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA; Full sequence of saRNA-Rplp0 plasmid vector (SEQ ID NO.8):

Claims

1. A saRNA, characterized in that: Transcribed from an alphavirus backbone vector, the alphavirus backbone vector includes the gene sequence of the immunogen Rplp0, the gene sequence of the immunogen is as shown in SEQ ID NO.1 or a gene sequence that has at least 90% homology with SEQ ID NO.1 and has the same or similar biological activity.

2. The saRNA according to claim 1, wherein: The alphavirus backbone vector includes a promoter, a 5'UTR, an alphavirus non-structural protein, a gene sequence of an immunogen, a 3'UTR and a PolyA tail; the nucleotide sequence of the promoter is shown in SEQ ID NO.3; the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.4; the nucleotide sequence of the alphavirus non-structural protein is shown in SEQ ID NO.5; the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.6; and the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.

7.

3. The saRNA according to claim 1 or 2, wherein: The nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.

8.

4. A saRNA vaccine for preventing and / or treating fibrosis, characterized in that: A vector comprising the saRNA according to any one of claims 1 to 3 and a saRNA delivery vector.

5. The saRNA vaccine according to claim 4, characterized in that: The delivery vehicle is selected from at least one of LNP, polymer nanoparticles or liposome complexes; preferably, the LNP components include: cationic lipid SM-102, auxiliary lipid DSPC, cholesterol and PEG lipid DMG-PEG 2000 ; The polymer nanoparticles are selected from at least one of the following: PEI, PAMAM, PLL, PPI; the liposome complex is selected from at least one of the following: DOTAP, DOTMA, DC-Chol, DOSPA.

6. A combination drug, characterized in that: Contains the saRNA according to any one of claims 1 to 3 or the saRNA vaccine according to any one of claims 4 to 5, administered separately or simultaneously, and other drugs for preventing and / or treating fibrotic diseases.

7. Use of the saRNA according to any one of claims 1 to 3, the saRNA vaccine according to any one of claims 4 to 5, or the combination drug according to claim 6 in the preparation of a drug for treating and / or preventing fibrotic diseases.

8. The use according to claim 7, characterized in that: The drug is a pharmaceutical preparation administered by injection, oral administration, nasal mucosa, lungs, rectum, oral mucosa or skin; preferably, the drug is an injection preparation, and the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

9. The use according to claim 7 or 8, characterized in that: The fibrotic disease is selected from at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, renal fibrosis, cardiac fibrosis, endometrial fibrosis, ocular fibrosis, splenic fibroproliferative disease, myelofibrosis or skin fibrosis; preferably, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or other pulmonary fibrosis.

10. The method for preparing saRNA according to any one of claims 1 to 3, wherein: The following steps are involved: (1) Enzymatically digest the plasmid containing the DNA sequence shown in SEQ ID NO. 8 to obtain a linearized template, which was then purified; (2) The purified linearized template is transcribed in vitro and purified to obtain purified RNA; (3) Capping and purifying the purified RNA obtained in step (2) to obtain saRNA.